• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    A method is provided for confirming osteogenesis physiological activity of an ossotide; including: predicting potential allergenicity of an ossotide; analyzing antigen immunity thereof; 5 establishing and simulating a stomach microenvironment model of an organism, analyzing a digestion characteristic of the ossotide in the stomach; establishing and simulating an intestine microenvironment model of the organism, analyzing a digestion characteristic of the ossotide in the intestine; establishing and simulating a Caco-2 intestinal epithelial cell monolayer absorption model of the organism; examining a transportable characteristic of the ossotide in the intestinal 10 epithelial cell; analyzing influence of the ossotide on a Wnt/B-catenin pathway. If the ossotide has a low or no antigen immunity and certain tolerance to gastrointestinal digestion; the ossotide may be transported to an action target point through the intestinal epithelial cell; may activate the Wnt/B-catenin signal pathway in the organism; and may be used in functional foods. 28
    公开号:NL2026294A
    申请号:NL2026294
    申请日:2020-08-19
    公开日:2020-10-06
    发明作者:Zhang Chunhui；Ye Mengliang；Jia Wei；Qin Xiaojie；Shen Qingshan；Zhang Hongru
    申请人:Institute Of Food Science And Tech Chinese Academy Of Agricultural Sciences；
    IPC主号:
    专利说明:

    OSSOTIDE, AND METHOD FOR CONFIRMING OSTEOGENESIS PHYSIOLOGICALACTIVITY AND USE THEREOF
    TECHNICAL FIELD The present invention belongs to the field of molecular biology, relates to an ossotide, and more particularly, relates to a method for confirming an osteoporosis physiological activity of the ossotide, and further relates to a use of the ossotide.
    BACKGROUND Since China has stepped into an aging society, an incidence of osteoporosis of residents is increasing year by year. Fracture of an organism induced by the osteoporosis not only increases a morbidity and a mortality of the old people, but also increases social and economic burdens, so that the osteoporosis has become a serious public health problem. The osteoporosis is a systemic bone metabolic disease of the organism characterized by a decreased bone mass, a degraded bone microstructure and an increased bone fragility. Clinically, drugs for treating the osteoporosis include risedronate, terephthalic acid, alendronic acid, diphosphonate, zoledronic acid, teriparatide, and the like. However, administration of these drugs often causes side effects such as esophageal inflammation, nausea, abdominal pain and even cancer of reproductive system, and a potential toxicity and side effects thereof limit wide application thereof to a certain extent. Therefore, people pay more attention to finding a safer natural food substitute that is able to promote bone formation and reverse a bone structure damage. Livestock and poultry bones are rich in collagen (which is mainly type-I, with a content accounting for about 20% of fresh animal bones), and the collagen is unique structural protein. Studies have shown that supplementation of a collagen peptide can increase a regularity and a firmness of a bone collagen fiber network, promote orderly deposition of calcium salt, and increase a bone strength and a bone density, so that the collagen peptide is an ideal source of a potential anti-osteoporosis active peptide. However, protein and peptide foods from livestock and poultry may have potential toxicity and allergenicity to a human body, which may bring adverse effects on human health, thus greatly affecting acceptance and consumption of customers. Studies have shown that the peptide produced by the protein through hydrolysis is generally non-toxic and less allergenic than parent protein. However, there are also some reports that a small molecule peptide still keeps a part of allergenicity of natural protein and has the 1 potential allergenicity. Therefore, it is particularly important to define the potential toxicity and allergenicity of the bioactive peptide while considering an application thereof as a functional food additive. The protein and peptide foods are often widely degraded during consumption. When entering the small intestine, the protein and peptide foods may also be further hydrolyzed by various proteases on small intestinal epithelial cells, finally hydrolyzed into small peptide fragments, and released into an intercellular matrix to be absorbed. There have been reports that peptide fragments with a large molecular weight may also be finally absorbed along with blood circulation, but a dosage of this part of peptide fragments is relatively low, and a digestion and absorption mechanism thereof is still unclear. Under normal conditions, a structure and a function of a bioactive substance may change to some extent after gastrointestinal digestion of the bioactive substance, and even a biological activity of the bioactive substance is lost. Therefore, most bioactive substances cannot play their original (in-vitro) biological activity after entering a body. How to systematically evaluate and confirm an osteogenesis physiological activity of the ossotide to promote development and utilization thereof is one of research hotspots in this field.
    SUMMARY One objective of the present invention is to solve at least the above problem and/or defect, and to provide at least the advantages to be described hereinafter. Another objective of the present invention is to provide an ossotide. Yet another objective of the present invention is to provide a method for confirming an osteogenesis physiological activity of an ossotide, which overcomes the defect that the existing method studies for evaluating and confirming an osteogenesis physiological activity of an ossotide of an organism are relatively scarce. A method for evaluating digestion and absorption characteristics of the ossotide and confirming control over a cell pathway is systematically studied in the present invention on the basis of bioinformatics, a gastrointestinal digestion model, a Caco-2 intestinal epithelial cell absorption model and the like in the present invention, so that the present invention has a good ability to predict and evaluate an osteogenesis physiological activity of a peptide, and provides a theoretical basis for guiding development of bioactive functional foods by using a livestock and poultry bone collagen peptide in the future. Still another objective of the present invention is to provide a use of the ossotide. Therefore, the present invention provides the technical solutions as follows. 2
    An ossotide is provided, wherein the ossotide has an osteogenesis activity, and an amino acid sequence of the ossotide is shown as SEQ ID NO: 1.
    A method for confirming an osteogenesis physiological activity of an ossotide includes the following steps performed in sequence: step 1. predicting a potential allergenicity of an ossotide by a bioinformatics method, and analyzing an antigen immunity of the ossotide; step 2. establishing and simulating a stomach microenvironment model of an organism, and analyzing a digestion characteristic of the ossotide in the stomach; step 3. establishing and simulating an intestine microenvironment model of the organism, and analyzing a digestion characteristic of the ossotide in the intestine; step 4. establishing and simulating a Caco-2 intestinal epithelial cell monolayer absorption model of the organism, and analyzing a transportable characteristic of the ossotide in the intestinal epithelial cell; and step 5. analyzing an influence of the ossotide on a Wnt/B-catenin pathway; if the ossotide is able to have a low or no antigen immunity and has certain tolerance to gastrointestinal digestion, the ossotide being able to be transported to an action target point (transportable characteristic) through the intestinal epithelial cell, being able to activate the Whnt/B-catenin signal pathway in the organism, and being able to be used in functional foods.
    Preferably, according to the method for confirming the osteogenesis physiological activity of the ossotide, in the step 2, specific steps of establishing and simulating the stomach microenvironment model of the organism include: preparing an ossotide solution first, then placing the ossotide solution in a 37°C constant-temperature water environment, then adjusting a pH of the ossotide solution to 2.0, adding pepsin into the ossotide solution, starting to stimulate in-vitro stomach digestion, stirring with a magnetic stirrer at the same time, simulating stomach peristalsis for a period of time, finally taking a part of digestive juice A as a sample, and analyzing the digestion characteristic of the ossotide in the stomach.
    Preferably, according to the method for confirming the osteogenesis physiological activity of the ossotide, in the step 3, specific steps of establishing and simulating the intestine microenvironment model of the organism include: adjusting a pH of the remaining solution in the step 2 to 7.5, then adding pancreatin into the remaining solution according to a mass ratio of enzyme to a substrate of 1:50, starting to simulate in-vitro intestine digestion, stirring with a magnetic stirrer at the same time, simulating intestine peristalsis for a period of time, finally taking a part of digestive juice B as a sample, and analyzing the digestion characteristic of the ossotide in the intestine.
    Preferably, according to the method for confirming the osteogenesis physiological activity of the ossotide, in the step 4, specific steps of establishing and simulating the Caco-2 intestinal epithelial cell monolayer absorption model of the organism include: inoculating a cell suspension of a Caco-2 cell into a culture chamber first, adding the cell suspension to an apical side AP of the culture chamber, adding a complete culture medium to a basolateral side of the culture chamber, after culturing for a period of time, measuring a transmembrane resistance value, using the transmembrane resistance value as a reference index to continuously culture the cell for 12 days to 15 days until the transmembrane resistance value reaches a maximum value, and indicating that the Caco-2 intestinal epithelial cell monolayer absorption model is successfully established; after successfully establishing the Caco-2 cell monolayer model, performing an absorption and transportation test of the ossotide: washing a cell monolayer twice with a HBSS buffer, adding 0.5 mL and 1.5 mL of HBSS buffer containing 0.05% DMSO to both sides AP and BP respectively, then culturing in 5% CO; and 95% air at a constant temperature of 37°C for 30 minutes, then removing the buffer, adding 0.5 mL of 10 mM ossotide to the side AP, adding 1.5 mL of HBSS buffer containing 0.05% DMSO to the side BL, and continuously culturing in 5% CO: and 95% air at a constant temperature of 37°C; and for the other groups, before adding the ossotide, adding 0.5 mL and 1.5 mL of pathway promoter and inhibitor related to cell absorption and transportation to the sides AP and BP respectively first, which are cytochalasin D with a concentration of 0.5 pg/mL, wortmannin with a concentration of 500 nM and Gly-Sar with a concentration of 25 mM, so as analyze an absorption and transportation mechanism thereof, after culturing for 30 minutes by the same way, removing the buffer, then adding 0.5 mL of 10 mM ossotide solution to the side AP and 1.5 mL of HBSS buffer containing 0.05% DMSO to the side BP respectively, taking 100 pL of sample from the side BL after 2 hours, and placing and keeping at -20°C for detection.
    Preferably, the method for confirming the osteogenesis physiological activity of the ossotide further includes a step of analyzing a sequence of the ossotide to obtain a sequence thereof; in the step 1, the potential allergenicity of the ossotide is predicted by using an AlgPred online database; and in the step 2, a mass ratio of the pepsin to the ossotide is 1:50, and a mass ratio of the pancreatin to the ossotide is also 1:50.
    Preferably, according to the method for confirming the osteogenesis physiological activity of the ossotide, the stomach microenvironment model is performed in a stomach simulation container, the stomach simulation container includes an outer peripheral wall and a bottom 4 portion connected with the outer peripheral wall in a sealed manner, the outer peripheral wall is made of a flexible material, a pair of extruding portions are arranged on two opposite sides of the outer peripheral wall, the extruding portions are configured to flatten the outer peripheral wall in a radial direction thereof by simultaneously compressing the outer peripheral wall, a reset spring is arranged in the outer peripheral wall in the radial direction, two ends of the reset spring are fixed on an inner side of the outer peripheral wall at positions corresponding to the pair of extruding portions, wherein the outer peripheral wall is an ellipse by a top view, the pair of extruding portions and the reset spring are arranged along a long axis of the ellipse, the pair of extruding portions and the reset spring are located at a lower side of the stomach simulation container, and heights of the pair of extruding portions and the reset spring from the bottom portion in a vertical direction do not exceed 1/3 of a total height of the stomach simulation container. The outer peripheral wall of the stomach simulation container in the present invention is made of the flexible material, the extruding portions and the reset spring are provided, and the extruding portions may be pressed as required to make the extruding portions simulate the stomach peristalsis, so that an actual working environment of the stomach is able to be better simulated, thus being beneficial for obtaining a more real result.
    Preferably, according to the method for confirming the osteogenesis physiological activity of the ossotide, in the step 5, the influence of the ossotide on the Wnt/B-catenin pathway is analyzed on the basis of Real-time qPCR and Western blot methods, wherein primers for detecting genes in the Real-time qPCR include a primer pair shown as SEQ ID NO:2 and SEQ ID NO:3, a primer pair shown as SEQ ID NO:4 and SEQ ID NO:5, a primer pair shown as SEQ ID NO:6 and SEQ ID NO:7, a primer pair shown as SEQ ID NO:8 and SEQ ID NO:9, a primer pair shown as SEQ ID NO:10 and SEQ ID NO:11, a primer pair shown as SEQ ID NO:12 and SEQ ID NO:13, a primer pair shown as SEQ ID NO:14 and SEQ ID NO:15, a primer pair shown as SEQ ID NO:16 and SEQ ID NO:17, and a primer pair shown as SEQ ID NO:18 and SEQ ID NO: 19.
    A use of the ossotide in preparation of an active functional food for scientific research or osteogenesis research is provided.
    The present invention includes at least the following beneficial effects.
    The present invention takes the lead in systematically studying the method for confirming an in-vitro allergenicity, digestion, absorption, transportation and an osteogenesis activity action mechanism thereof through the bioinformatics, the gastrointestinal digestion model and the Caco-2 intestinal epithelial cell absorption model, so as to define a potential feasibility thereof as a functional food additive with an osteogenesis activity. Whether the ossotide has the antigen 5 immunity, a gastrointestinal digestive stability, the transportable characteristic and a targeted osteogenesis activity is systematically evaluated while considering an application of the ossotide as the functional food additive with the osteogenesis activity. The method of the present invention has a good ability to predict and evaluate an osteogenesis physiological activity of a peptide, and may provide a theoretical basis for guiding development of bioactive functional foods by using a livestock and poultry bone collagen peptide in the future.
    Other advantages, objectives and features of the present invention will be partially reflected by the following description, and will be partially understood by those skilled in the art through study and practice on the present invention.
    BRIEF DESCRIPTION OF THE DRAWINGS FIG 1A is a schematic diagram of a gastrointestinal digestion and absorption model established in one embodiment of the present invention; and FIG. 1B is a structure diagram of a stomach simulation container viewed from above; FIG 2 is a schematic diagram of a Caco-2 cell monolayer transportation model established in one embodiment of the present invention; FIG 3 is a component analysis diagram of an ossotide after stimulating gastrointestinal digestion and absorption in one embodiment of the present invention, FIG 4 is a component analysis diagram of an ossotide after stimulating Caco-2 cell endopeptidase digestion in one embodiment of the present invention; FIG 5A is a comparative analysis diagram of apparent absorption coefficients under three possible transportation mechanisms of an ossotide in one embodiment of the present invention; FIG 5B is an analysis diagram of a transportation mechanism of the ossotide across the Caco-2 cell monolayer in one embodiment of the present invention; FIG 6A shows an influence of an ossotide on expression quantities of osteoblast proliferation-related genes in one embodiment of the present invention; Fig. 6B shows an influence of the ossotide on expression quantities of osteoblast Wnt/B-catenin pathway-relative genes in one embodiment of the present invention; FIG 6C is a Western blot electrophoretogram showing protein expression of the osteoblast proliferation-related genes influenced by the ossotide in one embodiment of the present invention; FIG 6D shows an influence of the ossotide on protein expression quantities of the osteoblast proliferation-related genes in one embodiment of the present invention; 6
    FIG. 6E is a Western blot electrophoretogram showing protein expression of the osteoblast Wnt/B-catenin pathway-relative genes influenced by the ossotide in one embodiment of the present invention; FIG. GF shows an influence of the ossotide on protein expression quantities of the osteoblast Wnt/B-catenin pathway-relative genes in one embodiment of the present invention; FIG. 7 is an analysis diagram of a mechanism of an activity of an ossotide in promoting osteoblast proliferation in one embodiment of the present invention; and FIG. 8 is a flow chart of a method for preparing an ossotide and a method for confirming an osteogenesis physiological activity in one embodiment of the present invention.
    DETAILED DESCRIPTION The present invention is further described in detail with reference to the accompanying drawings, so that those skilled in the art can implement according to the description.
    It should be understood that the terms such as "have", "contain" and "comprise" used herein do not imply the existence or addition of one or more other elements or combinations thereof.
    The laboratory of the applicant prepared bovine collagen peptides with a high purity by separation and purification from a bovine bone, performed structure identification on amino acid sequences thereof, established a peptide library that promoted an osteoblast proliferation activity (osteogenesis activity), and defined structure characteristics of an amino acid sequence of an osteogenesis active peptide according to a type of a binding force with a target protein, and a number and a type of amino acid residues at a binding site. However, a physiological activity of the bovine collagen peptide in promoting osteoblast proliferation depends on an ability thereof of completely reaching a target point. At present, there are no research reports about systematic evaluation and confirmation of the osteogenesis physiological activity of the ossotide, so that development and utilization of the the ossotide are greatly limited.
    The present invention provides an ossotide, wherein the ossotide has an osteogenesis activity, and an amino acid sequence of the ossotide is shown as SEQ ID NO: 1.
    The present invention provides a method for confirming an osteogenesis physiological activity of an ossotide.
    The method for confirming the osteogenesis physiological activity of the ossotide includes the following steps performed in sequence: step 1. predicting a potential allergenicity of an ossotide by a bioinformatics method, and 7 analyzing an antigen immunity of the ossotide; step 2. establishing and simulating a stomach microenvironment model of an organism, and analyzing a digestion characteristic of the ossotide in the stomach; step 3. establishing and simulating an intestine microenvironment model of the organism, and analyzing a digestion characteristic of the ossotide in the intestine; step 4. establishing and simulating a Caco-2 intestinal epithelial cell monolayer absorption model of the organism, and analyzing a transportable characteristic of the ossotide in the intestinal epithelial cell; and step 5. analyzing an influence of the ossotide on a Wnt/B-catenin pathway.
    If the ossotide can satisfy a low antigen immunity, and has certain tolerance to gastrointestinal digestion, the ossotide is able to be transported to an action target point (transportable characteristic) through the intestinal epithelial cell, is able to activate the Wnt/B-catenin signal pathway in the organism, and is able to be used in functional foods.
    As shown in FIG 1, a gastric juice device 1 and an intestinal juice device 2 may be connected to a stomach simulation container or an intestine simulation container placed on a magnetic stirrer through respective ducts 3 and 4 thereof, and liquid flowing may be realized by turning on a flow switch 5, so that the stomach microenvironment model of the organism and the intestine microenvironment model of the organism are established. A pH of a solution may be measured through a pH probe 6, and a rotor 7 is arranged in a reaction device.
    The present invention takes the lead in systematically studying a method for confirming an in-vitro allergenicity, digestion, absorption, transportation and an osteogenesis activity action mechanism thereof through the bioinformatics, the gastrointestinal digestion model and the Caco-2 intestinal epithelial cell absorption model, so as to define a potential feasibility thereof as a functional food additive with an osteogenesis activity. Whether the ossotide has an antigen immunity, a gastrointestinal digestive stability, a transportable characteristic and a targeted osteogenesis activity is systematically evaluated while considering an application of the ossotide as the functional food additive with the osteogenesis activity. The method of the present invention has a good ability to predict and evaluate an osteogenesis physiological activity of a peptide, and may provide a theoretical basis for guiding development of bioactive functional foods by using a livestock and poultry bone collagen peptide in the future.
    In one embodiment of the present invention, preferably, in the step 2, specific steps of establishing and simulating the stomach microenvironment model of the organism include: preparing an ossotide solution first, then placing the ossotide solution in a 37°C constant-temperature water environment, then adjusting a pH of the ossotide solution to 2.0, 8 adding pepsin into the ossotide solution, starting to stimulate in-vitro stomach digestion, stirring with a magnetic stirrer at the same time, simulating stomach peristalsis for a period of time, finally taking a part of digestive juice A as a sample, and analyzing the digestion characteristic of the ossotide in the stomach.
    In one embodiment of the present invention, preferably, in the step 3, specific steps of establishing and simulating the intestine microenvironment model of the organism include: adjusting a pH of the remaining solution in the step 2 to 7.5, then adding pancreatin into the remaining solution according to a mass ratio of enzyme to a substrate of 1:50, starting to simulate in-vitro intestine digestion, stirring with a magnetic stirrer at the same time, simulating intestine peristalsis for a period of time, finally taking a part of digestive juice B as a sample, and analyzing the digestion characteristic of the ossotide in the intestine.
    In one embodiment of the present invention, preferably, in the step 4, specific steps of establishing and simulating the Caco-2 intestinal epithelial cell monolayer absorption model of the organism include: inoculating a cell suspension of a Caco-2 cell into a culture chamber first, adding the cell suspension to an apical side AP of the culture chamber, adding a complete culture medium to a basolateral side of the culture chamber, after culturing for a period of time, measuring a transmembrane resistance value, using the transmembrane resistance value as a reference index to continuously culture the cell for 12 days to 15 days until the transmembrane resistance value reaches a maximum value, and indicating that the Caco-2 intestinal epithelial cell monolayer absorption model is successfully established; after successfully establishing the Caco-2 cell monolayer model, performing an absorption and transportation test of the ossotide: washing a cell monolayer twice with a HBSS buffer, adding 0.5 mL and 1.5 mL of HBSS buffer containing 0.05% DMSO to both sides AP and BP respectively, then culturing in 5% CO, and 95% air at a constant temperature of 37°C for 30 minutes, then removing the buffer, adding 0.5 mL of 10 mM ossotide to the side AP, adding 1.5 mL of HBSS buffer containing 0.05% DMSO to the side BL, and continuously culturing in 5% CO, and 95% air at a constant temperature of 37°C; and for the other groups, before adding the ossotide, adding 0.5 mL and 1.5 mL of pathway promoter and inhibitor related to cell absorption and transportation to the sides AP and BP respectively first, which are cytochalasin D with a concentration of 0.5 pg/mL, wortmannin with a concentration of 500 nM and Gly-Sar with a concentration of 25 mM, so as analyze an absorption and transportation mechanism thereof, after culturing for 30 minutes by the same way, removing the buffer, then adding 0.5 mL of 10 mM ossotide solution to the side AP and 1.5 9 mL of HBSS buffer containing 0.05% DMSO to the side BP respectively, taking 100 pL of sample from the side BL after 2 hours, and placing and keeping at -20°C for detection.
    In one embodiment of the present invention, preferably, the method for confirming the osteogenesis physiological activity of the ossotide further includes a step of analyzing a sequence of the ossotide to obtain a sequence thereof.
    In the step 1, the potential allergenicity of the ossotide is predicted by using an AlgPred online database.
    In one embodiment of the present invention, preferably, a mass ratio of the pepsin to the ossotide is 1:50, and a mass ratio of the pancreatin to the ossotide is also 1:50.
    In one embodiment of the present invention, preferably, the stomach microenvironment model is performed in a stomach simulation container 8. The stomach simulation container 8 includes an outer peripheral wall 801 and a bottom portion connected with the outer peripheral wall in a sealed manner, the bottom portion may be made of glass or other materials, and the outer peripheral wall 801 is made of a flexible material. A pair of extruding portions 802a and 802b are arranged on two opposite sides of the outer peripheral wall 801, and the extruding portions are configured to flatten the outer peripheral wall 801 in a radial direction thereof by simultaneously compressing the outer peripheral wall. A reset spring 803 is arranged in the outer peripheral wall 801 in the radial direction, and two ends of the reset spring 803 are fixed on an inner side of the outer peripheral wall 801 at positions corresponding to the pair of extruding portions. The outer peripheral wall 801 is an ellipse by a top view, the pair of extruding portions 802a and 802b and the reset spring 803 are arranged along a long axis of the ellipse, and the pair of extruding portions 802a and 802b and the reset spring 803 are located below the stomach simulation container 8. Heights of the pair of extruding portions 802a and 802b and the reset spring 803 from the bottom portion in a vertical direction do not exceed 1/3 of a total height of the stomach simulation container.
    In one embodiment of the present invention, preferably, in the step 5, the influence of the ossotide on the Wnt/B-catenin pathway is analyzed on the basis of Real-time qPCR and Western blot methods, wherein primers for detecting genes in the Real-time qPCR include a primer pair shown as SEQ ID NO:2 and SEQ ID NO:3, a primer pair shown as SEQ ID NO:4 and SEQ ID NO:5, a primer pair shown as SEQ ID NO:6 and SEQ ID NO:7, a primer pair shown as SEQ ID NO:8 and SEQ ID NO:9, a primer pair shown as SEQ ID NO:10 and SEQ ID NO:11, a primer pair shown as SEQ ID NO:12 and SEQ ID NO:13, a primer pair shown as SEQ ID NO:14 and SEQ ID NO:15, a primer pair shown as SEQ ID NO:16 and SEQ ID NO:17, and a primer pair shown as SEQ ID NO:18 and SEQ ID NO:19.
    10
    In one embodiment of the present invention, preferably, the certain tolerance is that the ossotide still has a complete peptide fragment after digestion in the stomach.
    The present invention discloses a method for systematically evaluating an antigen immunity, a gastrointestinal stability, a transportable characteristic and a targeted osteogenesis activity of the ossotide through the bioinformatics, the gastrointestinal digestion model and the Caco-2 intestinal epithelial cell absorption model for the first time. The method has a good ability to predict and evaluate an osteogenesis physiological activity of a peptide, and may provide a theoretical basis for guiding development of bioactive functional foods by using a livestock and poultry bone collagen peptide in the future.
    In one embodiment of the present invention, a method for confirming an osteogenesis physiological activity of an ossotide includes the following main steps: step 1. predicting a potential allergenicity of a peptide by bioinformatics, and examining an antigen immunity of the ossotide; step 2. establishing and simulating a stomach microenvironment model of an organism, and examining a digestion characteristic of the ossotide in the stomach; step 3. establishing and simulating an intestine microenvironment model of the organism, and examining a digestion characteristic of the ossotide in the intestine; step 4. establishing and simulating a Caco-2 intestinal epithelial cell monolayer absorption model of the organism, and analyzing a transportable characteristic of the ossotide in the intestinal epithelial cell; and step 5. examining an influence of the ossotide on a Wnt/B-catenin pathway on the basis of Real-time qPCR and Western blot technologies.
    In the method for confirming the osteogenesis physiological activity of the ossotide according to the present invention, the predicting the potential allergenicity of the peptide by the bioinformatics is realized by prediction of an AlgPred online database (http://crdd.osdd.net/raghava/algpred/submission. html).
    In the method for confirming the osteogenesis physiological activity of the ossotide according to the present invention, the establishing and stimulating the stomach and intestine micro-environment models of the organism is as follows. The ossotide (100 mg) is accurately added into a 100 mL beaker, and added with 5 mL of ultrapure water. The mixture is homogeneously stirred to prepare an ossotide solution with a concentration of 20 mg/mL, the ossotide solution is placed in a constant-temperature water bath at 37°C, and a pH of the ossotide solution is adjusted to 2.0 with 2 M HCI solution. Pepsin (E/S is 1:50) is added to start to stimulate in-vitro stomach digestion, and after stirring with a magnetic stirrer (simulating 11 stomach peristalsis) for 2 hours, a part of digestive juice A is taken out for later use. A pH of the remaining reaction solution is adjusted to 5.3 with 0.5 M NaHCO; solution first, and then adjusted to 7.5 with 2 M NaOH solution. Pancreatin (E/S is 1:50) 1s added to start to simulate in-vitro intestine digestion, and after stirring with a magnetic stirrer (simulating intestine peristalsis) for 2 hours, a part of digestive juice B is taken out for later use. All the above operations are repeated for 3 times. The collected digestive juices A and B are respectively heated in a constant-temperature water bath at 95°C for 10 minutes to inactivate enzyme, and then centrifuged at 4°C and 8000xg for 20 minutes. A supernatant is freeze-dried by a freeze dryer and then kept at -20°C for subsequent analysis.
    In the method for confirming the osteogenesis physiological activity of the ossotide according to the present invention, the establishing and stimulating the Caco-2 intestinal epithelial cell monolayer absorption model is as follows. Caco-2 cells are digested and prepared into a cell suspension with a concentration of 2+10° cells/mL, and inoculated into a 12-well culture chamber. 500 uL of cell suspension is slowly added to an apical side AP (apical side) of the culture chamber, with a cell inoculation amount of 1.5+10° cells/insert, and 1.5 mL of complete medium is slowly added to a side BL (Basolateral side) of the culture chamber. The culture media on both sides AP and BL are replaced on the third day after inoculation of the Caco-2 cell, and then the culture media are replaced every two days, and replaced every day after one week until the cells are inoculated for 10 days to 15 days. It should be noted that when the culture media are replaced, the culture media on the side BL of the culture chamber are carefully sucked first and then the culture media on the side AP are quickly removed. When being added, the culture media are added to the side AP first and then added to the side BL.
    Resistance values on both sides of the Caco-2 cell monolayer model are measured by a Millicecll ERS-2 resistance meter. A shorter end of a pole is inserted into an interior (AP side) of a Transwell insert culture chamber, and a longer end of the pole is immersed into an exterior (BL side). The shorter end is strictly forbidden to touch cells growing on the Caco-2 cell monolayer, and the longer end is perpendicular to a bottom side of a culture plate, so as to ensure that the pole is stable. The resistance values are accurately recorded after reading of the resistance meter is stable. A transmembrane resistance of the Caco-2 cell monolayer is represented by a transmembrane resistance per unit membrane area (Q*cm ): Caco-2 cell transmembrane resistance (Q*cm )=(Q; — Q)*0.3 wherein, OQ, is a transmembrane resistance value with the growth of the Caco-2 cell; OQ, is a blank resistance value without the growth of the Caco-2 cell; and 0.3 is a membrane area of the 24-well Tanswell insert chamber. 12
    Resistance values of different days (measurement is performed once every two days, such as a 1% day, a 3 day, a 5" day, and so on) are measured and data is recorded by taking the transmembrane resistance value as a reference index, so as to ensure successful establishment of the model, and the measurement is lasting for about 12 days.
    In the step 4, in order to examine a characteristic and a mechanism of transmembrane transportation of the ossotide, different pathway inhibitors and promoters of small molecular substance transportation are used. A specific test is designed as follows.
    After the Caco-2 cell monolayer model is successfully established, an absorption and transportation test of an ossotide GP-12 is performed. A cell monolayer is washed twice with a HBSS buffer, and 0.5 mL and 1.5 mL of HBSS buffer containing 0.05% DMSO is added to both sides AP and BP respectively. The mixture is cultured in a 5% CO,, 95% air and 37°C constant-temperature incubator (Stericycle CO, incubator, Thermo Fisher Scientific Inc., Waltham, MA) for 30 minutes. The buffer is removed, 0.5 mL of 10 mM ossotide GP-12 solution (prepared with the HBSS buffer containing 0.05% DMSO, the same below) is added to the side AP, and 1.5 mL of HBSS buffer containing 0.05% DMSO is added to the side BL. The mixture is cultured in the 5% CO», 95% air and 37°C constant-temperature incubator.
    For the other groups, before adding the ossotide, 0.5 mL and 1.5 mL of pathway promoter and inhibitor related to cell absorption and transportation are added to the sides AP and BP respectively, which are cytochalasin D (cell bypass absorption promoter), wortmannin (endocytosis inhibitor) and Gly-Sar (PepT1 carrier substrate), so as examine an absorption and transportation mechanism thereof. The promoter and the inhibitor are dissolved with a HBSS buffer containing 0.05% DMSO at concentrations of 0.5 pg/mL (cytochalasin D), 500 nM (wortmannin) and 25 mM (Gly-Sar) respectively. After culturing for 30 minutes, the buffer is removed, 0.5 mL of 10 mM ossotide solution is added to the side AP, and 1.5 mL of HBSS buffer containing 0.05% DMSO is added to the side BP. 100 pL of sample is taken from the side BL after 2 hours, and placed and kept at -20°C. All the above operations are repeated for 3 times.
    Preferably, sequence identification is performed on composition, an amino acid sequence and corresponding content analysis of the peptide in the solution after stimulation of the gastrointestinal digestion and the Caco-2 cell monolayer transportation test in the step 2, the step 3 and the step 4 above by the following methods.
    An Agilent HPLC1260- system (Agilent Technologies Inc., California, USA) is used to measure a component content of the ossotide after the stimulation of the gastrointestinal digestion. A TSK gel G2000SWXL chromatographic column (7.8*300 mm, TOSOH, Tokyo, 13
    Japan) is used. A mobile phase A is 0.1% trifluoroacetic acid solution, and a mobile phase B is
    0.1% trifluoroacetic acid acetonitrile solution. A component of the ossotide after the stimulation of the gastrointestinal digestion is loaded to a high-resolution mass spectrometer (Thermo Q-Exactive, Thermo Scientific, USA) through a reversed capillary chromatographic column (Phenomenex, Aqua® 10 cm, 5 um C18 125 A, USA). Mass spectrum parameters are set as follows: an electrospray ion source (ESI) is provided; a scanning mode is a positive ion mode; and a capillary temperature 1s 320°C, and a capillary ejection voltage is 2 kV. High-resolution MS/MS full scanning (m/z 300-2000 Da) is used, and 10 eV electron energy collides and dissociates. A Swiss-Prot database is searched and compared on the basis of a Mascot 2.4 search engine (Matrix Science, Boston, USA). The examining the influence of the ossotide on the Wnt/B-catenin pathway on the basis of the Real-time qPCR and Western blot technologies has the following operation steps. An appropriate amount of cell suspension is added into a 1.5 mL EP tube of RNAase-free, and added with chloroform according to a ratio of 0.2 mL/1.0 mL TRIzol. The mixture is shaken vigorously for 20 seconds, stood at a room temperature for 5 minutes, and centrifuged at 4°C and 12,000x g for 15 minutes, and an upper-layer solution is transferred to a new 1.5 mL EP tube. Isopropyl alcohol (0.5mL/1.0 mL TRIzol) is added, mixed evenly, then stood at a room temperature for 10 minutes, and centrifuged at 4°C and 10, 000xg for 10 minutes. A supernatant is discarded, and a precipitate is RNA. Iml of 75% ethanol (precooled at -20°C) is added into the precipitate, and centrifuged at 4°C and 10,000x g for 8 minutes, and a supernatant is discarded. After shaking and cleaning, the precipitate is centrifuged at 4°C and 10, 000xg for 3 minutes, and a supernatant is carefully removed, being careful not to remove the RNA precipitate. The RNA precipitate is placed at a room temperature for 2 minutes to 3 minutes and dried in air. 100 uL of RNase-free water is added, RNA is fully dissolved, and the obtained RNA is kept at -80°C for later use. A concentration of the RNA is measured by a micro nucleic acid protein tester, and a content thereof is measured by electrophoresis. The above RNA sample is diluted to 100 ng/uL with the RNase-free water, and the sample is loaded according to the following table (a total reaction volume is calculated as 10 pL): Reagents Volume (gl) ~ 5xPrmer Script Buffer 20 PrimeScript RT Enzyme Mix 0.5 Oligo dT Primer (50uM) 0.5 14
    © Random 6 mers (100 uM) 05 RNA (100ng/pl) 5.0 RNase Free ddH20 1.5 Reaction conditions of reverse transcription are as follows: 37°C and 15 minutes. Enzyme (reverse transcriptase) is inactivated by heating at 85°C for 5 seconds, and after reaction, a cDNA solution obtained by the reverse transcription is diluted by 100 times. A reaction solution 5S is prepared according to the following table. A reaction system is as follows. Reagents Volume (pL) ~ 2xUltra SYBR Mixture 50 Forward Primer 0.3 Reverse Primer 0.3 Rnase-Free Water 24 cDNA (diluted by 100 times) 2.0 Real Time PCR reaction is performed on ABI 7500Fast, and the detailed steps refer to the following table.
    Step Temperature Time OO Predenaturation 95 3 minutes Denaturation 95 15 seconds Annealing/extension 60 1 minute Dissolution curve analysis 95 15 seconds 60 I minute 95 15 seconds 60 15 seconds Primers for osteoblast proliferation and pathway-related genes are designed as the following table: Gene Primer Sequence SEQID NO: © pactin ~~ pactin-F GTACTCTGTGTGGATCGGTGG 2
    ToT B-actin-R AACGCAGCTCAGTAACAGTCC 3 Cyclin D1-F CATTTCCAACCCACCCTCCA 4 Cyclin D1 Cyclin DI-R CAGTCCGGGTCACACTTGA 5 Oxterix-F CTTTCGTCTGCAACTGGCTT 6 Oxterix Oxterix-R TAAAGCGCTTGGAACAGAGC 7 Runx 2-F CTCTGGCCTTCCTCTCTCAG 8 Run 2 Runx 2-R GTAGGTAAAGGTGGCTGGGT 9 Col I-F TGGAAACCCGAGGTATGCTT 10 Coll Col I-R CATTGCATTGCACGTCATCG 11 D-catenin-F TCATCATTCTGGCCAGTGGT 12 p-catenin D-catenin-R AGAGCAGACAGACAGCACTT 13 Freizzled-5-F GAAGAGAAGGCGAGTGACCG 14 Preizzled-5 Freizzled-5-R AAGGACAGAACTCTGTGGCG 15 _ WhntSa-F GCCTGCTTTCCCAACCCTAT 16 Wats Wnt5a-R CGGCTGCCTATTTGCATCAC 17 GSK-3B-F AGCTCTGATTGGCCACTGTC 18 GSK-3 GSK-3p-R TGGGAAGGAGGGAGGAGATG 19 An appropriate amount of cell suspension is added into an EP tube, added with 300 mL of tissue protein lysate (protease and phosphatase inhibitors have been added in advance), incubated on ice for 30 minutes, and centrifuged at 4°C and 10,000x g for 15 minutes.
    A supernatant is removed to a new EP tube, and kept at -20°C for later use.
    Protein concentrations of different samples are measured with a BCA kit, which are ready for subsequent use. 30% acrylamide solution, an electrotransfer solution, a 2xSDS gel sample loading buffer, a TBS buffer, a 10% electrophoresis buffer, a TBST buffer, a blocking solution, separation gel and concentrated gel are accurately prepared for later use.
    SDS-PAGE electrophoresis has the steps as follows. —aa number Main operation steps Gwe preparation: 5 mL of 10% separation gel is added into a glue preparation device, stood at a room temperature, and polymerized for 25 minutes. 5 2 mL of 5% concentrated glue is injected into a gap between glass plates to a position about 1.0 cm away from a top portion of an interlayer. 3 Placement of comb: a comb is inserted into a concentrated glue solution in the interlayer, stood at a room temperature, and polymerized for 30 minutes. 4 Pulling out of comb: the comb is carefully pulled out to avoid tearing a gel sample loading well, and the sample loading well is washed with a 1x electrophoresis buffer. 16
    Addition of liquid: a gel plate is put into a vertical electrophoresis tank, and the 1x electrophoresis buffer is slowly introduced until upper and lower tanks of the electrophoresis tank are fully filled.
    Sequential sample loading: a sample loading amount of each well is subject to a total protein 6 content of 15 ug, and a sample loading amount of a protein pre-dyed Marker is 5 ul. 7 Turning on of power supply: a device is connected for SDS-PAGE electrophoresis.
    Electrophoresis: a voltage applied to the concentrated gel is 8 V/cm, and the electrophoresis is 5 ended when bromophenol blue reaches a bottom portion of the separation gel. Membrane transfer has the steps as follows.
    number Main operation steps Preparation: a PVDF membrane and filter paper are soaked in methanol for 10 minutes. and then ! transferred to the electrotransfer solution for wetting and balancing for 25 minutes for later use.
    Gel processing: the gel plate is taken out. the glass plate is gently prised open, the gel is taken out, 2 and the gel is wetted with a transfer buffer.
    Removal of bubbles: three layers of wetted filter paper, the gel, the membrane and the filter paper 3 are placed on a half surface of a transfer box in sequence, and bubbles among the layers are removed.
    Addition of liquid: the membrane is placed on an anode surface of an electrotransfer instrument + according to the sequence, and the transfer buffer is slowly added into the transfer tank. 5 Turning on of power supply: the device is connected, and the membrane transfer is started.
    Ending of electrotransfer: whether target protein is completely transferred is analyzed according to 6 transfer of the protein pre-dyed Marker. Western blot has the steps as follows.
    Main operation steps number Sealing: after marking, the PVDF membrane subjected to electrotransfer is transferred to a ! confining liquid, and shaken and sealed at a room temperature for 2 hours.
    Hybridization: the confining liquid is discarded, and the PVDF membrane is hybridized with 2 primary antibodies of internal reference protein and target protein respectively, and incubated at 4°C for 12 hours.
    Membrane rinsing: the PVDF membrane is taken out, and repeatedly rinsed with the TBST buffer 3 for 3 times, with 10 minutes for each time.
    Hybridization: HRP-marked goat anti-mouse IgG or goat anti-rabbit IgG diluted by 1:1000 is used + as a secondary antibody, and shaking reaction is performed for 1 hour.
    Membrane rinsing: the PVDF membrane is taken out, and repeatedly rinsed with the TBST buffer 5 for 3 times, with 5 minutes for each time.
    ECL luminescence: the PVDF membrane is taken out and drained on the filter paper, and the 6 membrane is soaked in a luminescent liquid, incubated at a room temperature for 3 minutes, and exposed and photographed. In order to make those skilled in the art better understand the technical solutions of the 17 present invention, the following embodiments are now provided for description.
    A separated and purified ossotide GPAGPPGPIGNV (hereinafter referred to as GP-12, SEQ ID NO:1) is used as an object of study hereinafter.
    Embodiment 1 Examination of antigen immunity of ossotide GP-12 on the basis of bioinformatics Proteins and peptides usually have certain potential toxicity and allergenicity, which bring many adverse effects to human health.
    Statistical data shows that about 8% of children and 1.5% of adults are suffering from food allergy, and the allergy is still increasing.
    Studies have shown that a bovine collagen may have an allergen, and has a risk of causing an allergic reaction.
    IO Therefore, a potential allergenicity of the ossotide GP-12 was predicated in the present invention on the basis of a biological information database.
    Prediction results show that the ossotide GP-12 has no potential allergenicity, which may be because that a GP-12 fragment is located at a non-allergenic amino acid (peptide fragment) part in a parent of the bovine collagen.
    Therefore, the antigen immunity is not shown when predicting the in-vitro allergenicity.
    Embodiment 2 Examination of gastrointestinal stability of ossotide GP-12 by simulating in-vitro gastrointestinal digestion An ossotide GP-12 (100 mg) was accurately added into a 100 mL beaker first, added with 5 mL of ultrapure water, and homogeneously stirred to prepare an ossotide GP-12 solution with a concentration of 20 mg/mL.
    The ossotide GP-12 solution was placed in a constant-temperature water bath at 37°C, and stirred with a magnetic stirrer to accelerate even heating of the ossotide GP-12 solution.
    A pH of the ossotide GP-12 solution was adjusted to 2.0 with 2 M HCI solution, and then pepsin (E/S is 1:50) was added to start to simulate in-vitro stomach digestion, as shown in FIG 1. After stirring with the magnetic stirrer (simulating stomach peristalsis) for 2 hours, a part of digestive juice A was taken out to analyze peptide composition and an amino acid sequence thereof.
    A pH of the remaining stomach digestive reaction solution was continuously adjusted to 5.3 with 0.5 M NaHCO; solution, and then adjusted to 7.5 with 2 M NaOH solution.
    Finally, pancreatin (E/S is 1:50) was added to start to simulate in-vitro intestine digestion.
    After stirring with the magnetic stirrer (simulating intestine peristalsis) for 2 hours, a part of digestive juice B was taken out for later use.
    All the above operations were repeated for 3 times.
    The collected digestive juices A and B were respectively heated in a constant-temperature water bath at 95°C for 10 minutes to inactivate enzyme, and then centrifuged at 4°C and 8000xg for 20 minutes.
    A supernatant was freeze-dried by a freeze dryer and then kept at -20°C for subsequent analysis and measurement of peptide composition, a content and an amino acid sequence.
    The embodiment is based on simulating the gastrointestinal digestion of the organism, and 18 overcomes a shortcoming of a large individual difference in traditional simulation of the gastrointestinal digestion which stimulates gastrointestinal peristalsis through artificial stirring by simulating the gastrointestinal peristalsis with the magnetic stirrer, thus ensuring a stability and a reproducibility of the test. In the method, a peristaltic pump may be assisted to simulate transmission of the digestive juice, thus improving a coherence and an efficiency of a simulation system. The method has a strong operability, does not need a lot of manpower and material resources, may be widely applied to evaluate the gastrointestinal stability of the peptide and other active functional components, and provides technical support for development of anti-osteoporosis active functional health foods. Embodiment 3 Result analysis of gastrointestinal stability of ossotide GP-12 after simulating gastrointestinal digestion In the method for confirming the osteogenesis physiological activity of the ossotide according to the present invention, in order to explore whether the ossotide GP-12 was inactivated under intestine digestion, the present invention tried to establish an in-vitro gastrointestinal digestion model, and identified and examined a component of the ossotide GP-12 after stomach digestion and intestine digestion respectively. As shown in FIG 3, results show that the ossotide GP-12 still exists in an original form after the stomach digestion, without further enzymolysis, and the ossotide GP-12 has strong tolerance to pepsin. However, a part of ossotide GP-12 is further hydrolyzed into GPAGPPGPIGN(GP-11) and GPAGPPGPI(GP-9) after the intestine digestion, indicating that the ossotide GP-12 has certain tolerance to an intestine microenvironment, but is able to be hydrolyzed by some proteases in pancreatin. Therefore, it was necessary to examine a change in the component of the ossotide GP-12 after gastrointestinal digestion and an activity of the ossotide GP-12 in promoting osteoblast proliferation. Research results show that no significant difference (P>0.05) exists between the activity of the component of the ossotide GP-12 in promoting osteoblast proliferation before the stomach digestion and the intestine digestion and the activity of the component of the ossotide GP-12 in promoting osteoblast proliferation after the stomach digestion and the intestine digestion. Therefore, the ossotide GP-12 has a certain stability in the stomach and intestine digestion, and may partially pass through a digestive tract and still exert an osteogenesis activity, and a proportion of a complete peptide fragment is about 76.2%.
    In addition, peptide composition, a content and an amino acid sequence of the component of the ossotide GP-12 solution after stimulating the stomach and intestine digestion in the Embodiment 2 measured by reversed liquid-phase chromatography and liquid-phase chromatography tandem mass spectrometry were collected respectively.
    19
    Especially, the ossotide GP-12 is found to have strong tolerance to the pepsin.
    In addition, the ossotide GP-12 is also found to have certain tolerance to the intestine microenvironment, but is able to be hydrolyzed into two short peptides GPAGPPGPIGN(GP-11) and GPAGPPGPI(GP-9) by some proteases in the pancreatin.
    Embodiment 4 Analysis of transportation mechanism of ossotide GP-12 through Caco-2 monolayer There are many membrane proteases and membrane peptidases existing on a surface of a Caco-2 cell, showing different biological activities when the cell is under a complex physiological status. In order to explore a stability of the ossotide GP-12 transported through a IO Caco-2 cell monolayer, the present invention established an in-vitro Caco-2 cell monolayer model, as shown in FIG 2. After the Caco-2 cell monolayer 9 was established in a culture chamber 8, an ossotide 11 was added to an apical side 10 (simulating an intestinal villus side), ie. a side AP, and a bottom portion of the culture chamber as a porous polycarbonate membrane
    12. A lower side of the porous polycarbonate membrane was a basolateral side 13 (a side BL) which formed a gastrovascular cavity, and components of peptides on both sides (AP, BL) of the ossotide GP-12 transported through the Caco-2 cell monolayer were identified respectively (FIG 4). Results show that the ossotide GP-12 on the side AP is partially hydrolyzed into GPPGPIGNV(GV-9) and AGPGPIGNV (AV-10) after transportation through the Caco-2 cell monolayer. Three peptide components including the ossotide GP-12, GPPGPIGNV(GV-9) and AGPPGPIGNV(AV-10) are detected on a side BP. Therefore, the complete ossotide GP-12 may be transported to the side BL of the Caco-2 cell monolayer, which means that the ossotide GP-12 has certain tolerance to a brush border peptidase on an intestinal epithelial cell and an endopeptidase of an epithelial cell, and has a potential to be continuously transported to an action target point through blood to exert an biological activity thereof.
    A transportation mechanism of small peptides is not very clear yet. At present, mainstream research reports include the following three transportation mechanisms: cell bypass transportation, endocytosis transportation and small peptide transporter Pep T1-mediated transportation (FIG. 5). Therefore, the present invention mainly examines the above three transportation pathways, and designs pathway promoter and inhibitor related to transportation, including cytochalasin D (cell bypass absorption promoter), wortmannin (endocytosis inhibitor) and Gly-Sar (Pep TI carrier substrate), so as to examine an absorption and transportation mechanism thereof. The promoter and the inhibitor are dissolved with a HBSS buffer containing
    0.05% DMSO at concentrations of 0.5 pg/mL (cytochalasin D), 500 nM (wortmannin) and 25 mM (Gly-Sar) respectively. Results show that an apparent permeability coefficient (Papp) of the 20 ossotide GP-12 is not significantly changed after being processed with the wortmannin (endocytosis inhibitor) and the Gly-Sar (Pep T1 carrier substrate) compared with a control group (P>0.05). However, a Papp value after processing with the cytochalasin D (cell bypass absorption promoter) is significantly higher than that before processing (P<0.05), suggesting that the transportation mechanism of the peptide GP-12 is the cell bypass transportation, and the transportation pathway is a passive diffusion process independent of energy.
    It has been reported that the pathway is involved in transportation of various small molecular substances.
    Especially, most of the ossotides GP-12 are found to be hydrolyzed by the membrane protease and the membrane peptidase on the surface of the Caco-2 cell after the ossotides GP-12 are transported through the Caco-2 cell monolayer, and hydrolysates are GPPGPIGNV(GV-9) and AGPGPIGNV (AV-11). In addition, the three peptide components including the ossotide GP-12, the GPPGPIGNV(GV-9) and the AGPPGPIGNV(AV-11) are also detected on the side BP at the same time.
    To sum up, the complete ossotide GP-12 may be transported to the side BL of the Caco-2 cell monolayer, which means that the ossotide GP-12 has certain tolerance to the brush border peptidase on the intestinal epithelial cell and the endopeptidase of the epithelial cell, and has the potential to be continuously transported to the action target point through blood to exert the biological activity thereof.
    In addition, the Papp value after the ossotide GP-12 is processed with the cytochalasin D (cell bypass absorption promoter) is also found to be significantly higher than that before processing (P<0.05), suggesting that the peptide GP-12 is probably transported by the cell bypass (transportable characteristic), and the transportation pathway is the passive diffusion process independent of energy.
    It has been reported that the pathway is involved in transportation of various small molecular substances has been reported.
    Embodiment 5 Analysis of mechanism of activity of ossotide GP-12 in promoting osteoblast proliferation In the method for confirming the osteogenesis physiological activity of the ossotide according to the present invention, in order to explore a mechanism of an osteogenesis activity of the ossotide GP-12, changes of expression quantities of cell proliferation-related genes and Wnt/B-catenin pathway-relative genes after the ossotide GP-12 acts on an osteoblast MC3T3-E1 were examined (FIG. 6). Results show that with increase of a concentration of the ossotide GP-12, expression quantities of osteoblast MC3T3-E1 proliferation-related genes Cyclin DI, Oxterix, Runx2 and Col I are all up-regulated, and when the concentration of the ossotide GP-12 is 0.05 mg/mL, the expression quantities of the genes are maximum, which are 2.46, 1.85, 2.05 and 2.59 times the expression quantities of a control group CN respectively.
    Pathway-relative 21 genes B-catenin, Freizzled-5, WntSa and GSK-3[ show a similar trend. When the concentration of the ossotide GP-12 is 0.05 mg/mL, the expression quantities of the genes are maximum, which are 2.26, 2.47, 3.04 and 2.86 times the expression quantities of the control group CN respectively. In addition, after processing with a Wnt/B-catenin specific pathway inhibitor XAV-939, an up-regulation trend of the expression quantities of the above genes is inhibited, suggesting that an action of the ossotide GP-12 in promoting osteoblast proliferation (osteogenesis activity) may be closely related to activation of a Wnt/B-catenin signal pathway.
    In order to further verify that the ossotide GP-12 exerts the osteogenesis activity by controlling the Wnt/B-catenin signal pathway, the present invention examined protein expression quantities of the above genes. Please see FIG. 6 for results of protein expression quantities of genes related to the osteoblast MC3T3-E1 proliferation promoted by the ossotide GP-12 and pathway-relative genes. Results show that with increase of the concentration of the ossotide GP-12, protein expression quantities of the osteoblast MC3T3-E1 proliferation-related genes Cyclin D1, Oxterix, Runx2 and Col I are all up-regulated, and when the concentration of the peptide GP-12 is 0.05 mg/mL, the protein expression quantities are maximum, which are 1.86,
    2.08, 1.37 and 2.11 times the expression quantities of the control group CN respectively. The pathway-relative genes B-catenin, Freizzled-5, Wnt5a and GSK-3B show a similar trend. When the concentration of the peptide GP-12 is 0.05 mg/mL, the protein expression quantities are maximum, which are 1.90, 2.38, 1.59 and 1.31 times the protein expression quantities of the genes of the control group CN respectively. In addition, after processing with the Wnt/B-catenin specific pathway inhibitor XAV-939, an up-regulation trend of the protein expression quantities of the above genes is reversed, suggesting that the action of the ossotide GP-12 in promoting osteoblast proliferation (osteogenesis activity) is closely related to activation of the Wnt/B-catenin signal pathway.
    Especially, after the ossotide GP-12 acts on the osteoblast MC3T3-E1, the protein expression quantities of the cell proliferation-related genes and the Wnt/B-catenin pathway-relative genes are found to be able to be significantly increased. Moreover, after processing with the Wnt/B-catenin specific pathway inhibitor XAV-939, the up-regulation trend of the protein expression quantities of the above genes is reserved, suggesting that the action of the ossotide GP-12 in promoting osteoblast proliferation (osteogenesis activity) is closely related to activation of the Wnt/B-catenin signal pathway.
    In addition, the activity of the ossotide GP-12 in promoting osteoblast proliferation (osteogenesis) is also found to not only directly act on the Wnt/B-catenin signal pathway, but also be possibly combined with an epidermal growth factor receptor (EGFR) due to the ossotide 22
    GP-12. The activated EGFR induces downstream B-catenin accumulation and trans-cell nuclear transportation to a corresponding target point to perform a function. The ossotide GP-12 may be a crosstalk that activates interaction between the EGFR pathway and the Wnt/B-catenin signal pathway, so that the EGFR pathway and the Wnt/B-catenin signal pathway synergistically exert the osteogenesis activity.
    To sum up, the present invention takes the lead in systematically studying a method for confirming in-vitro allergenicity, digestion, absorption, transportation and an osteogenesis activity action mechanism of the ossotide through bioinformatics, a gastrointestinal digestion model and a Caco-2 intestinal epithelial cell absorption model, so as to define an antigen immunity, a gastrointestinal stability, a transportable characteristic and a targeted osteogenesis activity thereof. The method of the present invention has a good ability to predict and evaluate the osteogenesis physiological activity of the ossotide, and may provide a theoretical basis for guiding development of bioactive functional foods by using a livestock and poultry bone collagen peptide in the future.
    A number of modules and a processing scale described herein are used to simplify the description of the present invention. The application, modification and variation of the method for confirming the osteogenesis physiological activity of the ossotide according to the present invention are obvious to those skilled in the art.
    The present invention discloses the method for confirming the osteogenesis physiological activity of the ossotide of the organism. Those skilled in the art may learn from the content of the present invention and appropriately improve the parameter for realization. It should be particularly pointed out that all the similar substitutions and modifications are obvious to those skilled in the art, and shall be considered to be included in the present invention. The method and product of the present invention have been described through the preferred embodiments, and it is obvious that relevant personnel are able to modify or appropriately alter and combine the method described herein without departing from the content, spirit and scope of the present invention to realize and apply the technology of the present invention.
    Although the embodiments of the present invention have been disclosed above, the present invention is not limited to the applications listed in the description and the embodiments. The present invention may be applied to various fields suitable for the present invention absolutely, and other modifications may be easily realized by those skilled in the art. Therefore, the present invention is not limited to the specific details and the illustrations shown and described herein without departing from the general concepts defined by the claims and equivalent scopes.
    23
    权利要求:
    Claims (10)
    [1]
    Ossotide, wherein the ossotide has osteogenetic activity, and an amino acid sequence of the ossotide is shown as SEQ ID NO: 1.
    [2]
    2. A method for confirming a physiological osteogenesis activity of an ossotide, comprising the following steps which are carried out in sequence: - step 1. predicting a potential allergenicity of an ossotide by means of a bioinformatics method, and analyzing an antigen immunity of the ossotide; - step 2. building and simulating a gastric microenvironment model of an organism, and analyzing a digestive characteristic of the ossotide in the stomach; - step 3. building and simulating a gut microenvironment model of the organism, and analyzing a digestive characteristic of the ossotide in the gut; step 4. building and simulating a Caco-2 small intestinal epithelial cell monolayer membrane absorption model of the organism, and analyzing a transportable marker of the ossotide in the small intestinal epithelial cell; and - step 5. analyzing an influence of the ossotide on a Wnt / B catenin pathway; wherein, if the ossotide has low or no antigen immunity, has some tolerance to gastrointestinal digestion, can be transported by the small intestinal epithelial cell to an action target, and can activate the Wnt / B-catenin signaling pathway in the organism, the ossotide in functional foods can be used.
    [3]
    The method of confirming a physiological osteogenetic activity of an ossotide according to claim 2, wherein in step 2 specific steps for building and simulating the gastric microenvironment model of the organism comprise: first preparing an ossotide solution, then placing the ossotide solution in a 37 ° C water environment with constant temperature, then adjusting a pH of the ossotide solution to 2.0, adding pepsin to the ossotide solution, starting stimulating in vitro gastric digestion, stirring with a magnetic stirrer at the same time , simulating gastric peristalsis over a period of time, finally taking a portion of the digestive juice A as a sample, and analyzing the digestive characteristic of the ossotide in the stomach.
    [4]
    The method of confirming a physiological osteogenetic activity of an ossotide according to claim 3, wherein in step 3 specific steps for building and simulating a gut microenvironment model of the organism comprise: first controlling a pH of the residual solution in step 2 to 7.5, then adding pancreatin to the remaining solution according to a mass ratio of enzyme to a substrate of 1:50, starting simulating in vitro intestinal digestion, stirring with a magnetic stirrer at the same time, simulating intestinal peristalsis over a period of time, finally taking a portion of the digestive juice B as a sample, and analyzing the digestive characteristic of the ossotide in the intestine.
    [5]
    A method of confirming a physiological osteogenesis activity of an ossotide according to claim 2, wherein in step 4 specific steps for building and simulating a Caco-2 small intestinal epithelial cell monolayer membrane absorption model of the 10 organism comprise: - first inoculating a cell suspension of a Caco-2 cell in a culture chamber, adding the cell suspension to an apical side AP of the culture chamber, adding a complete culture medium to a basolateral side of the culture chamber, after culturing for a period of time, measuring of a transmembrane resistance value, using the transmembrane resistance value as the reference index to continuously culture the cell for 12 days to 15 days until the transmembrane resistance value reaches a maximum value, and indicating that the Caco-2 Dundarm Epithelial Cell Monolayer Membrane Absorption Model has been successfully constructed; - after successfully building the Caco-2 cell monolayer membrane model, performing an ossotide absorption and transport assay: washing a cell monolayer membrane twice with HBSS buffer, adding 0.5 ml and 1.5 ml HBSS buffer with 0.05% DMSO on both sides AP and BP respectively, then culture in 5 vol% CO; and 95 vol.% air at a constant temperature of 37 ° C for 30 minutes, then removing the buffer, adding 0.5 ml of 10 mM ossotide to the AP side, adding 1.5 ml of HBSS buffer with 0.05% DMSO on the BL side, and growing continuously in 5 vol.% CO; and 95% by volume air at a constant temperature of 37 ° C; and - for the other groups, before adding the ossotide, first adding 0.5 ml and 1.5 ml pathway promoter and inhibitor related to cell absorption and transport on both sides AP and BP respectively, namely cytochalasin D at a concentration of 0.5 µg / ml, wortmannin at a concentration of 500 nM and Gly-Sar at a concentration of 25 mM, to analyze an absorption and transport mechanism thereof, after culturing for 30 minutes in the same way , removing the buffer, then adding 0.5 ml of 10 mM ossotide solution to the AP side and 1.5 ml of HBSS buffer with 25
    0.05% DMSO on the BP side respectively, taking 100 µL. sample from the BL silk after 2 hours, and place and keep at -20 ° C for detection.
    [6]
    A method of confirming a physiological osteogenesis activity of an ossotide according to claim 2, further comprising a step of analyzing a sequence of the ossotide to obtain a sequence thereof, wherein: - in step 1 the potential allergenicity of the ossotide is determined predicted by using an AlgPred online database; and - in step 2, a mass ratio of the pepsin to the ossotide is 1:50, and a mass ratio of the pancreatin to the ossotide is also 1:50.
    [7]
    The method of confirming a physiological osteogenesis activity of an ossotide according to claim 2, wherein the gastric microenvironment model is performed in a gastric simulation container, the gastric simulation container comprises an outer circumferential wall and a bottom portion sealed to the outer circumferential wall, the outer circumferential wall is made of a flexible material, a pair of extrusion sections are provided on two opposite sides of the outer peripheral wall, the extrusion sections are configured to flatten the outer peripheral wall in a radial direction thereof by simultaneously compressing the outer peripheral wall, a return spring is provided in the outer peripheral wall in the radial direction , two ends of the return spring are attached to an inner side of the outer circumferential wall at positions corresponding to the pair of extrusion sections, the outer circumferential wall being an ellipse by a plan view, the pair of extrusion sections and the return spring are arranged along a long axis of the ellipse, the pair of extrusion sections and the return spring are located on an underside of the gastric simulation container, and the heights of the pair of extrusion sections and the return spring from the bottom section in a vertical direction are not greater than 1/3 of the total height of the gastric simulation container.
    [8]
    The method of confirming a physiological osteogenesis activity of an ossotide according to claim 2, wherein in step 5 the influence of the ossotide on the Wnt / B-catenin pathway is analyzed based on Real-time qPCR and Western blot methods. wherein primers for detecting genes in the Real-time qPCR comprise a primer pair shown as SEQ ID NO: 2 and SEQ ID NO: 3, a primer pair shown as SEQ ID NO: 4 and SEQ ID NO: 5, a primer pair shown as SEQ ID NO: 6 and SEQ ID NO: 7, a primer pair shown as SEQ ID NO: 8 and SEQ ID NO: 9, a primer pair shown as SEQ ID NO: 10 and SEQ ID NO: 11, a primer pair shown as SEQ ID NO: 12 and SEQ ID NO: 13, a primer pair shown as SEQ ID NO: 14 and SEQ ID NO: 15, a primer pair shown as SEQ ID 26
    NO: 16 and SEQ ID NO: 17, and a pair of primers shown as SEQ ID NO: 18 and SEQ ID NO: 19.
    [9]
    The method of confirming a physiological osteogenetic activity of an ossotide according to claim 2, wherein the certain tolerance is that the ossotide after digestion in the stomach still has a complete peptide fragment and a portion of the complete peptide fragment is 20% and above.
    [10]
    Use of the ossotide of claim 1 in the preparation of an active functional foodstuff for scientific or osteogenesis research.
    27
    类似技术:
    公开号 | 公开日 | 专利标题
    US6890754B2|2005-05-10|Epidermis/dermis equivalents and aged skin equivalents shaped therefrom
    CN108883138A|2018-11-23|Enhance the production and isolated method of cell-derived vesica
    CN101868245B|2013-10-23|Synthetic peptide containing bone forming peptide 1| for stimulating osteoblast differentiation, and pharmaceutical composition comprising synthetic peptide
    Lee et al.2018|Bio-artificial tongue with tongue extracellular matrix and primary taste cells
    JP2008508968A|2008-03-27|Cross-linked collagen matrix for producing skin equivalents
    NL2026294A|2020-10-06|Ossotide, and method for confirming osteogenesis physiological activity and use thereof
    WO2009148549A3|2010-01-28|Novel biosensors for live cell imaging of intracellular proteins
    CN106620694A|2017-05-10|Application of Cornulin as target in preparation of drug for preventing and treating psoriasis
    WO2015081226A1|2015-06-04|Engineered cardiac derived compositions and methods of use
    Yamamoto et al.2011|Allograft inflammatory factor-1 is overexpressed and induces fibroblast chemotaxis in the skin of sclerodermatous GVHD in a murine model
    AU2019279909A1|2020-01-02|Compositions and methods for induced tissue regeneration in mammalian species
    CN110325210A|2019-10-11|RSPO substitute molecule
    Wang et al.2018|Isolation of enteric glial cells from the submucosa and lamina propria of the adult mouse
    Hida et al.2010|Tissue reaction to synthetic oligopeptide derived from enamel matrix derivative in rats
    Lee et al.2021|Mechanobiological conditioning of mesenchymal stem cells for enhanced vascular regeneration
    KR20190111167A|2019-10-01|Methods for development and use of minimally polarized function cell micro-aggregate units in tissue applications using lgr4, lgr5 and lgr6 expressing epithelial stem cells
    US8858990B2|2014-10-14|Capsule of thermogenic cells for treating a metabolic disease
    CN109568583A|2019-04-05|Application of the RIPK3 as target spot in the drug of preparation prevention and treatment psoriasis
    Fujita et al.2010|Rapid decrease in active tension generated by C2C12 myotubes after termination of artificial exercise
    Yang et al.2021|FNDC5/irisin is expressed and regulated differently in human periodontal ligament cells, dental pulp stem cells and osteoblasts
    CN104906598A|2015-09-16|Application of ACTL6A gene to preparation of medicine for treating liver cancer or preventing relapse of liver cancer after surgery
    JP6294079B2|2018-03-14|ZSCAN4 and its use as a marker for pancreatic stem cells and progenitor cells
    CN105803085B|2019-07-19|A kind of molecular marked compound and application thereof detecting osteoarthritis
    Torio‐Padron et al.2007|Implantation of VEGF transfected preadipocytes improves vascularization of fibrin implants on the cylinder chorioallantoic membrane | model
    CN108685906A|2018-10-23|The new opplication of micromolecular compound P7C3
    同族专利:
    公开号 | 公开日
    CN110950930A|2020-04-03|
    CN110950930B|2021-09-07|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    WO2007087131A2|2006-01-05|2007-08-02|The Johns Hopkins University|Peptide prodrugs|
    EP3341399A2|2015-08-25|2018-07-04|Histide AG|Compounds for inducing tissue formation and uses thereof|
    CN107541538A|2017-08-10|2018-01-05|江苏大学|The method that in-vitro simulated gastro-intestinal digestion prepares collagen gel antioxidation polypeptide liquid|
    CN107523600A|2017-09-29|2017-12-29|中国农业科学院农产品加工研究所|Promote the preparation method and purposes of the bone collagen polypeptide of human osteoblast cell's propagation|
    CN110136774A|2019-05-22|2019-08-16|中国农业科学院农产品加工研究所|The structure of osteogenic activity polypeptide imitates evaluation method|BE1027448B1|2020-11-15|2022-02-08|Institute Of Food Science And Tech Chinese Academy Of Agricultural Sciences|A method for evaluating the structure-activity of polypeptides with osteogenic activity|
    法律状态:
    优先权:
    申请号 | 申请日 | 专利标题
    CN201910784028.1A|CN110950930B|2019-08-23|2019-08-23|Bone peptide and confirmation method and application of osteogenic physiological activity thereof|
    [返回顶部]