• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    The invention provides novel genetic constructions for the expression of inhibitory RNA in the cytoplasm of eukaryotic cells. The inhibitory RNA may be an anti-sense RNA or a co-suppressor RNA, and functions to reduce the expression of a gene of interest in the target cell. The genetic constructions of the invention are capable of replicating in the cytoplasm of a eukaryotic cell and comprise a promoter region in functional combination with an encoding polynucleotide. The genetic constructions may be designed so as to replicate in the cytoplasm of plant cells, yeast cells, and mammalian cells. When the eukaryotic cell of interest is a plant cell, the genetic construction is preferably derived from a plant RNA virus. Plant RNA virus derived genetic constructions may employ a plant virus subgenomic promoter, including subgenomic promoters from tobamoviruses in functional combination with the RNA encoding region. In a preferred embodiment of the invention, plant cells are induced to produce elevated levels of the carotenoid phytoene. The elevated levels of phytoene are achieved by inhibiting the expression of the enzyme phytoene desaturase using the vectors of the invention.
    公开号:US20010006797A1
    申请号:US09/265,576
    申请日:1999-03-09
    公开日:2001-07-05
    发明作者:Monto H. Kumagai；Guy R. della-Cioppa；Jonathan Donson；Damon A. Harvey；Laurence K. Grill
    申请人:Large Scale Biology Corp；
    IPC主号:C12N15-1137
    专利说明:
    [0001] This invention is in the field of gene regulation through anti-sense RNA endogenously produced inhibitory RNA molecules such as anti-sense RNA and co-suppressor RNA. [0001] BACKGROUND
    [0002] One of the primary goals of genetic engineering has been to control the expression of selected genes in eukaryotic organisms of interest. While it has been relatively straightforward to insert new genes for expression into eukaryotic cells, the targeting of endogenous genes for reduced expression has been more difficult to achieve. Site-directed inactivation of genes in higher organisms has required extremely complex genetic manipulations and is not applicable to a wide range of organisms. One method of reducing the expression of specific genes in eukaryotic organisms has been through the use of anti-sense RNA and through co-suppression. [0002]
    [0003] Anti-sense RNA has been used to reduce the expression of pre-selected genes in both plants and animals. Descriptions of the use of anti-sense RNA to reduce the expression of selected genes in plants can be found, among other places in U.S. Pat. No. 5,107,065, Smith et al., [0003] Nature 334:724-726 (1988), Van der Krol et al., Nature 333:866-869 (1988), Rothstein et al., Proc. Natl. Acad. Sci. USA 84:8439-8443 (1987), Bird et al., Bio/Technology 9:635-639 (1991), Bartley et al., Biol. Chem. 267:5036-5039 (1992), and Gray et al., Plant Mol. Bio. 19:69-87 (1992).
    [0004] Another method of reducing the expression of specific genes in eukaryotic organisms is through the use of co-suppressor RNA. Co-suppressor RNA, in contrast to anti-sense RNA, is in the same orientation as the RNA transcribed from the target gene, i.e., the “sense” orientation. [0004]
    [0005] It is possible that biochemical pathways in plants transfected with hybrid viruses could be altered by overproducing an enzyme involved in a rate-limiting step, or by inhibiting the synthesis of an enzyme via antisense RNA. Although the expression of numerous genes in transgenic plants have been repressed by antisense RNA, the actual mechanism and location of inhibition is not known. In the nucleus, antisense RNA may directly interfere with transcription or form duplexes with the heterogeneous nuclear (hnRNA). There is evidence that inhibition of endogenous genes can occur in transgenic plants containing sense RNA, A. R. van der Krol et al., [0005] Nature 333:866-869 (1988) and C. Napoli et al., Plant Cell 2:279-289 (1990). Mechanism of this down regulation or “co-suppression” is thought to be caused by the production of antisense RNA by read through transcription from distal promoters located on the opposite strand of the chromosomal DNA (Greison, et al. Trends in Biotech. 9:122-123 (1991)). Alternatively, in the cytoplasm, antisense RNA may form a double-stranded molecule with the complimentary mRNA and prevent the translation of mRNA into protein.
    [0006] Tobamoviruses, whose genomes consist of one plus-sense RNA strand of approximately 6.4 kb, replicate solely in the cytoplasm, and can be used as episomal RNA vectors to alter plant biochemical pathways. Hybrid tobacco mosaic (TMV)/odontoglosum ringspot viruses (ORSV) have been used previously to express heterologous enzymes in transfected plants (Donson, et al., [0006] Proc. Natl. Acad. Sci. USA 88:7204 (1991) and Kumagai, et al., Proc. Natl. Acad. Sci. USA 90:427-430 (1993), minus-Sense RNA Strand (Miller, et al.). Infectious RNA transcripts from viral cDNA clones encode proteins involved in RNA replication, movement, and encapsidation (10). Subgenomic RNA for messenger RNA synthesis is controlled by internal promoters located on the minus-sense RNA strand (N. benthamiana plants were inoculated with in vitro transcripts as described previously [W. O. Dawson, et al., Proc. Natl. Acad. Sci. USA 83:1832 (1986)]). Insertion of foreign genes into a specific location under the control of an additional subgenomic RNA promoter have resulted in systemic and stable expression of neomycin phosphotransferase and α-trichosanthin (Donson, et al., Proc. Natl. Acad. Sci. USA 88:7204 (1991) and Kumagai, et al., Proc. Natl. Acad. Sci. USA 90:427-430 (1993)).
    [0007] One of the many biochemical pathways that could serve as a target for genetic manipulation is the biosynthesis of carotenoids. On the first committed step in carotenoid biosynthesis in higher plants is the condensation of two geranylgeranyl pyrophosphate molecules to phytoene, a colorless C[0007] 40 hydrocarbon, by the enzyme phytoene synthase. In the ripening fruit of Lycopersicon esculentum, phytoene synthase is a monomeric, chloroplast localized protein with an approximate relative molecular mass of 42 kDa. This enzyme is initially synthesized as a 47-kDa preprotein and is processed by the removal of a transit peptide during import to the chloroplast (Bartley, et al., J. Biol. Chem. 267:5036-5039 (1992)). Transgenic tomato plants containing anti-sense to phytoene synthase mRNA produce yellow fruit and pale flowers. Although the fruit specific carotenes are reduced by 97%, the levels of carotenoids in the leaves of the transgenic plants are unaffected, (Bird, et al., Bio/Technology 9:635-639 (1991)). It has been proposed that an additional set of biosynthetic genes occurs in plants which regulate the expression of leaf specific carotenoids.
    [0008] The subsequent step in the biosynthetic pathway is the modification of the colorless phytoene to phytofluene and ζ-carotene by phytoene desaturase. Among higher plants, the isolation of gene encoding this enzyme has been described for tomato, Pecker, et al., [0008] Proc. Natl. Acad. Sci. USA, 89:4962 (1992), and Arabidopsis thaliana (Scolnick and Bartley, Plant Physiol. 103:147 (1993)). Phytoene desaturase is inhibited by norflurazon, a bleaching herbicide, in a reversible, non-competitive manner (Sandman, et al., Target Sites of Herbicide Actions, G. Sandman, P. Boger Es. (RC press, Boca Rotan (1989)). Application of this compound causes a dramatic decrease in leaf carotenoids and chlorophylls and a subsequent accumulation of phytoene. The reduction of the photoprotective carotenoids derived from phytoene may cause a rapid destruction of chlorophyll by photooxidation.
    [0009] The need for new methods of reducing the expression of specific genes in eukaryotes is clearly established. The invention described herein provides new methods for reducing the expression of selected genes, genetic constructions for practicing the methods, and cells transformed by these genetic constructions, and higher organisms comprising the transformed cells. [0009] SUMMARY OF THE INVENTION
    [0010] One aspect of the invention is to provide novel genetic constructions for the expression of inhibitory RNA in the cytoplasm of eukaryotic cells. The genetic constructions of the invention are capable of replicating in the cytoplasm of a eukaryotic cell and comprise a promoter region in functional combination with an inhibitory RNA encoding polynucleotide, i.e., encoding an anti-sense RNA or a co-suppressor RNA. The genetic constructions of the invention may be designed so as to replicate in the cytoplasm of plant cells, yeast cells, or mammalian cells. When the eukaryotic cell of interest is a plant cell, the genetic construction is preferably derived from a plant RNA virus, more preferably a positive single-stranded RNA virus. Plant RNA virus derived genetic constructions may comprise a plant virus subgenomic promoter, including subgenomic promoters from tobamoviruses, in functional combination with the inhibitory RNA encoding region. [0010]
    [0011] Another aspect of the invention is to provide cells comprising the genetic constructions of the invention and to provide organisms comprising a plurality of such cells. [0011]
    [0012] Another aspect of the invention is to provide methods of reducing the expression of a gene of interest in eukaryotic cells, i.e., methods of producing eukaryotic cells exhibiting reduced levels of expression of a gene of interest. The methods of the invention comprise the step of transforming a cell with a genetic construction of the invention in which the inhibitory RNA encoding region is specific for the gene of interest. Another aspect of the invention is to provide plant cells that produce elevated levels of the carotenoid phytoene. The elevated levels of phytoene are achieved by inhibiting the expression at the enzyme phytoene desaturase using the vectors of the invention. [0012] BRIEF DESCRIPTION OF THE FIGURES
    [0013] FIG. 1. Phytoene expression vector TTO1/PSY+. This plasmid contains the TMV-U1 126-, 183-, and 30-kDa ORFs, the ToMV coat protein gene (ToMVcp), the SP6 promoter, the tomato phytoene synthase gene, and part of the pBR322 plasmid. The TAA stop codon in the 30-kDa ORF is underlined. The TMV-U1 subgenomic promoter located within the minus strand of the 30-kDa ORF controls the expression of phytoene synthase. The putative transcription start point (tsp) of the subgenomic RNA is indicated with a period (.). A portion of the N terminal amino acid sequence of phytoene synthase (SEQ ID NO: 11) is given. The DNA sequence encoding this portion of the plasmid is also given (SEQ ID NO: 10). [0013]
    [0014] FIG. 2. Nucleotide sequence comparison of [0014] N. benthamiana leaf phytoene desaturase (PDS1-Nb) (SEQ ID NO: 14) and tomato phytoene desaturase (PDS-Le) (SEQ ID NO: 15). The nucleotides are aligned to maximize sequence similarity. DESCRIPTION OF THE SPECIFIC EMBODIMENTS
    [0015] Definitions [0015]
    [0016] The term “inhibitory RNA”, as used herein, refers to an RNA molecule that interferes with the expression of a target gene. An “inhibitory RNA” is specific for one or more target genes. An inhibitory RNA may be an anti-sense RNA with respect to an RNA molecule transcribed from the target gene. Alternatively, the target gene inhibitory RNA may be a co-suppressor RNA with respect to an RNA molecule transcribed from the target gene. [0016]
    [0017] The term “anti-sense RNA” as used herein, refers to an RNA molecule that is capable of forming a duplex with a second RNA molecule. Thus a given RNA molecule is said to be an anti-sense RNA molecule with respect to a second, complementary or partially complementary RNA molecule, i.e., the target molecule. An anti-sense RNA molecule may be complementary to a translated or an untranslated region of a target RNA molecule. The anti-sense RNA need not be perfectly complementary to the target RNA. Anti-sense RNA may or may not be the same length of the target molecule; the anti-sense RNA molecule may be either longer or shorter than the target molecule. [0017]
    [0018] The term “co-suppressor RNA” refers to an RNA molecule that effects suppression of expression of a target gene where the RNA is partially homologous to an RNA molecule transcribed from the target gene. A co-suppressor RNA molecule is the RNA molecule that effects co-suppression as described in U.S. Pat. No. 5,231,020, Krol et al., [0018] Biotechniques 6:958-976 (1988), Mol et al., FEBS Lett. 268:427-430 (1990), and Grierson, et al., Trends in Biotech. 9:122-123 (1991) and similar publications. A “co-suppressor” RNA is in the sense orientation with respect to the target gene, i.e., the opposite orientation of the anti-sense orientation.
    [0019] The term “inhibitory RNA encoding polynucleotide” as used herein, refers to a polynucleotide, e.g., DNA, RNA, and the like, capable of being transcribed, when in functional combination with a promoter, so as to produce an inhibitory RNA molecule, e.g., an anti-sense RNA or a co-supressor RNA. Anti-sense RNA encoding polynucleotides and co-supressor encoding polynucleotides are both embodiments of the inhibitory RNA encoding polynucleotides. When the inhibitory RNA is an anti-sense RNA, the inhibitory RNA transcribed from the inhibitory RNA encoding polynucleotide region of the genetic constructions of the invention is preferably perfectly complementary to the entire length of the RNA molecule or molecules for which the anti-sense RNA is specific, i.e., the target. The anti-sense RNA encoding polynucleotide in the subject vectors may encode an anti-sense RNA that forms a duplex with a non-translated region of an RNA transcript such as an intron region, or 5′ untranslated region, a 3′ untranslated region, and the like. Similarly, a co-suppressor encoding polynucleotide in the subject vectors may encode an RNA that is homologous to translated or untranslated portions of a target RNA. An anti-sense RNA encoding polynucleotides may be conveniently produced by using the non-coding strand, or a portion thereof, of a DNA sequence encoding a protein of interest. [0019]
    [0020] The term “reduced expression,” as used herein, is a relative term that refers to the level of expression of a given gene in a cell produced or modified by the claimed methods as compared with a comparable unmodified cell, i.e., a cell lacking the subject vector, under a similar set of environmental conditions. Thus, a cell modified by the subject methods, i.e., a cell having “reduced expression” of the gene of interest, may express higher levels of that gene under a first set of environmental conditions, than a comparable unmodified cell under a second set of environmental conditions, if the second set of conditions is highly favorable to gene expression. [0020]
    [0021] The Invention [0021]
    [0022] The invention described herein exploits the discovery that RNA can reduce the expression of a target gene through inhibitory RNA interactions with target mRNA that take place in the cytoplasm of a eukaryotic cell, rather than in the nucleus. Prior to the invention, it was not known if inhibitory RNA reduced gene expression by means of an interaction that takes place in the cytoplasm or an interaction that takes place in the nucleus. Thus, prior to the invention, it was necessary to produce inhibitory RNA in the nucleus so as to be certain that inhibition would be achieved. Furthermore, it was not known if adequate concentrations of inhibitory RNA could be provided in the cytoplasm. Cytoplasmic expression of inhibitory RNA (specific for target genes) has numerous advantages over nuclear expression, these advantages include the ability to use high level expression vectors that are not suitable for nuclear expression. The use of such vectors is particularly advantageous in plants, because vectors capable of systemically infecting plants may be used to produce the inhibitory RNA. The invention described herein has many aspects. These aspects include novel genetic constructions for the expression of target gene inhibitory RNA in the cytoplasm of eukaryotic cells, cells transfected with these genetic constructions, multicellular organisms comprising the transfected cells, and methods for reducing the expression of selected genes in a cell by transforming a cell with a genetic construction of the invention. [0022]
    [0023] There are numerous ways to produce the genetic constructions of the invention. Techniques for manipulating polynucleotides, e.g., restriction endonuclease digestion and ligation, are well known to a person of ordinary skill in the art. These conventional polynucleotide manipulation techniques may be used to produce and use the genetic construction of the invention. While some optimization of standard techniques may be employed to produce the subject genetic constructions, significant experimentation is not required to produce the genetic constructions or practice the claimed methods. [0023]
    [0024] The genetic constructions of the invention comprise a promoter region in functional combination with an inhibitory RNA encoding polynucleotide. The promoter region is selected so as to be capable of driving the transcription of a polynucleotide sequence in a host cell of interest. Thus for example, when the eukaryotic cell is a plant cell, the promoter is selected so as to be able to drive transcription in plant cells. Promoters capable of functioning in a given eukaryotic cell are well known to a person of ordinary skill in the art. Examples of promoters capable of driving transcription in a cell of interest can be found, among other places in, Goeddel et al., [0024] Gene Expression Technology Methods in Enzymology Volume 185, Academic Press, San Diego (1991), Ausubel et al., Protocols in Molecular Biology, Wiley Interscience (1994), and similar publications. When the cell for transformation is a plant cell, the RNA virus subgenomic promoters are preferably used as promoter regions. RNA virus subgenomic promoter are described, among other places in Dawson and Lehto, Advances in Virus Research, 38:307-342, PCT published application WO 93/03161.
    [0025] The genetic constructions of the invention are capable of replication or maintenance, at least transiently, in the cytoplasm of eukaryotic cells of interest i.e., a base vector. Thus, the genetic constructions of the invention necessarily comprise a polynucleotide region derived from a vector capable of being replicated or stably maintained in eukaryotic cell of interest. Many vectors capable of replication (or stable maintenance) in different types of eukaryotic cells are known. For example, vectors for use in yeast cells include 2μ circle derived vectors. Information describing vectors yeast and their use in yeast can be found, among other places, in Goeddel, et al. supra, Ausubel et al., supra, and similar publications. [0025]
    [0026] Vectors for use in mammalian cells include bovine papilloma virus derived vectors, vaccinia derived vectors, semiliki forrest virus vectors and the like. Information describing mammalian cell vectors and their use in mammalian cells can be found, among other places is Goeddel, et al. supra, and Ausubel et al., supra. Vectors for use in plants include vectors derived from cauliflower mosaic virus, tobacco mosaic virus, tomato mosaic virus, and the like. Information describing plant cell vectors and their use in plant cells can be found, among other places, in PCT published application WO 93/03161, and Donson, et al., [0026] Proc. Natl. Acad. Sci. USA 88:7204-7208 (1991).
    [0027] The promoter driving transcription of the inhibitory RNA encoding region of the subject genetic constructions may be selected so as have a level of transcriptional activity sufficient to achieve the desired degree of expression of the target gene inhibitory RNA of interest. The promoter may be native or heterologous to the cell for genetic modification. The promoter may also be native or heterologous to the base vector, i.e., the portion of the vector other than the promoter and the inhibitory RNA encoding region. The promoter may be inducible or constitutive. Preferably, strong promoters are used to drive transcription of the inhibitory RNA encoding polynucleotide when the target RNA is highly expressed. [0027]
    [0028] The invention also provides methods of reducing the expression of a gene or genes of interest in a eukaryotic cell. As a consequence of providing the subject methods of reducing gene expression in eukaryotic cell, the subject invention also provides methods of producing a eukaryotic cell having reduced expression of a gene of interest and eukaryotic cells that have reduced expression of a gene of interest, as produced by the methods of the invention. Reduction of gene expression is achieved by introducing one or more of the vectors of the invention into a eukaryotic cell. The vector used to transform the cell of interest comprises an inhibitory RNA encoding polynucleotide that encodes an inhibitory RNA specific for the gene for which reduced expression is sought. The method of reducing expression of the gene of interest comprises the step of introducing the subject genetic vector into a host cell that is capable of expressing the gene of interest under certain environmental conditions. The vector may be introduced into a cell of interest by any of a variety of well known transformation methods. Such methods include: infection, transfection, electroporation, ballistic projectile transformation, conjugation, and the like. The inventive aspect of the subject methods is not dependent upon the particular means by which the inhibitory RNA encoding vector is introduced into the cell of interest. The particular methods of introducing the vector into a cell of interest is, in part, dependent upon the particular cell for modification and the precise type of vector selected. [0028]
    [0029] When the eukaryotic cells of interest for genetic modification by the subject vectors are plant cells, the vectors are preferably derived from RNA plant viruses. Preferred RNA plant virus vectors are positive strand single stranded RNA viruses. RNA plant virus vectors may be conveniently manipulated and introduced into cells in a DNA form instead of working directly with RNA vectors. Viral vector derived from tobamoviruses are particularly preferred. Descriptions of suitable plant virus vectors that may be modified so as to contain an inhibitory RNA encoding region in functional combination with a promoter as well as how to make and use such vectors, can be found in, among other places, PCT publication number WO 93/03161, Kumagai et al., [0029] Proc. Natl. Acad. Sci. USA 90:427-430 (1993).
    [0030] The invention also provides polynucleotides encoding phytoene synthase and phytoene desaturase, as well as various vector for the expression of target gene inhibitory RNA specific for phytoene synthase genes or phytoene desaturase genes. The first committed step in carotenoid biosynthesis in higher plants is the condensation of two geranylgeranyl pyrophosphate molecules to phytoene, a colorless C[0030] 40 hydrocarbon, by the enzyme phytoene synthase. The subsequent step in the biosynthetic pathway is the modification of the colorless phytoene to phytofluene and ζ-carotene by phytoene desaturase.
    [0031] The invention provides polynucleotides encoding the phytoene desaturase enzyme from Nicotiana species and numerous derivatives thereof. Specifically, the invention provides, in purified form, polynucleotides encoding the phytoene desaturase of [0031] Nicotiana benthamiana. Additionally, the invention provides polynucleotides encoding tomato (Lycopersicon esculentum) phytoene synthase and phytoene desaturase. The phytoene synthase and phytoene desaturase encoding polynucleotides described herein may be used to produce inhibitory RNAs specific for phytoene synthase and phytoene desaturase genes from a variety of plant species. The phytoene synthase and phytoene desaturase inhibitory RNA are preferably produced by transcription of phytoene synthase or phytoene desaturase inhibitory RNA encoding polynucleotides in functional combination with a promoter region.
    [0032] The amino acid sequence of the various phytoene desaturase and the phytoene synthase enzymes described herein and the naturally occurring polynucleotide sequences encoding these enzymes enable a person of ordinary skill in the art of molecular biology to design and construct a variety of related molecules having useful properties similar to these enzymes and the polynucleotides obtained directly from the cloning of the cDNAs encoding these enzymes. In the case of polynucleotides, the degeneracy of the genetic code permits the person of ordinary skill in the art to produce numerous different polynucleotides encoding the same polypeptide, i.e., isocoding polynucleotides. The precise polynucleotide sequence produced may be selected so as to optimize expression in a particular host cell type, taking into account factors affecting expression such as codon frequency, potential mRNA secondary structures, methylation, and the like. The invention also provides a variety of polypeptides having the same enzymatic activity as phytoene desaturase and phytoene synthase, but differing in one or more amino acid residues, so as to produce a phytoene desaturase and phytoene synthase variant polypeptides. Variant polypeptides may be produced and designed in a wide variety of ways. Phytoene desaturase and phytoene synthase variants may be produced and designed by introducing mutations (either random or by design) into a polynucleotide sequence encoding the enzyme, transforming the mutated enzyme encoding polynucleotide (operably linked to a suitable promoter) into a host cell, and subsequently assaying the host cell for the expression of the desired enzymatic activity. The identity of mutations in Srf I encoding polynucleotides introduced randomly, may be determined by sequencing the polynucleotide encoding the enzyme. [0032]
    [0033] The invention also provides for the recombinant DNA expression of phytoene desaturase and phytoene synthase (as well as variants thereof). The recombinant expression of these enzyme may be achieved through standard recombinant DNA expression technology. Suitable recombinant DNA expression technology can be found, among other places, in Goeddel, et al., [0033] Gene Expression Technology: Methods in Enzymology Volume 185 Academic Press, San Diego (1991). The enzyme may be expressed in a wide range of host cells, including both eukaryotic and prokaryotic host cells. One advantage of providing the subject enzymes by recombinant DNA methodology is the production of increased amounts of enzyme from reduced amounts of cellular material.
    [0034] Another advantage of the recombinant production of the enzymes is the ability to produce the enzyme free of certain contaminants. Phytoene synthase and phytoene desaturase (and variants thereof) produced by recombinant DNA techniques may be purified by procedures similar to the procedures described herein for the purification of the non-recombinant enzyme. Guidance in devising and modifying enzyme purification procedures can be found, among other places in Deutscher, [0034] Guide to Protein Purification Methods in Enzymology—Volume 182, Academic Press, San Diego (1990), Scopes Protein Purification: Principles and Practice, 3rd edition, Springer-Verlag, NY (1993), and the like.
    [0035] The invention may be better understood by referring to the following examples. The following examples are offered for the purpose of illustrating the invention and should not be interpreted as a limitation of the invention. [0035] EXAMPLES Example 1
    [0036] Isolation of tomato mosaic virus cDNA. [0036]
    [0037] An 861 bp fragment (5524-6384) from the tomato mosaic virus (fruit necrosis strain F; ToMV-F) containing the putative coat protein subgenomic promoter, coat protein gene, and the 3′ end was isolated by PCR using ToMV primers 5′ CTCGCAAAGTTTCGAACCAAATCCTC 3′ (SEQ ID NO: 1) (upstream) and 5′CGGGGTACCTGGGCCCCAACCGGGGGTTCCGGGGG3′ (SEQ ID NO: 2) (downstream) and subcloned into the HincII site of pBluescript KS−. A hybrid virus consisting of TMV-U1 and ToMV-F was constructed by swapping an 874-bp XhoI-KpnI ToMV fragment into pBGC152 (Kumagai, et al., [0037] Proc. Natl. Acad. Sci. USA 90:427-430 (1993)), creating plasmid TTO1. The inserted fragment was verified by dideoxynucleotide sequencing. A unique AvrII site was inserted downstream of the XhoI site in TTO1 by PCR mutagenesis, creating plasmid TTO1A, using the following oligonucleotides:
    [0038] 5′ TCCTCGAGCCTAGGCTCGCAAAGTTTCGAACCAAATCCTCA 3′ (SEQ ID NO: 3) (upstream), [0038]
    [0039] 5′ CGGGGTACCTGGGCCCCAACCGGGGGTTCCGGGGG 3′ (SEQ ID NO: 2) (downstream). [0039] Example 2
    [0040] Isolation of a cDNA encoding tomato phytoene synthase and a partial cDNA encoding tomato phytoene desaturase. [0040]
    [0041] Partial cDNAs were isolated from ripening tomato fruit RNA by polymerase chain reaction (PCR) using the following oligonucleotides: PSY, 5′ TATGTATGGTGCAGAAGAACAGAT 3′ (SEQ ID NO:4) (upstream), 5′ AGTCGACTCTTCCTCTTCTGGCATC 3′ (SEQ ID NO: 5) (downstream); PDS, 5′ TGCTCGAGTGTGTTCTTCAGTTTTCTGTCA 3′ (SEQ ID NO: 6) (upstream), 5′ AACTCGAGCGCTTTGATTTCTCCGAAGCTT 3′ (SEQ ID NO: 7) (downstream). Approximately 3×10[0041] 4 colonies from a Lycopersicon esculentum cDNA library were screened by colony hybridization using a 32 P labelled tomato phytoene synthase PCR product. Hybridization was carried out at 42° C. for 48 h in 50% formamide, 5× SSC, 0.02 M phosphate buffer, 5× Denhart's solution, and 0.1 mg/ml sheared calf thymus DNA. Filters were washed at 65° C. in 0.133 SSC, 0.1% 50% SDS prior to autoradiography. PCR products and the phyoene synthase cDNA clones were verified by dideoxynucleotide sequencing. Example 3
    [0042] DNA sequencing and computer analysis. [0042]
    [0043] A 1.2 Kb PstI, BamHI fragment containing the phytoene synthase cDNA and a 0.7 Kb the partial phytoene desaturase cDNA was subcloned into pBluescript KS+ (Stratagene, La Jolla, Calif.). The nucleotide sequencing of KS +/PDS #38 and KS+/5′3′ PSY was carried out by dideoxy termination using single stranded templates. Nucleotide sequence analysis and amino acid sequence comparisons were performed using PCGENE and DNA Inspector IIE programs. [0043] Example 4
    [0044] Construction of the tomato phytoene synthase expression vector. [0044]
    [0045] A 1253 base pair XhoI fragment containing the tomato phytoene synthase cDNA was subcloned into TTO1. The vector TTO1/PSY+ (FIG. 1) contains the phytoene synthase cDNA (positive orientation) under the control of the TMV-U1 coat protein subgenomic promoter; while, the vector TTO1/PSY − contains the phytoene synthase cDNA in the anti-sense orientation. [0045] Example 5
    [0046] Construction of a viral vector containing a partial tomato phytoene destaturase cDNA. [0046]
    [0047] An XhoI fragment containing the partial tomato phytoene desaturase cDNA was subcloned into TTO1. The vector TTO1A/PDS+ contains the phytoene desaturase cDNA (positive orientation) under the control of the TMV-U1 coat protein subgenomic promoter; while, the vector TTO1/PDS− contains the phytoene desaturase cDNA in the antisense orientation. [0047]
    [0048] A partial cDNA encoding phytoene desaturase was isolated from [0048] N. benthamiana leaf RNA by RT-PCR using the following oligonucleotides: PDS, 5′ GGCACTCAACTTTATAAACC 3′ (SEQ ID NO: 8) (upstream), 5′ CTTCAGTTTTCTGTCAAACC 3′ (SEQ ID NO: 9) (downstream) and verified by dideoxynucleotide sequencing. Example 6
    [0049] Transfection and analysis of [0049] N. benthamiana [TTO1/PSY+, TTO1/PSY, TTO1/PDS700+, TTO1/PDS700−].
    [0050] Infectious RNAs from TTO1/PSY+ (FIG. 1), TTO1/PSY−, TTO1A/PDS+, TTO1/PDS− were prepared by in vitro transcription using SP6 DNA-dependent RNA polymerase and were used to mechanically inoculate [0050] N. benthamiana (Dawson, et al., Adv. Virus Res. 38:307 (1990)). The hybrid viruses spread throughout all the non-inoculated upper leaves as verified by transmission electron microscopy, local lesion infectivity assay, and polymerase chain reaction (PCR) amplification. The viral symptoms consisted of distortion of systemic leaves, plant stunting, and mild chlorosis. Plants transfected with TTO1/PSY+ showed at least a two fold increase in phytoene synthase activity over plants transfected with viral vector controls. Leaves from systemically infected TTO1/PSY+ plants developed a bright orange phenotype and accumulated high levels of phytoene (Table 1). The leaves and sepals from TTO1/PDS− plants developed a white bleaching phenotype similar to that seen with the herbicide norflurazon. The structure of the chloroplasts from TTO1/PSY+ and TTO1/PDS− transfected plants, when analyzed by transmission electron microscopy, appeared to be normal. Leaves from systemically infected TTO1A/PDS+ plants developed a bleaching white phenotype approximately one week later than leaves from antisense TTO1/PDS− plants and also accumulated high levels of phytoene.
    [0051] Agarose gel electrophoresis of PCR cDNA isolated from virion RNA and Northern blot analysis of virion RNA indicate that the vectors are maintained in an extrachromosomal state and have not undergone any detectable intramolecular rearrangements. [0051] TABLE I Quantitation of phytoene leaves of N. benthamianatransfected with viral transcripts Plant Phytoene μg/g FW fold increase N. benthamiana — 4.6 1N. benthamiana: TTO1/PDS− 234.8 51.0N. benthamiana: Norflurozon 339.8 73.9N. benthamiana: TTO1/PSY+ 52.4 11.4N. benthamiana: TTO1/PSY− 1.0 0.2 Example 7
    [0052] Purification and analysis of phytoene from transfected plants [0052]
    [0053] Phytoene was extracted in methanol and identified by its peak retention time and absorption spectra on a 25-cm Spherisorb ODS-1 5-μm column using acetonitrile/methanol/2-propanol (85:10:5) as a developing solvent at a flow rate of 1 ml/min. The phytoene isolated from systemically infected tissue had an identical retention time to phytoene from norflurozon treated plants. The, phytoene peak from [0053] N. benthamiana transfected with TTO1/PSY+ had a characteristic optical absorbance maxima at 276, 285, and 298 nm. One week after inoculation, plants transfected with viral encoded phytoene synthase showed a hundred-fold increase in phytoene compared to the levels in noninfected plants as measured by HPLL separation of carotenoids. The carotenoids were extracted in methanol and identified by their peak retention time and absorption spectra on a 25-cm Spherisorb ODS-15-μm column using acetonitrile/methanol/2-propanol (85:10:5) as a developing solvent. The expression of sense (TTO1A/PDS+) and antisense (TTO1/PDS−) RNA to a partial phytoene desaturase in transfected plants inhibited the synthesis of colored carotenoids and caused the systemically infected leaves to develop a white phenotype. HPLC analysis of these plants revealed that they also accumulated phytoene high levels. The bleaching of leaves was reproduced in control plants treated with the herbicide norflurozon, a non-competitive inhibitor of phytoene desaturase. Example 8
    [0054] Isolation of a partial cDNA encoding [0054] N. benthamiana phytoene desaturase.
    [0055] A partial cDNA clone that encodes for [0055] N. benthamiana phytoene desaturase was isolated from young leaf tissue. Nucleotide sequence comparison of 369 bp in the corresponding regions between tomato and N. benthamiana phytoene desaturase indicate that they are 92% similar to each other (FIG. 2). Since the two plant genes have areas of high homology, cytoplasmic inhibition of the endogenous plant gene by viral-derived antisense RNA may occur through the formation of hybrid, double stranded RNA molecules. The down regulation of phytoene desaturase in plants transfected with TTO1A/PDS + may be caused by direct interference during the translation of mRNA into protein or by duplexes formed between mRNA and viral-derived negative strand RNA, although the precise mechanism of action does not need to be known to carry out the invention. Example 9
    [0056] Construction of TTO1 and TTO1A expression vectors [0056]
    [0057] An 861 bp fragment (5524-6384) from the tomato mosaic virus (fruit necrosis strain F; ToMV-F) containing the putative coat protein subgenomic promoter, coat protein gene, and the 3′ end was isolated by PCR using ToMV primers 5′ CTCGCAAAGTTTCGAACCAAATCCTC 3′ (SEQ ID NO: 1) (upstream) and 5′ CGGGGTACCTGGGCCCCAACCGGGGGTTCCGGGGG 3′ (SEQ ID NO: 2) (downstream) and subcloned into the HincII site of pBluescript KS−. A hybrid virus consisting of TMV-U1 and ToMV-F was constructed by swapping an 874-bp XhoI-KpnI ToMV fragment into pBGC152 (I. Pecker, et al., [0057] Proc. Natl. Acad. Sci. USA 89:4962 (1992)), creating plasmid TTO1. The inserted fragment was verified by dideoxynucleotide sequencing. A unique AvrII site was inserted downstream of the XhoI site in TTO1 by PCR mutagenesis, creating plasmid TTO1A, using the following oligonucleotides:
    [0058] 5′ TCCTCGAGCCTAGGCTCGCAAAGTTTCGAACCAAATCCTCA 3′ (upstream) (SEQ ID NO: 3), [0058]
    [0059] 5′ CGGGGTACCTGGGCCCCAACCGGGGGTTCCGGGGG 3′ (SEQ ID NO: 2) (downstream). [0059] Example 10
    [0060] Construction of TTO1/PDS−, TTO1A/PDS+ [0060]
    [0061] Using PCR mutagenesis a XhoI fragment, encoding tomato phyotene synthase was amplified from a [0061] Lycopersicon esculentum cDNA clone isolated from a ripening fruit cDNA library, and placed under the control of the TMV-U1 coat protein subgenomic promoter by subcloning into TTO1. Example 11
    [0062] Inhibition of the expression of a specific endogenous plant gene (phytoene desaturase) using an RNA viral vector: Transfection and analysis of [0062] N. benthamiana [TTO1/PDS−, TTO1A/PDS+]
    [0063] Infectious RNAs from TTO1A/PDS+, TTO1/PDS− were prepared by in vitro transcription using SP6 DNA-dependent RNA polymerase and were used to mechanically inoculate [0063] N. benthamiana. The hybrid viruses spread throughout all the non-inoculated upper leaves as verified by transmission electron microscopy, local lesion infectivity assay, and polymerase chain reaction (PCR) amplification. The viral symptoms consisted of distortion of systemic leaves, plant stunting, and mild chlorosis. The leaves and sepals from TTO1/PDS− plants developed a white bleaching phenotype similar to that seen with the herbicide norflurazon. The structure of the chloroplasts from TTO1/PDS− transfected plants, when analyzed by transmission electron microscopy, appeared to be normal. Leaves from systemically infected TTO1A/PDS+ plants developed a bleaching white phenotype approximately one week later than leaves from antisense TTO1/PDS plants and also accumulated high levels of phytoene. Example 12
    [0064] Inhibition of the expression of a specific endogenous plant gene (phytoene synthase) using an RNA viral vector: Transfection and analysis of [0064] N. benthamiana [TTO1/PSY−]
    [0065] Infectious RNAs from TTO1/PSY− were prepared by in vitro transcription using SP6 DNA-dependent RNA polymerase and were used to mechanically inoculate [0065] N. benthamiana. The hybrid viruses spread throughout all the non-inoculated upper leaves as verified by transmission electron microscopy, local lesion infectivity assay, and polymerase chain reaction (PCR) amplification. The viral symptoms consisted of distortion of systemic leaves, plant stunting, and mild chlorosis. Plants transfected with TTO1/PSY+ showed at least a two fold increase in phytoene synthase activity over plants transfected with viral vector controls (data not shown). Leaves from systemically infected TTO1/PSY+ plants developed a bright orange phenotype and accumulated high levels of phytoene (Table 1). The leaves from TTO1/PDS− plants developed a light bleaching phenotype. The structure of the chloroplasts from TTO1/PSY− when analyzed by transmission electron microscopy, appeared to be normal. Leaves from systemically infected TTO1A/PSY− plants did not accumulate phytoene. Example 13
    [0066] Isolation of a partial cDNA encoding [0066] N. benthamiana phytoene desaturase
    [0067] A partial cDNA clone that encodes for [0067] N. benthamiana phytoene desaturase was isolated from young leaf tissue. Nucleotide sequence comparison of 380 bp in the corresponding regions between tomato and N. benthamiana phytoene desaturase indicate that they are 92% similar to each other (FIG. 2). Since the two plant genes have areas of high homology, cytoplasmic inhibition of the endogenous plant gene by viral-derived antisense RNA may occur through the formation of hybrid, double stranded RNA molecules. The down regulation of phytoene desaturase in plants transfected with TTO1A/PDS+ may be caused by direct interference during the translation of mRNA into protein or by duplexes formed between mRNA and viral-derived negative strand RNA. Example 15
    [0068] Analysis of PDS mRNA in Nicotina Cells Producing Tomato PDS Derived Specific Anti-sense RNA [0068]
    [0069] Reverse Transcriptase PCR experiments measuring the presence or absence of detectable PDS mRNA transcripts in [0069] N. benthamiana cells containing TTO1/PDS− (producing PDS anti-sense RNA) were performed. RNA was isolated from transfected plants by the method of Gailiano et al. The primers used to detect TTO1/L. esculeutum were 5′ TAATCGATGATGATTCGGAGGCTAC3′ (SEQ ID NO: 12) (upstream) 5′ GGCACTCAACTTTATAAACC3′ (SEQ ID NO: 8) (downstream). The primer used to detect N. benthamiana transcripts were 5′ GGCACTCAACTTTATAAACC3′ (SEQ ID NO: 8) (upstream) and 5′ CTCCTTTAATTGTACTGCCA3′ (SEQ ID NO: 13) (downstream). The PCR experiments were unable to detect endogenous PDS mRNA in the vector transfected plants, while the expected 452 bp anti-sense transcript could be detected. The 219 bp PDS mRNA could only be detected in the control, non-infected, N. benthamiana plants.
    [0070] Incorporation by reference [0070]
    [0071] All patents, patents applications, and publications cited are incorporated herein by reference. [0071]
    [0072] Equivalents [0072]
    [0073] The foregoing written specification is considered to be sufficient to enable one skilled in the art to practice the invention. Indeed, various modifications of the above-described makes for carrying out the invention which are obvious to those skilled in the field of molecular biology or related fields are intended to be within the scope of the following claims. [0073]
    权利要求:
    Claims (38)
    [1" id="US-20010006797-A1-CLM-00001] 1. A genetic vector capable of replication in the cytoplasm of a eukaryotic cell, the vector comprising a promoter region in functional combination with target gene inhibitor RNA encoding polynucleotide.
    [2" id="US-20010006797-A1-CLM-00002] 2. A vector according to
    claim 1 , wherein the eukaryotic cell is selected from the group consisting of plant cells, yeast cells, and mammalian cells.
    [3" id="US-20010006797-A1-CLM-00003] 3. A vector according to
    claim 2 , wherein the eukaryotic cell is a plant cell.
    [4" id="US-20010006797-A1-CLM-00004] 4. A vector according to
    claim 3 , wherein the vector is derived from a plant RNA virus.
    [5" id="US-20010006797-A1-CLM-00005] 5. A vector according to
    claim 4 , wherein the vector is derived from a single stranded RNA plant virus.
    [6" id="US-20010006797-A1-CLM-00006] 6. A vector according to
    claim 5 , wherein the promoter is a plant viral RNA subgenomic promoter.
    [7" id="US-20010006797-A1-CLM-00007] 7. A vector according to
    claim 6 , further comprising a second subgenomic promoter operably linked to a viral coat protein encoding polynucleotide.
    [8" id="US-20010006797-A1-CLM-00008] 8. A vector according to
    claim 7 wherein at least one of the subgenomic promoters is derived from a tobamovirus.
    [9" id="US-20010006797-A1-CLM-00009] 9. A method of producing a eukaryotic cell having reduced expression of a gene of interest, the method comprising the steps of transfecting a cell with a genetic vector according to
    claim 1 , wherein the anti-sense RNA encoded by the anti-sense RNA encoding polynucleotide is specific for the gene of interest.
    [10" id="US-20010006797-A1-CLM-00010] 10. A method according to
    claim 9 , wherein the eukaryotic cell is selected from the group consisting of plant cells, yeast cells, and mammalian cells.
    [11" id="US-20010006797-A1-CLM-00011] 11. A method according to
    claim 10 , wherein the eukaryotic cell is a plant cell.
    [12" id="US-20010006797-A1-CLM-00012] 12. A method according to
    claim 11 , wherein the vector is derived from a plant RNA virus.
    [13" id="US-20010006797-A1-CLM-00013] 13. A method according to
    claim 12 , wherein the vector is derived from a single stranded RNA plant virus.
    [14" id="US-20010006797-A1-CLM-00014] 14. A method according to
    claim 13 , wherein the promoter is a plant viral RNA subgenomic promoter.
    [15" id="US-20010006797-A1-CLM-00015] 15. A method according to
    claim 14 , further comprising a second subgenomic promoter operably linked to a viral coat protein encoding polynucleotide.
    [16" id="US-20010006797-A1-CLM-00016] 16. A method according to
    claim 15 wherein at least one of the subgenomic promoters is derived from a tobamovirus.
    [17" id="US-20010006797-A1-CLM-00017] 17. A eukaryotic cell produced by the method of
    claim 9 .
    [18" id="US-20010006797-A1-CLM-00018] 18. A eukaryotic cell according to
    claim 17 , wherein the eukaryotic cell is selected from the group consisting of plant cells, yeast cells, and mammalian cells.
    [19" id="US-20010006797-A1-CLM-00019] 19. A eukaryotic cell according to
    claim 10 , wherein the eukaryotic cell is a plant cell.
    [20" id="US-20010006797-A1-CLM-00020] 20. A eukaryotic cell according to
    claim 19 , wherein the vector is derived from a plant RNA virus.
    [21" id="US-20010006797-A1-CLM-00021] 21. A eukaryotic cell according to
    claim 20 , wherein the vector is derived from a single stranded RNA plant virus.
    [22" id="US-20010006797-A1-CLM-00022] 22. A eukaryotic cell according to
    claim 21 , wherein the promoter is a plant viral RNA subgenomic promoter.
    [23" id="US-20010006797-A1-CLM-00023] 23. A eukaryotic cell according to
    claim 22 , further comprising a second subgenomic promoter operably linked to a viral coat protein encoding polynucleotide.
    [24" id="US-20010006797-A1-CLM-00024] 24. A eukaryotic cell according to
    claim 23 wherein at least one of the subgenomic promoters is derived from a tobamovirus.
    [25" id="US-20010006797-A1-CLM-00025] 25. A plant comprising a plurality of cells according to
    claim 19 .
    [26" id="US-20010006797-A1-CLM-00026] 26. A plant according to
    claim 25 , wherein the vector is derived from a plant RNA virus.
    [27" id="US-20010006797-A1-CLM-00027] 27. A plant according to
    claim 26 , wherein the vector is derived from a single stranded RNA plant virus.
    [28" id="US-20010006797-A1-CLM-00028] 28. A plant according to
    claim 27 , wherein the promoter is a plant viral RNA subgenomic promoter.
    [29" id="US-20010006797-A1-CLM-00029] 29. A plant according to
    claim 28 , further comprising a second subgenomic promoter operably linked to a viral coat protein encoding polynucleotide.
    [30" id="US-20010006797-A1-CLM-00030] 30. A plant according to
    claim 29 wherein at least one of the subgenomic promoters is derived from a tobamovirus.
    [31" id="US-20010006797-A1-CLM-00031] 31. A eukaryotic cell comprising a vector according to
    claim 1 .
    [32" id="US-20010006797-A1-CLM-00032] 32. A eukaryotic cell according to
    claim 31 , wherein the eukaryotic cell is selected from the group consisting of plant cells, yeast cells, and mammalian cells.
    [33" id="US-20010006797-A1-CLM-00033] 33. A eukaryotic cell according to
    claim 32 , wherein the eukaryotic cell is a plant cell.
    [34" id="US-20010006797-A1-CLM-00034] 34. A eukaryotic cell according to
    claim 33 , wherein the vector is derived from a plant RNA virus.
    [35" id="US-20010006797-A1-CLM-00035] 35. A eukaryotic cell according to
    claim 34 , wherein the vector is derived from a single stranded RNA plant virus.
    [36" id="US-20010006797-A1-CLM-00036] 36. A eukaryotic cell according to
    claim 35 , wherein the promoter is a plant viral RNA subgenomic promoter.
    [37" id="US-20010006797-A1-CLM-00037] 37. A eukaryotic cell according to
    claim 36 , further comprising a second subgenomic promoter operably linked to a viral coat protein encoding polynucleotide.
    [38" id="US-20010006797-A1-CLM-00038] 38. A eukaryotic cell according to
    claim 37 wherein at least one of the subgenomic promoters is derived from a tobamovirus.
    类似技术:
    公开号 | 公开日 | 专利标题
    US6479291B2|2002-11-12|Cytoplasmic inhibition of gene expression by viral RNA
    US7485774B2|2009-02-03|Methods and means for delivering inhibitory RNA to plants and applications thereof
    EP1013771B1|2004-10-06|Non-nuclear chromosomal transformation
    US5889190A|1999-03-30|Recombinant plant viral nucleic acids
    JP3316209B2|2002-08-19|Recombinant plant virus nucleic acid
    KR20010040337A|2001-05-15|Method of determining the function of nucleotide sequences and the proteins they encode by transfecting the same into a host
    US20030027173A1|2003-02-06|Method of determining the function of nucleotide sequences and the proteins they encode by transfecting the same into a host
    US6054566A|2000-04-25|Recombinant animal viral nucleic acids
    WO2000063397A2|2000-10-26|Methods for delivering inhibitory rna to plants and applications thereof
    EP0832191A1|1998-04-01|Recombinant viral nucleic acids
    CA2309028C|2006-01-17|The cytoplasmic inhibition of gene expression
    JP3336307B2|2002-10-21|Plants resistant to multiple viruses and methods for producing the same
    US6479732B1|2002-11-12|cDNA of 4-coumarate: coenzyme a ligase and process for modifying lignin in plants
    WO2000042206A1|2000-07-20|An expression silencing system and different uses thereof
    同族专利:
    公开号 | 公开日
    AU710588B2|1999-09-23|
    DE69534421D1|2005-10-06|
    EP1087017A3|2001-11-28|
    WO1995034668A2|1995-12-21|
    MX9606476A|1997-05-31|
    US5922602A|1999-07-13|
    US20030219897A9|2003-11-27|
    US20040142477A1|2004-07-22|
    JPH10501968A|1998-02-24|
    US20020155605A1|2002-10-24|
    DE69534421T2|2006-06-29|
    US6376752B1|2002-04-23|
    EP0804600A1|1997-11-05|
    EP0804600B1|2002-07-31|
    WO1995034668A3|1996-02-01|
    AT303446T|2005-09-15|
    US6720183B2|2004-04-13|
    ES2246210T3|2006-02-16|
    CA2193094A1|1995-12-21|
    US20050204422A1|2005-09-15|
    AU2653495A|1996-01-05|
    DE69527654T2|2003-04-03|
    DE69527654D1|2002-09-05|
    AT221574T|2002-08-15|
    US6479291B2|2002-11-12|
    CA2193094C|2002-07-16|
    EP1087017B1|2005-08-31|
    ZA954451B|1996-02-05|
    IL113955D0|1995-08-31|
    ES2180641T3|2003-02-16|
    EP1087017A2|2001-03-28|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    US20020108151A1|1997-06-12|2002-08-08|Conkling Mark A.|Regulation of quinolate phosphoribosyl transferase expression|
    US20040031074A1|2000-11-07|2004-02-12|Conkling Mark A.|Putrescine-n-methyltransferase promotor|
    US20040144397A1|2001-06-08|2004-07-29|Conkling Mark A.|Modifying nicotine and nitrosamine levels in tobacco|
    US20040248299A1|2002-12-27|2004-12-09|Sumedha Jayasena|RNA interference|
    US20050072047A1|2002-04-09|2005-04-07|Conkling Mark A.|Tobacco having reduced nicotine and nitrosamines|
    US6911541B2|2000-08-30|2005-06-28|North Carolina State University|Promoter fragment that is recognized by the product of the tobacco Nic gene|
    US20050180912A1|1999-06-09|2005-08-18|Djamschid Amirzadeh-Asl|Process for producing barium sulfate, barium sulfate and use thereof|
    US20130254940A1|2011-09-13|2013-09-26|Daniel Ader|Methods and compositions for weed control|
    US9777288B2|2013-07-19|2017-10-03|Monsanto Technology Llc|Compositions and methods for controlling leptinotarsa|
    US9850496B2|2013-07-19|2017-12-26|Monsanto Technology Llc|Compositions and methods for controlling Leptinotarsa|
    US9988634B2|2010-03-08|2018-06-05|Monsanto Technology Llc|Polynucleotide molecules for gene regulation in plants|
    US10041068B2|2013-01-01|2018-08-07|A. B. Seeds Ltd.|Isolated dsRNA molecules and methods of using same for silencing target molecules of interest|
    US10100306B2|2013-11-04|2018-10-16|Monsanto Technology Llc|Compositions and methods for controlling arthropod parasite and pest infestations|
    US10240162B2|2012-05-24|2019-03-26|A.B. Seeds Ltd.|Compositions and methods for silencing gene expression|
    US10334848B2|2014-01-15|2019-07-02|Monsanto Technology Llc|Methods and compositions for weed control using EPSPS polynucleotides|
    US10378012B2|2014-07-29|2019-08-13|Monsanto Technology Llc|Compositions and methods for controlling insect pests|
    US10557138B2|2013-12-10|2020-02-11|Beeologics, Inc.|Compositions and methods for virus control in Varroa mite and bees|
    US10568328B2|2013-03-15|2020-02-25|Monsanto Technology Llc|Methods and compositions for weed control|
    US10609930B2|2013-03-13|2020-04-07|Monsanto Technology Llc|Methods and compositions for weed control|
    US10612019B2|2013-03-13|2020-04-07|Monsanto Technology Llc|Methods and compositions for weed control|
    US10655136B2|2015-06-03|2020-05-19|Monsanto Technology Llc|Methods and compositions for introducing nucleic acids into plants|
    US10683505B2|2013-01-01|2020-06-16|Monsanto Technology Llc|Methods of introducing dsRNA to plant seeds for modulating gene expression|
    US10760086B2|2011-09-13|2020-09-01|Monsanto Technology Llc|Methods and compositions for weed control|
    US10801028B2|2009-10-14|2020-10-13|Beeologics Inc.|Compositions for controlling Varroa mites in bees|
    US10806146B2|2011-09-13|2020-10-20|Monsanto Technology Llc|Methods and compositions for weed control|
    US10829828B2|2011-09-13|2020-11-10|Monsanto Technology Llc|Methods and compositions for weed control|
    US10883103B2|2015-06-02|2021-01-05|Monsanto Technology Llc|Compositions and methods for delivery of a polynucleotide into a plant|
    US10888579B2|2007-11-07|2021-01-12|Beeologics Inc.|Compositions for conferring tolerance to viral disease in social insects, and the use thereof|
    US10968449B2|2015-01-22|2021-04-06|Monsanto Technology Llc|Compositions and methods for controlling Leptinotarsa|
    US10988764B2|2014-06-23|2021-04-27|Monsanto Technology Llc|Compositions and methods for regulating gene expression via RNA interference|
    US11091770B2|2014-04-01|2021-08-17|Monsanto Technology Llc|Compositions and methods for controlling insect pests|JPS59216245A|1983-05-25|1984-12-06|Nec Corp|Normalizing circuit|
    US5190931A|1983-10-20|1993-03-02|The Research Foundation Of State University Of New York|Regulation of gene expression by employing translational inhibition of MRNA utilizing interfering complementary MRNA|
    US5272065A|1983-10-20|1993-12-21|Research Foundation Of State University Of New York|Regulation of gene expression by employing translational inhibition of MRNA utilizing interfering complementary MRNA|
    US5453566A|1986-03-28|1995-09-26|Calgene, Inc.|Antisense regulation of gene expression in plant/cells|
    US5107065A|1986-03-28|1992-04-21|Calgene, Inc.|Anti-sense regulation of gene expression in plant cells|
    EP0240332B1|1986-04-02|1995-07-12|Pioneer Hi-Bred International, Inc.|Virus resistant plants having antisense RNA|
    US5316931A|1988-02-26|1994-05-31|Biosource Genetics Corp.|Plant viral vectors having heterologous subgenomic promoters for systemic expression of foreign genes|
    US5922602A|1988-02-26|1999-07-13|Biosource Technologies, Inc.|Cytoplasmic inhibition of gene expression|
    US5231020A|1989-03-30|1993-07-27|Dna Plant Technology Corporation|Genetic engineering of novel plant phenotypes|
    US5034323A|1989-03-30|1991-07-23|Dna Plant Technology Corporation|Genetic engineering of novel plant phenotypes|
    WO1990012107A1|1989-03-31|1990-10-18|The Salk Institute Biotechnology/Industrial Associates, Inc.|Recombinant expression system based on satellite tobacco mosaic virus|
    SE466123B|1989-04-25|1991-12-16|Kvaser Consultant Ab|DEVICE FOR SYNCONIZING DATA IN A COMPUTER SYSTEM INCLUDING A COMMON SERIAL DATA COMMUNICATION CHANNEL|
    NL9001711A|1989-10-03|1991-05-01|Clovis Matton N V|GENETIC MANIPULATIONS WITH RECOMBINANT DNA INCLUDING SEQUENCES DERIVED FROM RNA VIRUS.|
    GB8928179D0|1989-12-13|1990-02-14|Ici Plc|Dna,constructs,cells and plants derived therefrom|
    EP0471056B1|1990-03-02|2001-10-17|BP Corporation North America Inc.|Biosynthesis of carotenoids in genetically engineered hosts|
    WO1991013994A1|1990-03-13|1991-09-19|Commonwealth Scientific And Industrial Research Organisation|Gene expression|
    DK0596979T3|1991-08-01|2002-05-13|Large Scale Biology Corp|Plant virus recombinant nucleic acids|
    GB9210273D0|1992-05-13|1992-07-01|Ici Plc|Dna|
    US5539093A|1994-06-16|1996-07-23|Fitzmaurice; Wayne P.|DNA sequences encoding enzymes useful in carotenoid biosynthesis|US5922602A|1988-02-26|1999-07-13|Biosource Technologies, Inc.|Cytoplasmic inhibition of gene expression|
    US6054566A|1988-02-26|2000-04-25|Biosource Technologies, Inc.|Recombinant animal viral nucleic acids|
    US20030150019A1|1988-02-26|2003-08-07|Large Scale Biology Corporation|Monopartite RNA virus transformation vectors|
    GB9611981D0|1996-06-07|1996-08-07|Zeneca Ltd|Enhancement of gene expression|
    BR9713462A|1996-08-09|2000-03-28|Calgene Inc|Methods for producing carotenoid compounds and special oils in plant seeds.|
    US6429356B1|1996-08-09|2002-08-06|Calgene Llc|Methods for producing carotenoid compounds, and specialty oils in plant seeds|
    GB9703146D0|1997-02-14|1997-04-02|Innes John Centre Innov Ltd|Methods and means for gene silencing in transgenic plants|
    GB9720148D0|1997-09-22|1997-11-26|Innes John Centre Innov Ltd|Gene silencing materials and methods|
    US6077992A|1997-10-24|2000-06-20|E. I. Du Pont De Nemours And Company|Binary viral expression system in plants|
    US6632980B1|1997-10-24|2003-10-14|E. I. Du Pont De Nemours And Company|Binary viral expression system in plants|
    US6506559B1|1997-12-23|2003-01-14|Carnegie Institute Of Washington|Genetic inhibition by double-stranded RNA|
    US6426185B1|1998-01-16|2002-07-30|Large Scale Biology Corporation|Method of compiling a functional gene profile in a plant by transfecting a nucleic acid sequence of a donor plant into a different host plant in an anti-sense orientation|
    US6303848B1|1998-01-16|2001-10-16|Large Scale Biology Corporation|Method for conferring herbicide, pest, or disease resistance in plant hosts|
    US20020164585A1|1998-01-16|2002-11-07|Sean Chapman|Method for enhancing RNA or protein production using non-native 5' untranslated sequences in recombinant viral nucleic acids|
    AU761367B2|1998-01-16|2003-06-05|Large Scale Biology Corporation|Method of determining the function of nucleotide sequences and the proteins they encode by transfecting the same into a host|
    US6468745B1|1998-01-16|2002-10-22|Large Scale Biology Corporation|Method for expressing a library of nucleic acid sequence variants and selecting desired traits|
    US6700040B2|1998-01-16|2004-03-02|Large Scale Biology Corporation|Cytoplasmic gene inhibition or gene expression in transfected plants by a tobraviral vector|
    US6300133B1|1998-01-16|2001-10-09|Large Scale Biology Corporation|RNA transformation vectors derived from an uncapped single-component RNA virus|
    WO2001007600A1|1999-07-21|2001-02-01|Large Scale Biology Corporation|Method of correlating sequence function by transfecting a nucleic acid sequence of a donor organism into a plant host in an anti-sense or positive sense orientation|
    US20030027173A1|1998-01-16|2003-02-06|Della-Cioppa Guy|Method of determining the function of nucleotide sequences and the proteins they encode by transfecting the same into a host|
    US6300134B1|1998-01-16|2001-10-09|Large Scale Biology Corporation|RNA transformation vectors derived from a single-component RNA virus and contain an intervening sequence between the cap and the 5′ end|
    US6653530B1|1998-02-13|2003-11-25|Calgene Llc|Methods for producing carotenoid compounds, tocopherol compounds, and specialty oils in plant seeds|
    AT526405T|1998-03-20|2011-10-15|Commw Scient Ind Res Org|SYNTHETIC GENES AND GENETIC COMPOSITIONS CONTAINING THESE|
    AUPP249298A0|1998-03-20|1998-04-23|Ag-Gene Australia Limited|Synthetic genes and genetic constructs comprising same I|
    US6759571B1|1998-04-01|2004-07-06|North Carolina State University|Method of suppressing gene expression in plants|
    SI1068311T1|1998-04-08|2011-07-29|Commw Scient Ind Res Org|Methods and means for obtaining modified phenotypes|
    WO1999055887A2|1998-04-24|1999-11-04|E.I. Du Pont De Nemours And Company|Carotenoid biosynthesis enzymes|
    US6600089B1|1998-04-24|2003-07-29|E. I. Du Pont De Nemours And Company|Carotenoid biosynthesis enzymes|
    FR2784688B1|1998-10-20|2002-12-13|Univ Grenoble 1|CDNA SEQUENCE DESCRIBED BY SEQ ID NO: 1 TRANSCRIBING AN mRNA ENCODING FOR TERMINAL OXIDASE ASSOCIATED WITH CAROTENOID BIOSYNTHESIS|
    EP2314700A1|1999-01-28|2011-04-27|Medical College of Georgia Research Institute, Inc|Composition and method for in vivo and in vitro attenuation of gene expression using double stranded RNA|
    EP1171610B1|1999-04-15|2007-04-04|Calgene LLC|Nucleic acid sequences to proteins involved in isoprenoid synthesis|
    AU775188B2|1999-04-20|2004-07-22|Bayer Cropscience Nv|Methods and means for delivering inhibitory RNA to plants and applications thereof|
    US7148400B1|1999-04-20|2006-12-12|Bayer Bioscience N.V.|Methods and means for delivering inhibitory RNA to plants and applications thereof|
    US6423885B1|1999-08-13|2002-07-23|Commonwealth Scientific And Industrial Research Organization |Methods for obtaining modified phenotypes in plant cells|
    AT447017T|2000-08-07|2009-11-15|Monsanto Technology Llc|AM METHYL-D-ERYTHRIOL PHOSPHATE REACTION WAY INVOLVED GENE|
    DE10049587A1|2000-10-06|2002-05-02|Icon Genetics Ag|Vector system for plants|
    US6872815B1|2000-10-14|2005-03-29|Calgene Llc|Nucleic acid sequences to proteins involved in tocopherol synthesis|
    DE10061150A1|2000-12-08|2002-06-13|Icon Genetics Ag|Methods and vectors for the production of transgenic plants|
    DE10102389A1|2001-01-19|2002-08-01|Icon Genetics Ag|Methods and vectors for plastid transformation of higher plants|
    US6800748B2|2001-01-25|2004-10-05|Large Scale Biology Corporation|Cytoplasmic inhibition of gene expression and expression of a foreign protein in a monocot plant by a plant viral vector|
    CA2369944A1|2001-01-31|2002-07-31|Nucleonics Inc.|Use of post-transcriptional gene silencing for identifying nucleic acid sequences that modulate the function of a cell|
    DE10114209A1|2001-03-23|2002-12-05|Icon Genetics Ag|Site-directed transformation using amplification vectors|
    DE10115507A1|2001-03-29|2002-10-10|Icon Genetics Ag|Method for coding information in nucleic acids of a genetically modified organism|
    DE10121283B4|2001-04-30|2011-08-11|Icon Genetics GmbH, 80333|Methods and vectors for amplification or expression of desired nucleic acid sequences in plants|
    CA2443865C|2001-05-09|2012-02-07|Monsanto Technology Llc|Tyra genes and uses thereof|
    US7161061B2|2001-05-09|2007-01-09|Monsanto Technology Llc|Metabolite transporters|
    DE10132780A1|2001-07-06|2003-01-16|Icon Genetics Ag|Plastid gene expression via autonomously replicating vectors|
    AU2002329759A1|2001-08-17|2003-03-03|Monsanto Technology Llc|Methyltransferase genes and uses thereof|
    DE10143238A1|2001-09-04|2003-03-20|Icon Genetics Ag|Identification of eukaryotic internal ribosome entry siteselements|
    DE10143237A1|2001-09-04|2003-03-20|Icon Genetics Ag|Manufacture of artificial internal ribosomal entry point elements |
    AT456657T|2001-10-25|2010-02-15|Monsanto Technology Llc|AROMATIC METHYLTRANSFERASES AND THEIR USE|
    WO2003052108A2|2001-12-18|2003-06-26|Bayer Bioscience N.V.|Improved methods and means for delivering inhibitory rna to plants and applications thereof|
    AU2003222018A1|2002-03-14|2003-09-29|Yale University|Tobacco rattle virus vectors and related compositions and methods|
    CA2478957C|2002-03-19|2013-07-02|Monsanto Technology, Llc|Homogentisate prenyl transferasenucleic acids and polypeptides, and uses thereof|
    DE10212892A1|2002-03-20|2003-10-09|Basf Plant Science Gmbh|Constructs and methods for regulating gene expression|
    US20060005282A1|2002-04-23|2006-01-05|Activx Biosciences, Inc|Production and use of salt tolerant and culture density tolerant organisms|
    US20040180438A1|2002-04-26|2004-09-16|Pachuk Catherine J.|Methods and compositions for silencing genes without inducing toxicity|
    JP4868739B2|2002-05-06|2012-02-01|アルナイラムファーマシューティカルズ，インコーポレイテッド|Nucleic acid delivery methods|
    US20040126823A1|2002-05-31|2004-07-01|Tsichlis Philip N.|Modulation of prostaglandin synthesis and cancer growth|
    AT405658T|2002-07-26|2008-09-15|Basf Plant Science Gmbh|NEW SELECTION PROCEDURES|
    AU2003274906A1|2002-07-31|2004-02-16|Nucleonics, Inc.|Double stranded rna structures and constructs, and methods for generating and using the same|
    US20040023390A1|2002-08-05|2004-02-05|Davidson Beverly L.|SiRNA-mediated gene silencing with viral vectors|
    US20080274989A1|2002-08-05|2008-11-06|University Of Iowa Research Foundation|Rna Interference Suppression of Neurodegenerative Diseases and Methods of Use Thereof|
    US20040241854A1|2002-08-05|2004-12-02|Davidson Beverly L.|siRNA-mediated gene silencing|
    US20050042646A1|2002-08-05|2005-02-24|Davidson Beverly L.|RNA interference suppresion of neurodegenerative diseases and methods of use thereof|
    US20080176812A1|2002-08-05|2008-07-24|Davidson Beverly L|Allele-specific silencing of disease genes|
    BR0313270A|2002-08-05|2005-08-02|Monsanto Technology Llc|Genes related to tocopherol biosynthesis and uses|
    US20050106731A1|2002-08-05|2005-05-19|Davidson Beverly L.|siRNA-mediated gene silencing with viral vectors|
    US20050255086A1|2002-08-05|2005-11-17|Davidson Beverly L|Nucleic acid silencing of Huntington's Disease gene|
    EP1629090B1|2002-11-06|2014-03-05|iBio, Inc.|Expression of foreign sequences in plants using trans-activation system|
    US7683238B2|2002-11-12|2010-03-23|iBio, Inc. and Fraunhofer USA, Inc.|Production of pharmaceutically active proteins in sprouted seedlings|
    US7692063B2|2002-11-12|2010-04-06|Ibio, Inc.|Production of foreign nucleic acids and polypeptides in sprout systems|
    AU2004209660A1|2003-02-03|2004-08-19|Fraunhofer Usa, Inc.|System for expression of genes in plants|
    US7644624B2|2004-06-04|2010-01-12|The Board Of Trustees Of The University Of Illinois|Artificial lateral line|
    US20050039228A1|2003-06-19|2005-02-17|The Samuel Roberts Noble Foundation|Methods and compositions for analysis of plant gene function|
    CA2530956A1|2003-07-03|2005-03-03|Board Of Trustees Operating Michigan State University|Expression of a recombinant transgene|
    US8148608B2|2004-02-20|2012-04-03|Fraunhofer Usa, Inc|Systems and methods for clonal expression in plants|
    US20050260652A1|2004-04-15|2005-11-24|The General Hospital Corporation|Compositions and methods that modulate RNA interference|
    CN1330756C|2005-03-14|2007-08-08|姜国勇|Gene for anti mosaic virus of tomato, and separation method|
    CN101203611B|2005-04-19|2013-08-14|巴斯福植物科学有限公司|Improved methods controlling gene expression|
    EP1931789B1|2005-09-20|2016-05-04|BASF Plant Science GmbH|Methods for controlling gene expression using ta-siran|
    EP2029300A4|2006-06-02|2013-10-30|Univ Illinois|Soft mems|
    US7661319B2|2006-06-02|2010-02-16|The Board Of Trustees Of The University Of Illinois|Micromachined artificial haircell|
    WO2008005466A2|2006-06-30|2008-01-10|The Board Of Trustees Of The University Of Illinois|Artificial lateral line|
    US20100011463A1|2007-02-06|2010-01-14|Basf Plant Science Gmbh|Compositions and Methods Using RNA Interference for Control of Nematodes|
    AT554174T|2007-02-06|2012-05-15|Basf Plant Science Gmbh|USE OF ALANINE RACEMASE GENES TO TRANSFER NEMATODE RESISTANCE TO PLANTS|
    AT553195T|2007-02-08|2012-04-15|Basf Plant Science Gmbh|COMPOSITIONS AND METHODS OF RNA INTERFERENCE OF OPR3-SIMILAR GENE FOR THE CONTROL OF NEMATODES|
    AT524553T|2007-02-09|2011-09-15|Basf Plant Science Gmbh|COMPOSITIONS AND METHODS USING CDPK-LIKE RNA INTERFERENCES FOR THE CONTROL OF NEMATODES|
    MX2009008601A|2007-03-15|2009-08-21|Basf Plant Science Gmbh|Use of nematode chitinase genes to control plant parasitic nematodes.|
    WO2009029644A1|2007-08-27|2009-03-05|Cornell Research Foundation, Inc.|Methods to improve alcohol tolerance of microorganisms|
    AU2009233940A1|2008-04-07|2009-10-15|Pioneer Hi-Bred International, Inc.|Use of virus-induced gene silencingto down-regulate genes in plants|
    CN102124025A|2008-08-27|2011-07-13|巴斯夫植物科学有限公司|Nematode-resistant transgenic plants|
    EP2527450A1|2008-12-11|2012-11-28|BASF Plant Science GmbH|Plant root-specific nematode resistance|
    CN102361987A|2009-03-20|2012-02-22|巴斯夫植物科学有限公司|Nematode-resistant transgenic plants|
    US20120151629A1|2009-08-25|2012-06-14|Basf Plant Science Company Gmbh|Nematode-Resistant Transgenic Plants|
    EP2510090A1|2009-12-09|2012-10-17|BASF Plant Science Company GmbH|Methods for increasing the resistance of plants to fungi by silencing the fungal smt1-gene|
    EP2539362A1|2010-02-23|2013-01-02|BASF Plant Science Company GmbH|Nematode-resistant transgenic plants|
    CA2802275A1|2010-06-16|2011-12-22|Plant Bioscience Limited|Control of plant seed shattering|
    US20140026256A1|2010-12-20|2014-01-23|Basf Plant Science Company Gmbh|Nematode-Resistant Transgenic Plants|
    EP2535416A1|2011-05-24|2012-12-19|BASF Plant Science Company GmbH|Development of phytophthora resistant potato with increased yield|
    EP2755988B1|2011-09-13|2018-08-22|Monsanto Technology LLC|Methods and compositions for weed control|
    CN107739737A|2011-09-13|2018-02-27|孟山都技术公司|Method and composition for Weeds distribution|
    MX362810B|2011-09-13|2019-02-13|Monsanto Technology Llc|Methods and compositions for weed control.|
    WO2013050318A1|2011-10-07|2013-04-11|Basf Plant Science Company Gmbh|Method of producing plants having increased resistance to pathogens|
    WO2013050593A1|2011-10-07|2013-04-11|Basf Plant Science Company Gmbh|Method of producing plants having increased resistance to pathogens|
    WO2013050611A1|2011-10-07|2013-04-11|Basf Plant Science Company Gmbh|Method of producing plants having increased resistance to pathogens|
    WO2013053686A1|2011-10-10|2013-04-18|Basf Plant Science Company Gmbh|Method of producing plants having increased resistance to pathogens|
    WO2013053711A1|2011-10-10|2013-04-18|Basf Plant Science Company Gmbh|Method of producing plants having increased resistance to pathogens|
    US10077451B2|2012-10-18|2018-09-18|Monsanto Technology Llc|Methods and compositions for plant pest control|
    CA2897458A1|2013-01-15|2014-07-24|Monsanto Technology Llc|Methods and compositions for plant pest control|
    US10000767B2|2013-01-28|2018-06-19|Monsanto Technology Llc|Methods and compositions for plant pest control|
    BR112015017345A2|2013-01-29|2017-11-21|Basf Plant Science Co Gmbh|method for increasing fungal resistance in a plant, recombinant vector construction, transgenic plant, method for producing transgency plant, use of any of the exogenous nucleic acids, part that can be harvested from a transgenic plant, product derived from a plant , method for producing a product and method for growing a fungal resistant plant|
    BR112015017693A2|2013-01-29|2018-12-04|Basf Plant Science Co Gmbh|methods of increasing fungal resistance in plants, transgenic plant production, product elaboration and plant cultivation, recombinant vector construction, transgenic plant, use of any of the exogenous nucleic acids, part that can be harvested from plant transgenic and product.|
    CN104981149A|2013-01-29|2015-10-14|巴斯夫植物科学有限公司|Fungal resistant plants expressing EIN2|
    AR096014A1|2013-03-08|2015-12-02|Basf Plant Science Co Gmbh|FUNGI-RESISTANT PLANTS THAT EXPRESS THE TRANSCRIPTION FACTOR Myb |
    US20140283211A1|2013-03-14|2014-09-18|Monsanto Technology Llc|Methods and Compositions for Plant Pest Control|
    EP3010329B1|2013-06-17|2019-11-20|Bayer CropScience Aktiengesellschaft|Method for identifying substances which prime cells for a stress response and cells for use in this method|
    EP3019609B8|2013-07-10|2018-07-18|Basf Se|Rnai for the control of phytopathogenic fungi and oomycetes by inhibiting the expression of cyp51 genes|
    EP3470420A1|2013-08-14|2019-04-17|Institute Of Genetics And Developmental Biology|Methods of modulating seed and organ size in plants|
    BR112017016688A2|2015-02-04|2018-04-10|Basf Plant Science Co Gmbh|method for increasing fungal resistance, vector construct, vector, transgenic plant, method for producing a transgenic plant, use of any of the constructs, collectible parts, product, method for producing a product, method for creating a plant resistant to fungus, method for applying a scopoletin, plant surface and plant|
    EP3054014A3|2016-05-10|2016-11-23|BASF Plant Science Company GmbH|Use of a fungicide on transgenic plants|
    GB201721600D0|2017-12-21|2018-02-07|Plant Bioscience Ltd|Metabolic engineering|
    GB201808617D0|2018-05-25|2018-07-11|Plant Bioscience Ltd|Scaffold modification|
    GB201908431D0|2019-06-12|2019-07-24|Plant Bioscience Ltd|Biosynthetic genes and polypeptides|
    GB201909104D0|2019-06-25|2019-08-07|Plant Bioscience Ltd|Transferase enzymes|
    法律状态:
    1999-06-25| AS| Assignment|Owner name: BIOSOURCE TECHNOLOGIES, INC., CALIFORNIA Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:KUMAGAI, MONTO H.;DELLA-CIOPPA, GUY R.;DONSON, JONATHAN;AND OTHERS;REEL/FRAME:010075/0925;SIGNING DATES FROM 19990520 TO 19990528 |
    2004-08-09| AS| Assignment|Owner name: LARGE SCALE BIOLOGY CORPORATION, CALIFORNIA Free format text: CHANGE OF NAME;ASSIGNOR:BIOSOURCE TECHNOLOGIES, INC.;REEL/FRAME:015661/0083 Effective date: 19991101 |
    2006-05-31| REMI| Maintenance fee reminder mailed|
    2006-06-30| SULP| Surcharge for late payment|
    2006-06-30| FPAY| Fee payment|Year of fee payment: 4 |
    2010-06-21| REMI| Maintenance fee reminder mailed|
    2010-11-12| LAPS| Lapse for failure to pay maintenance fees|
    2010-12-13| STCH| Information on status: patent discontinuation|Free format text: PATENT EXPIRED DUE TO NONPAYMENT OF MAINTENANCE FEES UNDER 37 CFR 1.362 |
    2011-01-04| FP| Expired due to failure to pay maintenance fee|Effective date: 20101112 |
    优先权:
    申请号 | 申请日 | 专利标题
    US16076688A| true| 1988-02-26|1988-02-26||
    US16077188A| true| 1988-02-26|1988-02-26||
    US21927988A| true| 1988-07-15|1988-07-15||
    US31088189A| true| 1989-02-17|1989-02-17||
    US34763789A| true| 1989-05-05|1989-05-05||
    US36313889A| true| 1989-06-08|1989-06-08||
    US60024490A| true| 1990-10-22|1990-10-22||
    US64161791A| true| 1991-01-16|1991-01-16||
    US73789991A| true| 1991-07-26|1991-07-26||
    US73914391A| true| 1991-08-01|1991-08-01||
    US07/923,692|US5316931A|1988-02-26|1992-07-31|Plant viral vectors having heterologous subgenomic promoters for systemic expression of foreign genes|
    US08/184,237|US5589367A|1988-02-26|1994-01-19|Recombinant plant viral nucleic acids|
    US08/260,546|US5922602A|1988-02-26|1994-06-16|Cytoplasmic inhibition of gene expression|
    US09/265,576|US6479291B2|1988-02-26|1999-03-09|Cytoplasmic inhibition of gene expression by viral RNA|US09/265,576| US6479291B2|1988-02-26|1999-03-09|Cytoplasmic inhibition of gene expression by viral RNA|
    US09/436,068| US6376752B1|1988-02-26|1999-11-08|Cytoplasmic inhibition of gene expression in a plant|
    US10/103,450| US6720183B2|1992-07-31|2002-03-20|Cytoplasmic inhibition of gene expression|
    US10/773,601| US20040142477A1|1992-07-31|2004-02-06|Cytoplasmic inhibition of gene expression|
    US11/129,170| US20050204422A1|1994-06-16|2005-05-13|Cytoplasmic inhibition of gene expression|
    [返回顶部]