Evolution and use of enzymes for combinatorial and medicinal chemistry

专利摘要:
The present invention provides a library of recombinant derivatization enzymes useful for biocatalytic synthesis of organic molecular derivatives, including leading substances for pharmaceutical use. Recombinant derivatization enzymes catalyze reactions such as the modification or replacement of a function on an organic molecule or the addition of a chemical moiety to a functional group already present. Recombinant enzyme libraries can be used to obtain enzymes that catalyze the formation of organic molecular derivatives that cannot be prepared otherwise using only naturally occurring enzymes.
公开号:KR20020022808A
申请号:KR1020027001884
申请日:2000-08-11
公开日:2002-03-27
发明作者:크렙버클라우스；데이비스에스크리스토퍼；델카르데이레스테펜；셀리포노브세르게이에이；하워드러셀
申请人:리우, 루；추후제출；맥시겐, 인크.；
IPC主号:

专利说明:

EVOLUTION AND USE OF ENZYMES FOR COMBINATORIAL AND MEDICINAL CHEMISTRY
[2] In the drug discovery process, optimizing lead compounds is one of a number of challenges. Lead substances very often lack some of the pharmacological properties (eg, high potency, selectivity, low toxicity, bioavailability, etc.) required for sufficiently functional drugs. Therefore, further modification of the lead material is often necessary to obtain an optimized medicament with the perfect combination of properties required. Conventional attempts at derivatization allow medical chemists to rely on a number of experimental experiences in selecting which chemical homologues to synthesize and test. Some compounds are selected for synthesis but others are not. Similarly, when the derivatives of the lead material are prepared using combinatorial chemistry, in particular building blocks are chosen for the parallel synthesis of multiple derivatives, other building blocks are not. These choices are usually made in accordance with the experience of medicinal chemistry, which provides guidance regarding modifications that will result in improvements and modifications that will lead to new unwanted or deteriorating existing properties. Unfortunately, however, these experiences are specific to individual medicinal chemists because they are not fully disclosed except in the bulk of their bulky fragments.
[3] Improvements in leading substances with potential pharmaceutical uses are not the only situations where derivatization of organic molecules is of interest. Organic molecules have many uses, including, for example, insecticides, herbicides, and the like. In order to obtain compounds exhibiting improved properties for certain applications, it is highly desirable to produce libraries of organic molecular derivatives which can then be screened to identify those derivatives that will exhibit the desired properties.
[4] Combination synthesis methods have the potential to provide a method for synthesizing a wide variety of lead derivatives without the need for a priori prediction of which derivative would be most desirable. Instead of synthesizing the derivatives individually and testing them, many different derivatives can be prepared simultaneously. Combination synthesis is useful not only for derivatization of the lead, but also for the synthesis of compounds that are screened to identify those that are worth further study as potential lead. However, the synthesis of combinatorial libraries of organic molecular derivatives is severely limited because many forms of organic molecular derivatives are difficult or nearly impossible to synthesize by pure chemical means.
[5] Enzymes provide a potentially attractive route for the synthesis of chemical compound libraries that can identify compounds that exhibit the desired properties. Enzymes can act on mixtures of complex molecules in solution and catalyze the synthesis of derivatives of molecules without producing byproducts. Conventional chemical methods for derivatization of lead are usually nonselective and require multiple protection and deprotection steps, while these steps are not necessary for enzymatic synthesis. Moreover, the enzyme operates under relatively mild conditions that are not disruptive to the reaction product. Enzymes can also perform several different forms of modifications to organic molecules such as conventional potential precursors and other biologically active molecules of interest. For example, enzymes can catalyze the addition of a portion to a compound (eg, ester, amide, carbonate, carbamate or glycosidic bonds, etc.). Enzymes can also add new functional groups to organic molecules or modify the functional groups present in a compound. Enzymatic biocatalytic reactions can provide certain additional advantages such as substrate selectivity, stereoselectivity and regioselectivity. Although enzymatic combinatorial biocatalyst reactions have great potential, serious disadvantages remain. For example, there has not yet been obtained a sufficiently broad variety of enzymes that can promote organic molecular derivatization over the entire range. It is not easy to obtain enzymes from naturally occurring sets of enzymes that will have the substrate, conformation, or positionality needed for any particular organic molecule of interest. Thus, there is a need for derivatization enzymes capable of producing a wide variety of organic molecular derivatives. The absence of such enzymes limits the number and form of organic molecular derivatives obtainable by combinatorial biocatalytic reactions. Thus, there is a need for such organic molecular derivative libraries as well as the need for derivatizing enzyme obtaining methods that catalyze a wide variety of different organic molecular derivatizations. The present invention satisfies this need and the like.
[1] The present invention relates to the field of enzymatic synthesis of combinatorial libraries of organic molecules using evolved enzymes. The present invention provides an enzyme library capable of biocatalytically synthesizing a plurality of organic molecular derivatives through predetermined evolution. Organic molecular derivative libraries can be screened to identify active compounds such as antibiotics and other therapeutic agents, herbicides and pesticides.
[171] 1 shows potential sugar attachment points on vancomycin hydrochloride.
[172] 2 shows potential sugar attachment points on somatostatin.
[173] 3 shows potential sugar attachment points on cholic acid.
[174] 4 shows potential sugar attachment points on L-thyroxine.
[175] 5 shows potential sugar attachment points on nogalamycin.
[176] 6 shows the potential sugar attachment points on the cyringgalazine phase.
[177] 7 shows potential sugar attachment points on alcarubicin.
[178] 8 shows potential sugar attachment points on ritodrine hydrochloride.
[179] 9 shows potential sugar attachment points on rifamycin.
[180] 10 shows potential sugar attachment points on ristomycin sulfate. Five additional hydroxyls on the main chain are also shown (but not indicated by arrows); These represent potential sugar attachment points.
[181] Figure 11 shows multistage chemical methylation of erythromycin A and its analogs.
[182] 12 shows the reaction catalyzed by S-adenosylmethionine (SAM) dependent on methyltransferase.
[183] Figure 13 shows the specificity of O-methyltransferase that can be shuffled to obtain recombinant enzymes with 6-OMTase activity using erythromycin and its analogs as substrates.
[184] Figure 14 shows the DNA and protein sequence similarity of O-methyltransferase that can be shuffled to obtain recombinant enzymes with 6-OMTase activity using erythromycin and its analogs as substrates.
[185] Figure 15 shows a microtiter plate high efficiency primary screen for identifying methyltransferases with novel specificity.
[186] Figure 16 shows a schematic of the use of erythromycin A 6-O-methyltransferase for biocatalytic synthesis of clarithromycin.
[187] 17 shows the secondary assay for clarithromycin synthesis. MS / MS detection of the 590/158 pairs identifies methylation of the macrolide ring.
[188] 18 shows an additional secondary assay for clarithromycin synthesis. Phenyl boronate reacts specifically with cis diol at neutral pH. Only clarithromycin has 11-12-cis diol which reacts to yield 834.5 ions.
[189] 19 shows a map of the pCKZEBB vector.
[6] Summary of the Invention
[7] The present invention provides a method for obtaining a library of organic molecular derivatives. The method includes contacting an organic molecule with one or more members of the recombinant derivatization enzyme library and other necessary reactants to form an organic molecular derivative library. Derivatizing enzymes may comprise a) one or more functional group modifications present on an organic molecule; b) addition of a chemical moiety to one or more functional groups present on organic molecules; Or c) catalyze reactions such as the introduction of new functional groups on organic molecules. The method is useful for a wide variety of organic molecules or for industrial processes, including, for example, having pharmacological activity, herbicide activity, pesticide activity or other activity.
[8] In some embodiments, the method further comprises performing one or more additional reactions in the derivative obtained by contacting the derivatizing enzyme. The product of the initial reaction thus serves as an intermediate of further reaction. Additional reactions include, for example, contacting the organic molecular derivative library with one or more members of the second recombinant derivatization enzyme library and other necessary reactants to form additional libraries of organic molecular derivatives. Alternatively, the intermediate may be modified chemically or using other enzymes.
[9] In some embodiments, (1) recombining at least a first and a second form of nucleic acid encoding a derivatizing enzyme, the first and second forms being different from each other at two or more nucleotides, to produce a library of recombinant polynucleotides; (2) A library of recombinant derivatization enzymes is obtained by expressing a recombinant polynucleotide library to obtain a library of recombinant derivatization enzymes. If desired, the method recombines (3) one or more recombinant polynucleotides encoding a member of the recombinant derivatization enzyme library with additional forms of nucleic acid encoding the derivatization enzyme (same as or different from the first and second forms). Producing additional libraries of recombinant nucleic acids, (4) expressing additional libraries of recombinant polynucleotides to obtain additional libraries of recombinant derivatization enzymes, and (5) additional libraries of recombinant derivatization enzymes, if desired, Repeating steps (3) and (4) until it includes different recombinant derivatization enzymes.
[10] The method also provides a method for obtaining an enzyme that catalyzes the synthesis of the necessary organic molecular derivatives. These methods include contacting an organic molecule with recombinant derivatization enzyme library members and other necessary reactants to form an organic molecular derivative; Identifying required organic molecular derivatives in the library of organic molecular derivatives; And identifying a member of the library of recombinant derivatization enzymes that catalyze the synthesis of the required organic molecular derivatives.
[11] Also provided by the present invention is a library of recombinant derivatization enzymes, wherein the recombinant derivatization enzymes, when contacted with an organic molecule having one or more functional groups, comprise: a) modification of one or more functional groups; b) addition of a chemical moiety to at least one of said functional groups; Or c) catalyze reactions such as the introduction of new functional groups.
[12] In another embodiment, the present invention provides a library of organic molecular derivatives. The library contains a number of libraries of recombinant derivatization enzymes that catalyze reactions such as organic molecules having one or more functional groups, a) modification of one or more functional groups, b) addition of chemical moieties to one or more functional groups, or c) introduction of new functional groups. It is synthesized biocatalytically by contact with the circles.
[13] details
[14] Justice
[15] "Derivatization enzymes" are enzymes that can catalyze reactions on organic molecules. For example, derivatization enzymes can modify existing functional groups present on a molecule, add chemical moieties on functional groups, or add new functional groups on organic molecules. Organic molecules may include both synthetic (eg, non-natural compounds such as halo-containing compounds and the like) and naturally occurring compounds.
[16] A "recombinant derivatizing enzyme" is a non-naturally occurring derivatizing enzyme that differs in sequence from the naturally occurring derivatizing enzyme by one or more amino acid residues. Recombinant derivatization enzymes include derivatization enzymes consisting of a plurality of amino acid blocks, wherein the blocks are not in contact with naturally occurring enzymes. The length of the block is usually not constant. Recombinant derivatization enzymes are chimeric and have portions of sequences derived from sequences of two or more different parent enzymes. Chimeric recombinant derivatization enzymes are encoded by chimeric genes containing nucleic acid fragments derived from two or more different parent genes or parent gene fragments. The parent gene may optionally encode a derivatization enzyme.
[17] As used herein, "library" refers to a collection of various molecules such as, for example, recombinant derivatization enzymes and organic compound analogs. Libraries of the invention have two or more different members of the molecule but can vary in size. Typically, the inventive library has at least about 5 different members and more generally at least about 10 different members of the molecule. Large libraries in the present invention typically have at least about 100 different members of the molecule, and sometimes have at least about 10,000, even at least 100,000 different members of the molecule. Very large libraries of the present invention have at least about 1,000,000 members.
[18] "Functional group" means an atom or group of atoms that defines the structure of a particular group of organic compounds and determines their properties. Functional groups include, for example, alkenes, alkynes, aromatics, halogens, hydroxyls, ethers, esters, aldehydes, ketones, carboxylic acids, amides, amines and the like.
[19] A "lead substance" is a prototype compound with desirable biological or pharmacological activity, but may also have other undesirable properties. For example, the lead may be toxic, insoluble and may have other biological activities or less than bioavailability (eg, properties such as absorption, distribution, metabolism and secretion (ie, ADME)) or optimization. Can have biological activity and the like.
[20] "Nucleic acid" means deoxyribonucleotides or ribonucleotides and polymers of the single or double helix type. The term includes nucleic acids comprising known nucleotide homologs or modified backbone residues or linkages, which are synthetic, naturally occurring and non-naturally occurring, have similar binding performance as standard nucleic acids, and in a manner similar to standard nucleotides. It is metabolized. Examples of the homologues include, but are not limited to, phosphorothioate, phosphoramidate, methylphosphonate, chiral-methyl phosphonate, 2-O-methylribonucleotide, peptide-nucleic acid (PNA), and the like. Does not.
[21] Unless otherwise indicated, certain nucleic acid sequences potentially include conservatively modified variants (eg, degenerate codon substitutions) and complementary sequences as well as implied sequences. "Nucleic acid" can be used interchangeably herein with "gene", "cDNA", "mRNA", "oligonucleotide" and "polynucleotide".
[22] "Polypeptide", "peptide" and "protein" are used interchangeably herein to mean a polymer of amino acid residues. The term applies to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues are homologs or analogs of the corresponding naturally occurring amino acid.
[23] "Amino acids" refer to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid analogs that function in a similar manner to naturally occurring amino acids. Naturally occurring amino acids include those encoded by the genetic code as well as amino acids that are later modified such as, for example, hydroxyproline, γ-carboxyglutamate and O-phosphoserine. Amino acid homologs refer to compounds having the same basic chemical structure as natural amino acids, i.e., a-carbon, carboxyl, amino and R groups (e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium) that bind hydrogen do. The homologues have a modified R group (eg, norleucine) or a modified peptide backbone but possess the same basic chemical structure as the natural amino acid. Amino acid analogs refer to chemical compounds that have a structure that differs from the general chemical structure of an amino acid, but which act in a similar manner to natural amino acids.
[24] Amino acids are referred to herein by the one letter symbols presented by the IUPAC-IUB Biochemical Nomenclature Committee or by commonly known three letter symbols. Likewise, nucleotides may be referred to by commonly used single letter codes.
[25] "Conservatively modified variants" applies to both amino acid and nucleic acid sequences. With respect to a particular amino acid sequence, conservatively modified variants refer to nucleic acids that encode identical or nearly identical amino acid sequences or to sequences that are nearly identical if the nucleic acids do not encode amino acid sequences. Specifically, degenerate codon substitutions can be obtained by preparing a sequence in which the third position of at least one selected (or all) codon is substituted with a mixed base and / or deoxyinosine residue (Batzer et al., Nucleic Acid Res. 19: 5081 (1991); Ohtsuka et al., J. Biol. Chem. 260: 2605-2608 (1985); Rossolini et al., Mol. Cell. Probes 8: 91-98 (1994). Because of the degeneracy of the genetic code, many nucleic acids with the same function encode any given protein. For example, GCA, GCC, GCG and GCU all encode the amino acid alanine. Thus, at all positions where alanine is specified by a codon, the codon can be altered with any corresponding codon described above without altering the encoded polypeptide. The nucleic acid variant is a "potential variant" and is a kind of conservatively modified variant. All nucleic acid sequences encoding polypeptides referred to herein also represent all possible latent variants of the nucleic acid. Those skilled in the art will appreciate that each codon of a nucleic acid (along with GUG in some organisms) is usually the only codon of methionine and TGG is usually the only codon of tryptophan) and can be modified to produce molecules with the same function. Thus, each latent variant of a nucleic acid encoding a polypeptide is latent within each described sequence.
[26] With respect to amino acid sequences, those skilled in the art will recognize that individual substitutions, deletions or additions to a nucleic acid, peptide, polypeptide or protein sequence that alter, add or delete a single amino acid or a small proportion of amino acids in an encoded sequence are referred to as "conservatively modified variants. This alteration results in the amino acid being replaced with chemically similar amino acids. Conservative substitution tables that provide functionally similar amino acids are known in the art. Such conservatively modified variants are added to and do not exclude polymorphic variants, interspecies homologs, and alleles of the invention.
[27] "Shuffling" refers to recombination between sequences that are not identical herein, and in some embodiments, shuffling refers to a non-homologous or homologous recombination such as a cre / lox and / or flp / frt system. May include intersection. Shuffling can be performed using a variety of different formats such as in vitro and in vivo shuffling formats, in silico shuffling formats, shuffling formats using double helix or single helix template, primers System shuffling format, nucleic acid fragmentation system shuffling format, oligonucleotide-mediated shuffling format (all of which are based on recombination results between unequal sequences, which are described in more detail below or in the references herein As well as similar recombinant system formats.
[28] Description of Preferred Embodiments
[29] The present invention provides a library of recombinant derivatization enzymes useful for preparing combinatorial libraries of chemical compounds, especially organic molecules. Also provided are libraries of organic molecular derivatives obtained using recombinant derivatization enzyme libraries. Since libraries of organic molecular derivatives are useful for identifying derivatives with the necessary biological activity, for example, they are suitable for testing as a leader (eg, for pharmaceutical or other uses) and have improved pharmacological or other It is suitable for generating a combinatorial library of pre-identified lead derivatives for testing parameters. Chemical compounds can often be organic molecules, including synthetic molecules (eg, non-natural compounds) and natural substances such as antibiotics.
[30] The library of recombinant derivatization enzymes provided herein provides several advantages over the methods that have been used in the past for obtaining libraries of organic molecular derivatives. For example, recombinant libraries can be characterized as catalyst speed and constant regions, stereospecificity, site specificity, enantiomeric specificity, multiple substrate specificities, product inhibition, stability in solvents used for biocatalyst synthesis, conventional chemistry Enzymes exhibiting different catalytic properties from one another in properties such as stability in the process. Multiplication of different enzymes results in an increase in the number of different compounds that can be produced in the biocatalytic reaction. When one enzyme is used in a biocatalyst method with a single organic molecule and a single chemical donor, usually one derivative is produced. Conversely, many recombinant enzymes will include enzymes that can catalyze different reactions compared to the original enzyme, so different products can be prepared even when starting with the same substrate as was used in the original enzyme. In addition, the use of enzymes for the synthesis of organic compounds of interest greatly increases the synthesis reaction by a certain percentage.
[31] In a preferred embodiment, a library of recombinant enzymes is prepared using DNA shuffling or other repetitive recombination methods. DNA shuffling has proven to be very effective in enhancing the known activity levels of biocatalysts. An additional value of this technique lies in the ability to prepare catalytic activities previously unknown in wild type enzymes. The technology thus provides a reliable means of biocatalyst preparation that reduces or even eliminates the need to obtain a natural biocatalyst for the targeted reaction. DNA shuffling of related gene families results in functionally diverse gene libraries with different physical properties that, for example, fill more complex sequence intervals than can be found in nature for a particular protein. Since new members of these enzyme libraries were not under selective pressure in living organisms, they are fair and can be screened for new activities that are rare or not present in natural samples. Thus, a variety of complex enzyme libraries can be prepared that catalyze the spectrum of important chemistry. For example, enzymes can modify the functional groups present on organic molecules, add chemical moieties on functional groups (eg, acylation, glycosylation, and methylation) and introduce new functional groups into organic molecules (eg, by hydration by oxidation). Introduction of a siloxane group, a double bond by reduction, or the like). Enzyme libraries can be used to directly synthesize multiple products starting from a substrate mixture or to synthesize specific compounds starting from a defined set of substrates. Alternatively, a single member of the recombinant enzyme library can be used to synthesize a mixture of compounds by contacting the member with the substrate mixture. In still other embodiments of the invention, a single member of the recombinant derivatization enzyme library can be tested using a limited set of substrates to identify enzymes with new useful substrate selectivity or other useful features.
[32] As a result, the synthesized organic molecular derivatives can then be screened or further modified by one or more additional chemical or enzymatic reactions to identify those having the required properties. Enzyme libraries can also be screened to identify enzymes with new useful substrate specificities or other necessary characteristics and the enzymes can be used to produce the required compounds.
[33] Recombinant enzymes obtained using the methods of the present invention can be expressed in microbial cells that are used in vitro or undergo biocatalytic reactions. In some embodiments, the microorganism is modified to express one or more derivatizing enzymes for efficient biocatalytic production of the derivatized product. For example, the microorganism may comprise one or more recombinant polynucleotides encoding an improved acyltransferase, glycosyltransferase, oxidase, methyltransferase or other biocatalytic enzymes, which are expressed by microbial cells. Can be. These polynucleotides can be introduced into an organism that naturally produces the starting substrate of interest. For example, polynucleotides encoding recombinant derivatization enzymes can be introduced into organisms engineered to naturally produce or produce polyketides or other antibiotics. Therefore, the recombinant polynucleotide encoding the recombinant derivatization enzyme of the present invention can be used for in vivo derivatization of an organic compound in which a main chain is prepared in advance, in vivo derivatization of an organic compound in an organism that biosynthesizes the main chain of an organic molecule, and It is useful for in vitro use to derivatize the prepared organic molecules.
[34] A. Generation of Recombinant Libraries
[35] The present invention provides for the necessary properties (eg, enhanced enzyme activity, stereospecificity, positional specificity, enantiospecific specificity), reduced sensitivity to inhibitors, process stability (eg, solvent stability, pH stability, thermal stability, etc.). Generating a recombinant library of polynucleotides to be screened to identify library members encoding enzymes or other polypeptides. Recombinant libraries can be generated using any of a variety of methods, including those disclosed herein. For example, various nucleic acid shuffling protocols are available in the art and fully disclosed. The following documents describe various such methods and / or methods that may be included in such methods, as well as various other production protocols: Stemmer et.al., (1999) "Molecular breeding of viruses for targeting and other clinical properties. Tumor Targeting "4: 1-4; Nesset et al. (1999)" DNA Shuffling of subgenomic sequences of subtilisin "Nature biotechnology 17: 893-896; Chang et al. (1999) "Evolution of a cytokine using DNA family shuffling" Nature Biotechnology l7: 793-797; Minshull and Stemmer (1999) "Protein evolution by molecula breeding," Current Opinion in Chemical Biology 3: 284-290; Christian set al. (1999) "Directed evolution of thymidine kinase for AZT phosphorylation using DNA family shuffling" Nature Biotechnology 17: 259-264; Crameri et al. (1998) "DNA shuffling of a family of genes from diverse species accelerates directed evolution" Nature 39l: 288-291; Crameri et al. (1997) "Molecular evolution of an arsenate detoxification pathway by DNA shuffling," Nature Biotechnology 15: 436.438; Zhang et al. (1997) "Directed evolution of an effective fucosidase from a galactosidase by DNA shuffling and screening" Proceedings of the National Academy of Sciences, USA. 94: 4504-4509; Patten et aI. (1997) "Applications of DNA Shuffling to Pharmaceuticals and Vaccines" Current Opinion in Biotechnology 8: 724-733; Crameri et al. (1996) "Construction and evolution of antibody-phage libraries by DNA shuffling" Nature Medicine 2: 100- 103; Crameri et al. (1996) “Improved green fluorescent protein by molecular evolution using DNA shuffling” Nature Biotechnology 14: 315-319; Gates et al. (1996) "Affinity selective isolation of ligands from peptide libraries through display on a lac repressor 'headpiece dimer'" Journal of Molecular Biology 255: 373-386; Stemmer (1996) "Sexual PCR and Assembly PCR" In: The Encyclopedia of Molecular Biology. VCH Publishers, New York. pp.447-457; Crameri and Stemmer (1995) "Combinatorial multiple cassette mutagenesis creates all the permutations of mutant and wildtype cassettes" BioTechniques 18: 194-195; Stemmer et al., (L995) "Single-stepassembly of a gene and entire plasmid form large numbers of oligodeoxyribonucleotides" Gene, 164: 49-53; Stemmer (1995) “The Evolution of Molecular Computation” Science 270: 1510; Stemmer (l995) “Searching Sequence Space” Bio / Technology 13: 549-553; Stemmer (1994) "Rapid evolution of a protein in vitro by DNA shuffling" Nature 370: 389-391; and Stemmer (l994) "DNA shuffling by random fragmentation and reassembly: In vitro recombination for molecular evolution." Proceedings of the National Academy of Sciences, USA. 91: l0747-10751.
[36] Further description of the DNA shuffling method has been found in the US patents by the inventor and his colleagues: US Pat. No. 5,605,793, Stemmer (February 25, 1997), "METHODS FOR IN VITRO RECOMBINATION;" U.S. Patent 5,811,238, Stemmer et al. (September 22, 1998) "METFIODS FOR GENERATING POLYNUCLEOTlDES HAVING DESIRED CHARACTERIS'l.ICS BY ITERATIVE SELECTION AND REQOMBNATION;" U.S. Patent 5,830,721, Stemmer et al. (3 November 1998), "DNA MUTAGENESIS BY RANDOM FRAGMENTATION AND REASSEMBLY;" U.S. Patent 5,834,252, Stemmer, et al. (November 10, 1998) “END-COMPLEMENTARY POLYMERASE REACTION,” and US Pat. No. 5,837,458, Minshul1, et al. (November 17, 1998), "METHOS AND COMPOSITIONS FOR CELLULAR AND METABOLIC ENGINEERING."
[37] In addition, the description and format of the DNA shuffling protocol is found in various PCT and foreign patent specifications, including: Stmmer and Crameri, "DNAMUTAGENESIS BY RANDOM FRAGNMENTATION AND REASSEMBLY" WO95 / 22625; Stemmer and Lipschutz "END COMPLEMENTARY POLYMERASE CHAIN REACTION" WO 96/33207; Stemmer and Crameri "METHODS FOR GENERATING POLYNUCLEOTIDES HAVING DESIRED CHARACTERISTICS BY ITERATIVE SELECTION AND RECOMBINATION 'WO 97/0078; VECTORS "WO 99/41402; Punnonen et al." ANTIGEN LIBRARY IMMUNIZATION "WO 99/41383; Punnonen et al .; GENETIC VACCINE VECTOR ENGINEERING" WO 99/41369; Punnonen et al. OPTIMIZATION OF IMMUNOMODULATORY PROPERTIES OF GENETIC VACCINES WO 9941368; Stemmer and Crameri, "DNA MUTAGENESIS BY RANDOM FRAGMENTATION AND REASSEMBLY" EP 0934999; Stemmer "EVOLVING CELLULAR DNA UPTAKE BY RECURSIVE SEQUENCE RECOMBINATION" EP 0932670; Stemmer et al., “MODIFICATION OF VIRUS TROPISM AND HOST RANGE BY VIRAL GENOME SHUFFLING” WO 9923 107; Apt et al., "HUMAN PAPILLOMAVIRUS VECTORS" WO 9921979; Del Cardayre et al. "EVOLUTION OF WHOLE CELLS AND ORGANISMS BY RECURSIVE SEQUENCE RECOMBINATION" WO 9831837; Patten and Stemmer, "METHODS AND COMPOSITIONS FOR POLYPEPTIDE ENGINEERING" WO 9827230; Stemmer et al., "METHODS FOR OPTIMIZATION OF GENE THERAPY BY RECURSIVE SEQUENCE SHUFFLING AND SELECTION" WO 9813487; Arnold et al. "RECOMBINATION OF POLYNUCLEOTIDE SEQUENCES USING RANDOM OR DEFINED PRIMERS" WO 9842832; Arnold et al. "METHOD FOR CREATING POLYNUCLEOTIDE AND POLYPEPTIDE SEQUENCES" WO 9929902; Vind, "AN ln vitro METHOD FOR CONSTRUCTION OF A DNA LIBRARY USING DNA SHUFFLING" WO 9841662.
[38] The US application provides a variety of other manufacturing methods, as well as additional descriptions of DNA shuffling and related techniques, as follows: "SHUFFLING OF CODON ALTERED GENES" Patten et al. US Ser. No. 60 / 102,362, filed September 29, 1998, US Ser. No. 60 / 117,729, January 29, 1999, and US Ser. 09 / 407,800, September 28, 1999 (Attorney Docket Number 20-28520US / PCT); "EVOLUTION OF WHOLE CELLS AND ORGANISMS BY RECURSIVE SEQUENCE RECOMBINATION", del Cardayre et al. Application filed July 15, 1998 (USSN 09 / 166,188), and July 15, 1999 (USSN 09 / 354,922); "OLIGONUCLEOTIDE MEDIATED NUCLEIC ACID RECOMBINATION" Crameri et al. Filed February 5, 1999 (USSN 60 / 118,813) and filed June 24, 1999 (USSN 60 / I41,049) and September 28, 1999 (USSN 09 / 408,392, Attomey Docket Number 02-29620US). ; And "USE OF CODON.BASED OLIGONUCLEOTIDE SYNTHESIS FOR SYNTHETIC SHUFFLING", filed Sept. 28, 999 (USSN 09 / 408,393, Attorney Docket Number 02-0l0070US); CHARACTERISTICS "Selifonov and Stemmer, filed February 5, 1999 (USSN 60/118854) and USSN 09 / 416,375 filed October 12, 1999. The shuffling format using a single helix mold is described in: "METHODS AND COMPOSITIONS FOR POLYPEPTIDE ENGINEERING," WO 9827230, Patten et al .; "SINGLE-STRANDED NUCLEIC ACID TEMPLATE-MEDIATED RECOMBINATlON AND NUCLEIC ACID FRAGMENT ISOLATION 'Affholter, USSN 60 / 186,482 filed March 2, 2000; "METHODS FOR GENERATING HIGHLY DIVERSE LlBRARIES," WO 0000632; and "METHOD FOR OBTAINING IN VITRO RECOMBINED POLYNUCLEOTIDE SEQUENCES, SEQUENCE BANKS, AND RESULTING SEQUENCES," WO 0009679.
[39] Looking at the foregoing publications, patents, published applications, and US patent applications, nucleic acid shuffling to provide new nucleic acids with the required properties can be performed by a number of published recombinant methods, and these methods can be used in a variety of other manufacturing methods. Can be combined with
[40] In summary, several different general classes of recombinant methods can be applied to the present invention and are described in the references cited above. First, the nucleic acid can be recombined in vitro by any of the various techniques described in the aforementioned references, including, for example, ligation and / or PCR resynthesis of the nucleic acid after DNAase digestion of the nucleic acid to be recombined. Second, nucleic acids can be recombined repeatedly in vivo, such as by recombination between nucleic acids in a cell. Third, all genomic recombination methods can be used to recombine all of a cell's genome or other organism, and optionally include spiking a genomic recombination mixture with the necessary library components. Fourth, synthetic recombination methods can be used to synthesize and resynthesize oligonucleotides corresponding to targets of interest in PCR or ligation reactions comprising oligonucleotides corresponding to one or more parent nucleic acids to generate new resynthesized nucleic acids. . Oligonucleotides can be prepared by standard nucleotide addition reactions or can be prepared by tri-nucleotide synthesis attempts. Fifth, genetic algorithms may be used in a computer using recombinant insilico methods to recombine sequence strings corresponding to nucleic acid homologs (or even non-cognate sequences). The resulting recombinant sequence string is selectively converted to nucleic acid by nucleic acid synthesis corresponding to the recombinant sequence, for example simultaneously with oligonucleotide synthesis / gene resynthesis techniques. Any preceding general recombinant format can be implemented in an iterative manner to produce a more diverse set of recombinant nucleic acids. Sixth, for example, hybridization of various nucleic acids or nucleic acid fragments into a single helix template followed by polymerization and / or ligation to regenerate to full length sequences, optionally approaching natural diversity by denaturation of the template and recovery of the resulting modified nucleic acid. Can be used.
[41] For purposes of explanation in one embodiment of the present invention, a shuffling method used to prepare polynucleotides encoding recombinant derivatization enzymes may be performed under conditions of overlapping a set of fragment polynucleotides to initiate a polynucleotide amplification process. One fragment is provided as a template for amplification of another fragment to produce a set of recombinant polynucleotides, and to select and screen the recombinant polynucleotides for the required properties.
[42] Overlapping fragments may be prepared by a variety of methods described herein or described in the references, including, for example, chemical synthesis, cleavage, or fragmentation, amplification, and other methods of a group of polynucleotides.
[43] In another embodiment, the shuffling method used to prepare the recombinant derivatization enzyme comprises at least two nucleic acid sets, wherein the first set of nucleic acids comprises a single helix nucleic acid template and the second set of nucleic acids comprises at least one set of nucleic acid fragments. Recombining a set of nucleic acid sequences by hybridizing and extending, ligating or both sequence gaps between the hybridized nucleic acid fragments to produce at least nearly full length chimeric nucleic acid sequences corresponding to the single helix nucleic acid template. And denaturing nearly full length chimeric nucleic acid sequences and single helix nucleic acid templates, and optionally separating at least full length chimeric nucleic acid sequences from a single helix nucleic acid template by one or more separation techniques and separating at least nearly full length. Nuclease Digestion of Chimeric Nucleic Acid Sequences It is a step of fragmentation and to physical fragmentation provides a chimeric nucleic acid fragment.
[44] The foregoing references provide various modifications of these and other basic recombinant formats as well as these formats. Regardless of the shuffling format used, the nucleic acids of the invention are recombined (either with or with or without regard to each other) to produce a variety of recombinant nucleic acid sets (eg, homologous nucleic acid sets).
[45] Following recombination, any nucleic acid produced can be selected for the required activity. In connection with the present invention, any activity that can be detected in an automated format is tested and identified by any analytical method in the art. Various related (or irrelevant) properties are analyzed using various analytical methods. These methods are automated in accordance with the present invention as described herein.
[46] DNA mutagenesis and shuffling provide a robust and widely applicable means of diversity formation useful for the manipulation of proteins, pathways, cells and organisms with improved properties. In addition to the basic format described above, it is sometimes desirable to combine shuffling methods with other techniques to form diversity. Various diversity forming methods can be performed in conjunction with (or separately) the shuffling method and the results (ie, populations with varying nucleic acids) are screened in the system of the present invention. Additional diversity can be introduced by mutagenesis methods known in the art.
[47] Mutagenesis methods are included, for example, in the contents of the following references: Publ. No. 'WO 98/42727; Ling et al. (L997) "Approaches to DNA mutagenesis: an overview" ln: Anal Biochem. 254 (2): 157-78; Dale et al. (1996) "Oligonucleotide-directed random mutagenesis using the phosphorothioate method. "Methods Mol Biol. 57: 369-74; Smith (1985)" In vitro mutagenesis "Ann. Rev. Genet. 19,423-462; Botstein and Short 1e (1985)" Strategies and applications of in vitro mutagenesis "Science 229 , 1 193- 1201; Carter (1986) "Site-directed mutagenesis" Biochem J 237, 1-7; Kunkel (i987) "The efficiency of oligonucleotide directed mutagenesis" Nucleic Acids & Molecular Biology) Eckstein, F. and Lilley, DMJ eds Springer Verlag, Berlin) Inducing mutations using uracil-containing templates (Kunkel (1985) "Rapid and .efficient site-specific mutagenesis without phenotypic selection" Proc. Natl. Acad. Sci. USA 82, 488-492; Kunkel, TA, Roberts, JD & Zakour, RA (198.7) "Rapid and efficient site-specific mutagenesis without phenotypicselection" Methods in Enzymol. 154, 367-382; Bass, S., V.Sorrels, and P. Youderian (1988) "Mutant Trp repressors with new DNA-binding specificities "Science 242: 240-245); Inducing Oligonucleotide Designated Mutations (for review see, Smith, Ann. Rev. Genet. 19: 423-462 (1985); Botstein and Short 1e, Science 229: 1193-120l, (1985); Carter, Biochem. J. 237: 1-7 (1986); Kunkel, "The efficiency of oligonucleotide directed mutagenesis" in Nucleic Acids & Molecular Biology, Eckstein and Lilley, eds., Springer Verlag, Berlin (1987)); Oligonucleotide-directed mutations (Methods in Enzymol. 100: 468-500 (1983), and Methods in Enzymol. 154: 329-350 (1987); Zoller & Smith (1982) "Oligonucleotide-directed mutagenesis using M13-derived vectors: an efficient and general procedure for the production of point mutations in any DNA fragment ", Nucleic Acids Res. 10, 6487-6500. Zoller & Smith (1983)" Oligonucleotide-directed mutagenesis of DNA fragments c1oned into M13 vectors "Methods in Enzymo1. 100, 468-500 Zoller & Smith (l987) "Oligonucleotide-directed mutagenesis: a simple method using two oligonucleotide primers and a single-stranded DNA template" Methods in Enzymol. 154, 329-350) phosphothioate modified DNA mutations Induction (Taylor et al. (1985) "The use of phosphorothioate-modified DNA in restriction enzyme reactions to prepare nicked DNA" Nuc1.Acids Res. 13: 8749-8764; Taylor et al. (1985) "The rapid generation of oligonucleotide -directed mutations athigh frequency using phosphorothioate-modified D NA "Nucl. Acids Res. 13: 8765-8787 (1985); Nakamaye and Eckstein (1986)" lnhibition of restriction endonuclease Nci I cleavage by phosphorothioate groups and its application to oligonucleotide-directed mutagenesis "Nucl. Acids Res. 14: 9679-9698; Sayers et al. (1988), Nucl. Acids Res. "Y-T Exonucleases in phosphorothioate-based oligonucleotide-directed mutagenesis". 16: 791.802; Sayers et al ,. (1988) Strand specific cleavage of phosphorothioate-containing DNA by reaction with restriction endonucleases in the presence of ethidium bromide "Nucl.Acids Res. 16: 803-814), mutagenesis using uracil-containing templates (Kunkel, Proc. Natl. Acad. Sci. USA 82: 488-492 (1985) and Kunkel et al., Methods in Enzymol. 154: 367-382); inducing mutations with gapn duplex DNA (Kramer et aI., "The gapped duplex DNA approach to oligonucleotide-directed mutation construction "Nucl. Acids Res. 12: 9441-9456 (1984); Kramer and Fritz, Methods in Enzymol." Oligonucleotide-directed construction of mutations via gapped duplex DNA "l54: 350-367 (1987); Kramer et al., Nucl. Acids Res. 16: 7207 (l988)); Fritz et al. (1988) "Oligonucleotide-directed construction of mutations: a gapped duplex DNA procedure without enzymatic reactions in vitro" Nuc1. Acids Res. 16 : 6987-6999 (1988) Mutagenesis using Gapped Duplex DNA; Kramer, W., Ohmayer, A. & Fritz, H.-J. (1988) "lmproved enzymatic in vitro reactions in the gapped duplex DNA approach to oligonucleotide-directed construction of mutations Nucleic Acids Res. 16, 7207; and Bass, S., V. Sorrels, and P. Youderian (1988) "Mutant Trp repressors with new DNA-binding specificities" Science 242: 240-245)
[48] Additionally suitable methods include point injury treatment (Kramer et al. (1984) "Point Mismatch Repair" Cel1 38: 879-887 (1984)), mutagenesis using repair-deficient host strains (Carter et al. (1985) " Improved oligonucleotide site-directed mutagenesis using M13 vectors "Nucl. Acids Res. 13: 443 14443 (1985); Carter (1987)" Improved oligonucleotide-directed mutagenesis using M13 vectors "Methods in Enzymol. 154: 382-403), deletion mutations Eghtedarzadeh and Henikoff (1986) "Use 0f oligonucleotides to generate large deletions" Nucl.Acids Res. 14: 5115), restriction selection and restriction purification (Wells et al. (1986) Importance of hydrogen-bond formation in stabilizing the transition state of subtilisin "Phil. Trans. R. Soc. Lond. A 317: 415-423), causing mutations by whole gene synthesis (Nambiar et al. (1984)" Tota1 synthesis and cloning of a gene coding for the ribonuclease S protein "Science 223: 1299-1301; Sakamar and Khorana (1988)" Total synthesis and expression of a gene for the a-subunit of bovine rod outer segment guanine nucleotide-binding protein (transducin) "Nuc1. Acids Res. 14: 6361-6372; Wells et al. "Cassette mutagenesis: an efficient method for generation of multiple mutations at defined sites" Gene 34: 3l5-323 (1985); and Grundstrom et a I. (1985) "Oligonucleotide-directedmutagenesis by microscale 'shot-gun' gene synthesis." Nucl. Acids Res. 13: 3305-33 16), Band aid (Mandecki (1986) "Oligonucleotide-directed double-strand break repair in plasmid of Escherichia coli: a method for site-specific mutagenesis" Proc. Nat'l. Acad.Sci. USA, 83: 7177-7181) / Additional details on many of the above methods can be found in Methods
[49] in Enzymology, Volume 154, which also describes useful controls for trouble-shooting problems with various mutagenesis methods.
[50] Mutagenesis kits are commercially available, for example, kits are commercially available from Stratagene (e.g., QuickChange site-directed mutagenesis kit; Chameleon double-stranded, site-directed mutagenesis kit), Bio / Can Scientific, Bio -Rad (eg, using the Kunkel method described above), Boehringer Mannheim Corp., Clonetech Laboratories, DNA Technologies, Epicentre Technologies (eg, 5 prime 3 prime kit); Genpak Inc, Lemargo lnc, Life Technologies (Gibco BRL), New England Biolabs, Phannacia Biotech, Promega Corp., Quantum Biotechnologies, Amersham International plc (e.g., Eckstein method described above), and Anglian Biotechnology Ltd (e.g., Carter. Winter method).
[51] In addition, any of the aforementioned shuffling techniques can be used in conjunction with processes that introduce additional diversity into genomes such as the bacterial genome. For example, techniques have been proposed to produce nucleic acid multimers suitable for transfection with various species (including E. coli and B. subtilis) (see Schellenberger US Pat. No. 5,756.316). DNA shuffle, when the multimers are composed of genes that are different from each other (e.g., from error-prone PCR or through pathways of mutant bacterial strains through application of natural variability or through application of localized mutagenesis) and are transformed with the appropriate host Additional sources of nucleic acid diversity for the ring are introduced. Multimers transformed with host species are particularly suitable as substrates for in vivo shuffling protocols. Alternatively, multiple polynucleotide covalent sites with partial sequence similarity can be transformed into a host species and recombined in vivo by the host cell. Continuous circulation of cell division can be used to prepare libraries, members thereof, each comprising a single cognate population of homologous monomers or pooled nucleic acids. Alternatively, monomeric nucleic acids can be recovered by standard techniques and recombined in any of the shuffling formats described above.
[52] A shuffling format using a chain termination method has been proposed (see US Pat. No. 5,965,408). In this approach, double helix DNAs corresponding to one or more gene sharing sites with sequence similarity are denatured in combination with or without primers specific for that gene. The single helical polynucleotide is then annealed and the polymerase and chain terminators (e.g., uv, gamma or X-ray radiation; iridium bromide or other intercalators; DNA binding proteins such as single helix binding proteins, transcriptional activation factors, Or incubated in the presence of histones, polycycle aromatic hydrocarbons, trivalent chromium or trivalent chromium salts, or abbreviated polymerization mediated by rapid thermal cycling, etc. to produce partial double molecules. Partial double molecules (eg, containing partial extension chains) are then denatured and annealed in a continuous cycle of replication or partial replication to produce polynucleotides that share varying degrees of sequence similarity, which affects an initial population of DNA molecules. It is chimeric. Optionally, the product or partial pool of products may be amplified in one or more stages of the process. Polynucleotides produced by the chain termination method (as described above) are suitable substrates for further DNA shuffling according to any of the formats described above.
[53] The diversity can be further increased using a non-homologous based shuffling method (as described in the literature and applications described above, and can be based on homogeneity or non-homogeneity depending on the exact format). ). For example, in vitro or in vivo using incremental short cuts for the production of hybrid enzymes (ITCHY) described in Ostermeier et al (1999) "A combination approach to hybrid enzymes independent of DNA homology" Nature Biotechnol. The shuffling method can produce shuffled libraries, which can optionally be provided as a substrate for one or more sson rings. Ostermeier et al. (1999), "combinatorial protein engineering by incremental truncation," Proc. Nat'l. Acad. Sci. USA 96: 3562-3567; See Ostermeier et al. (1999), "Incremental truncation as a strategy in the engineering of novel biocatalysts," Biological and Medicinal Chemistry, 7: 2139-2144.
[54] Methods of making multi-expression libraries have been disclosed (eg, US Pat. Nos. 5,783,431 and 5,824,485) and their use has been proposed to identify protein activity of interest (US Pat. No. 5,958,672). Multivariate expression libraries are generally libraries comprising genomic sequences or cDNAs derived from multiple species or strains operably linked to appropriate regulatory sequences in an expression cassette. cDNA and / or genomic sequences were optionally chained randomly to further enhance diversity. The vector may be a shuttle vector suitable for transformation or expression in a host organism, such as a bacterial species, one or more species of eukaryotic cells. In some cases, the library is biased by preselected sequences that encode a protein of interest or hybridize a nucleic acid of interest. Any of the above libraries can be provided as a substrate for any shuffling method described herein.
[55] In some applications, it is desirable to preselect and prescreen libraries (eg, amplified libraries, genomic libraries, cDNA libraries, generalized libraries, etc.) or other substrate nucleic acids prior to shuffling. Or it is desirable to bias the substrate against the nucleic acid encoding the functional product (the shuffling process can also have these effects independently). For example, in the case of antibody manipulation, any of the aforementioned methods can take advantage of the in vivo recombination case prior to DNA shuffling to bias the shuffling process for antibodies with functional antigen binding sites. For example, after a recombinant CDR derived from a B cell cDNA library is amplified and combined with an outer conformation region (eg, Jirholt et al, (1998) "Exploiting sequence space: shuffling in vivo formed complementarity determining regions into a master framework Gene 215: 471) can be DNA shuffled according to any of the methods described herein.
[56] Libraries can be biased against nucleic acids encoding proteins with desirable enzymatic activity. For example, after identifying a clone from a library that exhibits specific activity, any known method for introducing DNA alterations can be used to mutate the clone, such as, for example, DNA shuffling but It is not limited. Libraries containing mutagenesis homologs are then screened for desired activity, which may be the same as or different from the initial specific activity. An example of this process is proposed in US Pat. No. 5,939,250. Preferred activity can be identified by any method known in the art. For example, WO99 / 10539 can be screened by a gene library combining extracts from the gene library with components obtained from metabolically enriched cells and identifying combinations that exhibit desirable activity. Clones with desirable activity insert bioactive substrates into the samples of the library and bioactive fluorescence corresponding to the product with the desired activity using a fluorescence detector (e.g., a flow cytometer, a CCD, a fluorometer, or a spectrometer). It has been proposed that this can be identified by detection (eg WO 98/58085).
[57] The library is also biased against nucleic acids with specific properties (eg hybridization to selected nucleic acid probes). For example, application WO99 / 10539 discloses preferred activity (eg, enzymatic activity such as lipase, esterase, protease, glycosidase, glycosyl transferase, phosphatase, kinase, oxygenase, peroxy). It is proposed that polynucleotides encoding multidase, hydrolase, hydratase, nitrilase, transaminase, amidase or acylase) can be identified in genomic DNA sequences in the following manner. Single helix DNA molecules derived from a group of genomic DNA hybridize to a ligand-conjugated probe. These genomic DNAs may be derived from cultured or uncultured microorganisms or from environmental samples. Alternatively, genomic DNA can be derived from multicellular organisms or tissues derived therefrom.
[58] The second helix synthesis can be performed directly from the hybridization probes used for capture, with or without prior release from the capture medium, or in various other strategies known in the art. Alternatively, isolated single helix genomic DNA ends can be fragmented without further cloning and used directly in the shuffling format using a single helix template. Some single helix mold shuffling formats are described in WO 98 27239, "METHOD AND COMPOSITIONS FOR POLYPEPTIDE ENGINEERING." Patten et al .; "SINGLE-STRANDED NUCLEIC ACID TEMPLATE-MEDIATED RECOMBINATION AND NUCLEIC ACID FRAGMENT ISOLATION" by Affholter, USSN 60 / 180,482, filed March 2, 2002; "METHODS FOR GENERATING HIGHLY DEVERSE LIBRARIES," WO 0000632; And "METHOD FOR OBTAINING IN VITRO RECOMBINED POLYNUCLEOTIDE SEQUENCE BANKS AND RESULTING REQUENCES," WO 0009679. In the above method, a partial or nearly full length ssDNA or RNA in which a population of fragments derived from genomic library (s) corresponds to the opposite helix. Is annealed as. Combinations of complex chimeric genes derived from these populations are mediated by nuclease-based removal of non-hybridized fragment ends, polymerization that fills the gap between the fragment and subsequent single helix ligation. The parent helix can be removed by digestion (if it contains RNA or uracil), magnetic separation under denaturing conditions (if labeled in a way that aids this separation), and other available separation / purification methods. Alternatively, the parent helix can optionally be purified with chimeric helix and removed during subsequent screening or processing steps.
[59] In conventional trials, single helix molecules are converted to double helix DNA (dsDNA) and the dsDNA molecules are bound to the solid support by ligand mediated binding. After separation of unbound DNA, the selected DNA molecule is released from the support and introduced into the appropriate host cell to produce a library rich sequence that hybridizes the probe. Libraries prepared in this manner use any of the shuffling reactions described herein to provide a preferred substrate for further shuffling.
[60] It will be appreciated that any of the aforementioned techniques suitable for enriching the library prior to shuffling can be used to screen products made by the DNA shuffling method.
[61] In presently preferred embodiments, the recombinant library is prepared using DNA shuffling. Shuffling and screening or selection can be used to "evolve" individual genes, whole plasmids or viruses, multigenic clusters, or even whole genomes (Stemmer (1995) Bio / Technology 13: 549-553). Repeated cycles of recombination and screening / selection may optionally be performed to further evolve the nucleic acid of interest. This technique does not require the extensive analysis and calculations required by conventional methods for polypeptide manipulation. Shuffling allows large amounts of mutant recombination in a minimal number of screening / selection cycles, as opposed to conventional bidirectional recombination cases. Thus, the sequence recombination techniques described herein allow them to recombine between mutations in some or all of these. Providing a particular advantage provides a very rapid way of examining in a way that various combinations of mutations can affect the desired outcome. However, in some embodiments, structural and / or functional information does not require sequence recombination but is useful to provide an opportunity for modification of the present technology.
[62] These shuffling methods typically use two or more variant forms of the starting nucleic acid substrate. Variant forms of candidate substrates show substantial sequence or secondary structural mutual similarity but they must differ at two or more positions. Thatched diversity between forms may be the result of natural variation, for example, different variant forms (homologs) may be obtained from different individuals or strains (including geometric variants) of an organism or constitute related sequences (such as allelic variations) from the same organism. do. Alternatively, initial diversity may be induced, such as the use of a polymerase that lacks the corrective activity of the first variant form (see Liao (1990) Gene 88: 107-111) or error prone PCR. By error prolon transcription, or by replication of the first form in a mutagenic strain, or by mutagenic processes of DNase fragments and resynthesis by error prolon polymerase. Initial diversity between substrates is greatly amplified in successive stages of repetitive sequence recombination.
[63] In a preferred embodiment, shuffling of nucleic acid “groups” is used to generate a library of recombinant polynucleotides. When a group of nucleic acids is shuffled, nucleic acids encoding homolog polypeptides from different strains, species or gene groups or portions thereof are used as nucleic acids of different forms. Since the genome provides an increasing amount of sequence information, the likelihood of directly amplifying homologues with designated primers increases. For example, given a sequence of lipase or protease genes derived from several species, one can designate primers for amplification of homologues. The resulting nucleic acid fragments can then be shuffled.
[64] All shuffling methods described herein can be readily used in the practice of the present invention. For example, in codon modified shuffling ("SHUFFLING OF CODON ALTERED GENES" Patten et al, filed September 28, 1998 (USSN 60 / 102,362), January 29, 1999 (USSN 60 / 117,729) and 1999). (Detailed in US Sep. 09 / 102,362), the codons encoding polypeptides can be mutated to allow nucleic acids to be synthesized to allow access to a completely different variant cloud upon successive mutations of the nucleic acid. This increases the sequence diversity of the initial nucleic acid for the shuffling protocol, which changes its speed to enhance the evolutionary process. Codon modification procedures may be used to modify any derivatization enzymes encoding nucleic acids herein (eg, prior to performing DNA shuffling) or codon alteration attempts may be used with oligonucleotide shuffling procedures as described herein above. Can be.
[65] Codon modified shuffling includes selecting a first nucleic acid sequence that encodes a first polypeptide sequence or portion thereof. Numerous codon modified nucleic acid sequences, each of which encodes all or part of the first polypeptide or a modified or related polypeptide, are then selected (e.g., a codon modified nucleic acid library is selected from a biological assay that recognizes a library component or activity). A plurality of codon altering nucleic acid sequences may be recombined to produce nucleic acids with modified target codons encoding some or all of the second protein. The nucleic acid with altered target codons is then screened for detectable functional or structural properties and optionally comparing with the properties of the first polypeptide and / or related polypeptide. The purpose of this screening is to identify polypeptides having structural or functional properties that are equivalent to or better than the first polypeptide or related polypeptide. The nucleic acid encoding the polypeptide may be subjected to any process substantially necessary, including introducing the nucleic acid with the target codon altered into a cell, vector, virus (eg, as a component of a vaccine or immunological composition), transformed organism, or the like. Can be used.
[66] Selifonov and Stemmer, METHODS FOR MAKING CHARACTER STRINGS, POLYNECLEOTIDES & POLYPEPTIDES HAVING DESIRED CHARACTERISTICS, filed Feb. 5, 1999 (USSN 60,118,854) and Oct. 12, 1999 (USSN 09 / 416,375). (In detail) uses a computer algorithm to perform "virtual" shuffling using a genetic operator in a computer. As applied in the present invention, the derivatizing enzyme gene sequence string is recombined in a computer system to produce the required product (eg, by resynthesis PCR of synthetic oligonucleotides). In summary, genetic effectors (algorithms that represent certain genetic cases, such as point mutations, recombination of two-helix homologous nucleic acids, etc.) are used in model recombination or mutation cases that may occur in one or more nucleic acids, e.g. Alignment (using standard alignment software or by manual inspection or manual alignment) and used to predict recombinant results. The predicted recombinant product is used to generate the corresponding product (eg, by oligonucleotide synthesis and resynthesis PCR).
[67] In "Oligonucleotide-mediated shuffling" (Crameri et al. "OLIGONUCLEOTIDE MEDIATED NUCLEIC ACID RECOMBINATION", filed February 5, 1999 (USSN 60 / 118,813), and June 24, 1999 (USSN 60 / 141,049). ) And oligonucleotides corresponding to a group of related homologous nucleic acids (e.g., as applied to the present invention, or allelic mutants between derivatizing enzyme species encoding nucleic acids), filed September 28, 1999, and USSN 09 / 408,392. ) Recombinantly produces a selectable nucleic acid.
[68] One advantage of oligonucleotide-mediated recombination is the ability to recombine homologous or non-homologous nucleic acids with low sequence similarity. In these low homologous oligonucleotide shuffling methods, one or more sets of nucleic acid fragments are recombined, for example, into one set of crossgroup diversity oligonucleotides. Each of these cross oligonucleotides has multiple sequence diversity domains corresponding to multiple sequence diversity domains derived from homologous or non-homogeneous nucleic acids with low sequence similarity. Cross oligonucleotides derived by comparison with one or more homologous or non-homologous nucleic acids can be hybridized to one or more regions of a nucleic acid fragment to facilitate recombination.
[69] When recombining homologous nucleic acids, a group of overlapping groups of oligonucleotides (which are derived by homologous nucleic acid comparison and synthesis of oligonucleotide fragments) are hybridized and extended (eg, by resynthesis PCR) to provide desirable characteristics. Or a plurality of recombinant nucleic acids that can be selected for their nature. Typically, a group of overlapping oligonucleotides comprises a plurality of oligonucleotide member forms, which have subsequent consensus regions derived from a plurality of homologous target nucleic acids. Generally, a group of overlapping oligonucleotides is provided by arranging homologous nucleic acid sequences to select sequence identification preservers and sequence diversity regions. Synthesizing multiple oligonucleotides in series or in parallel, corresponding to one or more sequence diversity regions.
[70] A subset of fragments, or subsets of fragments used in oligonucleotide shuffling attempts, are cleaved (e.g., with DNA) of one or more homologous nucleic acids, more generally a group of oligos corresponding to multiple regions of one or more nucleic acids. It can be provided by synthesizing nucleotides (usually oligonucleotides corresponding to full length nucleic acids are provided as part of a nucleic acid fragment). In the shuffling process described herein, these fragments (eg, fragments of derivatization enzymes encoding nucleic acids) can be used with shuffling oligonucleotide groups (eg, recombinant derivatizations encoding enzymes). One or more recombinant reactions to prepare nucleic acids).
[71] Often, improvements are made after one cycle of recombination and screening / selection. However, repeated sequence recombination can be performed to achieve better improvements in desirable properties. Sequence recombination can be accomplished in a wide variety of formats and permutations of formats, sharing some common principles. Repetitive sequence recombination involves a continuous cycle of recombination to produce molecular diversity. That is, when a group of nucleic acid molecules are generated, some sequence identity to each other is shown, but they differ in terms of the presence of mutations. In any given cycle, recombination can occur in vitro or in vivo, intercellularly or extracellularly. Moreover, the diversity resulting from recombination can be augmented in any cycle by applying conventional methods of mutagenesis (eg error-prone PCR or cassette mutagenesis) to the substrate or recombinant product. In some cases, new or improved properties or characteristics, when using different and different forms of sequence, as homologues of different individuals or strains of an organism, or as related sequences from the same organism, as allelic variants, in vitro or fresh vegetables After only a single cycle of recombination can be achieved.
[72] Recombinant polynucleotide expression to obtain recombinant derivatization enzymes can generally be performed intracellularly. Libraries of recombinant polynucleotides can be generated in vitro or in vivo, which are described in US Pat. No. 5,837,458. Thus, in in vitro library preparation, recombinant polynucleotides are introduced into cells for expression.
[73] Derivatizing Enzymes for Biocatalytic Synthesis of B Combination Library
[74] The method of the present invention can be applied to a wide variety of derivatizing enzymes that can catalyze the modification of organic molecules of interest. The enzyme can modify the substrate, for example by adding a functional group to the molecule or by modifying a functional group present on the molecule. Adding a chemical moiety onto a functional group is also a variant of interest. In presently preferred embodiments derivatization enzymes are not added to the backbone length of the organic molecule. Reaction forms of interest are described, for example, in Khmelnitsky et al. (1996) Molecular Diversity and Combinatorial Chemistry, Chapter 14 pp144-157 (American Chemical Society), as well as Michels et al. (1998) Tibtech 16: 210-215. It is. Examples of various forms of derivatizing enzymes and the application of the methods of the invention to these enzymes are described below.
[75] In addition to the increased variety of enzymatic activities found in recombinant enzyme libraries, organic compounds such as natural compounds, non-natural compounds (eg 5-fluorouracil, azidothymidine, etc.), small molecules, and polymers (such as , Peptides and peptide variants, oligonucleotides / polynucleotides and variants thereof, polyhydroxyalkanoates, polysaccharides, polylactic acid, copolymers of polylactic acid and glycolic acid, polyethylene glycol, etc.) Enzymes with enhanced specific properties can also be obtained that increase utility. Small molecules used in the practice of the present invention typically have a molecular weight of about 2500 Daltons or less, and typically have a molecular weight of about 2000 Daltons, sometimes of about 1500 Daltons or less.
[76] These libraries can be screened to identify those library members that encode enzymes that show improvement compared to wild-type enzymes in properties and desirable properties for use in reactions of interest. For example, screening can be performed to identify those library members that encode enzymes that have enhanced substrate specificity for a particular compound or enhanced regioselectivity for desired functional groups on the compound.
[77] In some embodiments, the library of recombinant derivatization enzymes is any wild type gene variant that has been mutated by diversity generating methods as described herein, such as shuffling and gene resynthetic shuffling processes. Close sampling can thus provide limited but complete diversity around a given sequence. In other embodiments, the recombinant library produces a recombinant library by applying a diversity generation method to several different wild-type genes. Limited and incomplete diversity is achieved, which is all distributed throughout the functional sequence space as in poor sampling. In the case of making new enzyme specificities, this latter technique is preferred.
[78] 1. Modification of existing functional groups and introduction of new functional groups into organic molecules
[79] In some embodiments, recombinant derivatization enzymes and libraries thereof can catalyze functional group modifications present on organic molecules of interest, such as leader material. For example, a derivatization agent of interest can oxidize or reduce functional groups, hydrolyze groups, and replace one functional group with another. Other reactions of interest include lactonation, isomerization and epimerization.
[80] a. Hydroxylation
[81] In some embodiments, the hydrogen of the organic molecule is substituted with a hydroxyl group. This often results in profound alterations in biological activity. Since hydroxylation is the first gateway through the liver, it is often associated with increased metabolism. Introducing hydroxyl groups in drug candidates may also contribute faster metabolism by the continuous activity of groups delivering enzymes (eg, enzymes that catalyze methylation, sulfidation, phosphorylation and glycosylation).
[82] Among the derivatizing enzymes useful for introducing hydroxyl groups are mono and deoxygenases. A range of monooxygenases known in the art provides a suitable starting point for making libraries of recombinant monooxygenases useful in the methods of the invention. One useful group of monooxygenases is exemplified by heme-dependent eukaryotic and bacterial sheetchrome P-450. In the presence of oxygen and a complete redox recycle system, P450 exhibits monooxygenase activity. However, the addition of hydrogen peroxide or other peroxides can be used to bypass the NAD (P) H need for many of the same substrates (ie, enable peroxidase activity). Enzyme performance such as P450 for carrying out chemistry at chemically different positions is very well known. Steroid modifications of naturally occurring P450 are widely spread in biosynthesis and drug metabolism. Thus, for example, shuffled libraries of P450 can create many new points of attachment for further chemical reactions (or enzymatic derivatization) or screening. Other groups of enzymes referred to herein may also have utility in creating new structural diversity in a group of clinically important compounds.
[83] The P450 monooxygenase gene family is particularly well suited for the use of group shuffling to obtain recombinant derivatization enzymes. About 70-80 groups of P450 monooxygenase from a wide variety of species are known. For identification of homologous genes that can be shuffled together as a group, a representative array of P450 enzymes is described in Appendices of volume CYTOCHROME P450; STRUCTURE, MECHANISM, AND BIOCHEMISTRY 2nd edition (Paul R. Oritz de Monttellano) Plenum Press, New York, 1995) ("Oritz de Montellano"). A recent list of P450s is available electronically on the World Wide Web (http://drnelson.utmem.edu/homepage,html). To illustrate the application of shuffling to improve the P450 family of enzymes, more than 1000 members of these superfamily are selected and arranged into similar homologous sequences and then shuffled to homologous sequences. . For example, the gene for the bovine group P450 _SCC enzyme, CYP11A1, belongs to the group closely related to P450. DNA shuffling (Crameri et al., Nature 391: 288) can be used to generate hybrid variants from a family of genes, and libraries thereof can be used to prepare combinatorial libraries of organic molecular derivatives. Specifically, Streptomyces produces P450 monooxygenase, which is used for the production of natural products such as antibiotics. Examples of P450 monooxygenase genes suitable for shuffling include the following, each of which is at least 45% identical at the amino acid level.
[84] Cytochrome p450 monooxygenase (S. venezuelae) AF087022
[85] Cytochrome p450 monooxygenase (Sac. Erythrae) M83110
[86] Cytochrome p450 monooxygenase (Sac. Erythrae) M54983
[87] Cytochrome p450 monooxygenase (S. hydroscopicus) X86780
[88] Cytochrome p450 monooxygenase (S. antibioticus) L47200
[89] Library generation of the recombinant p450 monooxygenase gene is described in more detail in co-pending US patent application Ser. No. 60 / 148,850, filed Aug. 12, 1999.
[90] Note that the basic chemistry described below with respect to monooxygenase is known. In addition to Oritz de Montellano (homologous), general guidance on the various chemistry involved is found in Stryer (1988) BIOCHEMISTRY, 3rd edition (or later). New York, NY; Pine et al. ORGANIC CHEMISTRY FOURTH EDITION (1980) McGraw-Hill, Inc. (USA) (or later); March, ADVANCED-ORGANIC CHEMISTRY REACTIONS, MECHANISMS and Structure 4th edition. J. Wiley and Sons (New York, NY, 1992) (or later editions); Greene, et al., PROTECTIVE GROUPS IN ORGANIC CHEMISTRY, 2nd Ed., John Wiley & Sons, New York, NY, 1991 (or later); Lide (ed) (1995) THE CRC HANDBOOK OF CHEMISTRY AND PHYSICS 75TH EDITOLON (Or later editions); And the references cited therein. Moreover, in-depth guidance on a number of chemicals and industrial processes applicable to the present invention can be found in KIRK-OTHMER ENCYCLOPEDIA OF CHEMICAL TECHNOLOGY (3rd and 4th editions, published throughout 1998), MartinGrayson, Executive Editor, Wiley-Interscience, John Wiley and Sons, NY, and references cited therein ("Kirk-Othmer").
[91] Other monooxygenase enzymes and other modifications of organic molecules suitable for the introduction of hydroxyl groups are those having activities such as alkane oxidation (eg, hydroxylation, ketone formation, aldehyde formation, etc.), alkene epoxidation, aromatic hydroxyls Silylation, N-dealkylation (eg of alkylamines), S-dealkylation (of reduced thio organics), O-dealkylation (eg of alkylethers), oxidation of aryloxyphenols, conversion of aldehydes to acids , Conversion of alcohols to aldehydes or ketones, dehydrogenation, decarbonylation, oxidative dehalogenation of haloaromatics and halohydrocarbons, Baeyer-Villiger monooxygenation, modification of cyclosporin, hydroxylation of mevastatin, erythromycin And those having activities such as hydroxylation, N-hydroxylation, sulfoxide formation, or oxidation of sulfonylureas. Other oxidative conversions will be apparent to those skilled in the art. Examples of suitable monooxygenases for use in the present invention are described in US application Ser. No. 09 / 373,928, filed "DNA SHUFFLING OF MONOOXYGENASE GENES FOR PRODUCTION OF INDUSTRIAL CHEMICALS," filed August 12, 1999.
[92] Deoxygenase is another group of derivatizing enzymes useful for biocatalytic synthesis of organic molecular derivatives. Bacterial arene deoxygenase (ADO) can, for example, oxidize π bonds to the corresponding adjacent diols. In the presence of oxygen, in the presence of reducing compounds such as NAD (P) H, these enzymes catalyze the reductive deoxygenation of various compounds as well as aromatic rings and non-aromatic multiple bonds. The non-phenolic nature of the cyclic cis-dihydroxylation products resulting from the action of arene deoxygenases can be used to prepare organic molecular derivatives by avoiding toxic accumulations and reactive epoxide intermediates that can seriously impair the performance of the biocatalyst. It offers excellent advantages.
[93] Arene dioxygenase is, for example, toluene 2,3-dioxygenase, isopropylbenzene 2,3-dioxygenase, benzene-1,2-dioxygenase, biphenyl-2,3-dioxygenase naphthalene-1 , 2-dioxygenase and many homologous and / or functionally similar enzymes. Suitable arene deoxygenase-encoding polynucleotides can be obtained from many organisms using cloning methods known to those skilled in the art. The following list provides examples of polynucleotides suitable for using the methods of the present invention and encoding arene deoxygenase. The left is identified by Gen Bank and encodes the complete or partial protein component of arendoxygenase. Suitable loci include, for example: [PSETODCIC] toluene-1,2-dioxygenase; [AF 006691], [PJU53507], [PSECUMA], [REU24277] Isopropylbenzene-2,3- [E04215], [PSEBDO] deoxygenase; Benzene-1,2-dioxygenase; [AEBPHA1F], [CTU47637], [D78322], [D88020], [D88021], [PSEBPHA], [PSEBPHABC], [PSEBPHABCC], [PSU95054], [RERBPHAl], [RGBPHA], [RSU27591] Biphenyl- 2,3-dioxygenase; [PSU15298] chlorobenzene deoxygenase; [AB004059], [AF01047l],. [AF036940], [AF053735], [AF053736], pAF079317], AF004283], [AF004284], [PSENAPDOXA], [PSENAPDOXB], [PSENDOABC], [PSEORFl], [PSU49496] Naphthalene-1,2-dioxygenase; [AF009224], [PSEBEDC 12A] benzoate-1,2-dioxygenase; [PWWXYL] toluene deoxygenase; [ASCBAABC], [U18133] 3-chlorobenzoate-3,4-dioxygenase; [PCCBDABC] 2-clobenzoate. 1,2-dioxygenase; [BSU62430] 2,4-dinitrotoluene deoxygenase; [PSU49504] 2-nitrotoluene deoxygenase; [PPU24215] p-cumate. 2,3-dioxygenase; [PSEPHT] phthalate-4,5-dioxygenase; [AB008831], [ACCANI], [D85415] aniline l, 2-dioxygenase; [D90884] Phenylpropionic acid 2,3-dioxygenase; [PPPOBAB] phenoxybenzoate deoxygenase; [AF060489], [AB001723], and [D89064] carbenzol deoxygenase.
[94] Also useful are organisms in which the genome contains genes encoding other deoxygenases, including: tetralin-5,6-dioxygenase, Sikkema et al., Appl. Eviron. Microbio 1.59: 567-573, (1993); p-coumate-2,3-idoxygenase DeFrank et al., J. Bacteriol. 129: 1356-1364 (1977); Fluorenone 1,1a-dioxygenase, Selifonov et al, Biochem. Biophys. Res. Comm. 193: 67-76 (1993); Dibenzofuran-4,4a deoxygenase, Trenz et al, J Bacteriol. 176: 789-795 (1994); Phthalate-3,4-dioxygenase, Eaton et al., J, Bacteriol. 51: 48-58 (1982); And 2-chlorobenzoate-l, 2-dioxygenase (Selifonov et al, Biochem Biophys. Res. Comm. 213 (3): 759-767 (l995), etc. Using to make the enzyme library of the present invention Suitable these and other deoxygenases are described in US Patent No. 60 / 148,450, "DNA SHUFFLING OF DIOXYGENASE GENES FOR PRODUCTION OF INDUSTRIAL CHEMICALS," filed on August 12, 1999, simultaneously pending.
[95] When hydroxyl groups are introduced into the lead or other organic molecules, it is often desirable to add functional groups to hydroxyl (eg glycosylation, acylation, etc.), as described below. Accordingly, the present invention also provides a method of continuously contacting a library of organic molecular derivatives obtained by contacting an organic molecule with a first library of recombinant derivatization enzymes. The enzymes in the second library are not necessarily, but often catalyze the addition of chemical moieties to functional groups. Alternatively, the hydroxylated compound can be altered by chemical or other means known to those skilled in the art.
[96] b. Halogenase
[97] Halogenases constitute another example of a group of derivatizing enzymes that can be used to obtain libraries of organic molecular derivatives. Halogenases typically halogenate aromatic rings to which some of the naturally occurring or non-naturally occurring product complexes can operate and other organic molecules of interest, for example, as lead materials. Examples of suitable halogenases include: halogenase PrnA, PrnB, PrnC (U74493; P.fluorescens), putative halogenase, PltM, PltD, PltA (AF081920; P.fluorescens), putative oxygenase Agent / halogenase (Y16952; Amycolatopsis orientalis). Although these specific enzymes have up to about 35% amino acid sequence identity, polynucleotides encoding the enzyme are useful as probes to obtain more closely related halogenases that can be used for DAN shuffling.
[98] c. Other substitutions
[99] Similarly, sulfur-containing groups can be introduced into the organic compound. Thiols, for example, can usually be introduced to produce thiolate anions with strong affinity for heavy metals. Heavy metals are often found at enzyme active sites. Derivatizing enzymes usable in these embodiments include, for example, the group of aryl sulfotransferases. These groups of enzymes can be used to transfer sulfo groups to the aromatic portion of organic molecules. The aryl sulfotransferase family includes a number of members with very high amino acid identity (> 80%), which can be easily shuffled with creating a library of recombinant derivatization enzymes. Examples of suitable sulfotransferase genes that can be used for recombination include, for example, arylamine sulfotransferase (U33886, Homo sapiens) phenol sulfotransferase (D85541; Macaca fascicularis), phenol sulfotransferase (D29807; Canis familiaris), phenol Sulfotransferase (U34753; Bos Taurus) and minoxidil sporttransferase (L19998; Rattus norvegicus).
[100] In further embodiments, one or more basic groups are substituted for functional groups already present. Most common basic groups used in medical chemistry are amines, amidines, guanidines, and almost all nitrogen-containing heterocycles. The introduction of these groups into molecules which already have biological activity has a solubilizing effect which is almost the same as the introduction of acid action. Amines and basic heterocycles are widely present in substantially successful drugs. For example, amines can be easily introduced by using acyltransferases or esterases using bifunctional compounds including amines.
[101] 2. Addition to functional groups of chemical moieties
[102] Additional embodiments of the present invention provide recombinant derivatization enzymes and libraries thereof that can catalyze the reaction of adding one or more chemical moieties onto functional groups present on organic molecules of interest, such as precursors. In these embodiments, the recombinant derivatization enzymes of the invention are those capable of attaching one group to a portion of the drug that acts centrally at a position that does not impair the drug's function. Such attachment may enhance the solubility of some of the drugs, for example as prodrugs.
[103] These attachments may be reversible or irreversible. Reversible attachment includes, for example, attachment of esters, peptides and glucosides. Irreversible attachment includes, for example, attachment through O- and N-alkylation. The production of CC bonds can be carried out by graft side chains (eg dimethylaminoethyl or morpholinoethyl chains) or acidic side chains (eg carboxylic, sulfonic, -OSO ₃ H, -PO ₃ H ₂ , -OPO ₃ H ₂ ) or neutral groups (eg glyceryl). Larger solubilizers can be added using the enzymes and methods of the present invention. Examples thereof include -O-CH ₂ -CH ₂ -COOH, -NH ₂ -CH ₂ -CH ₂ -CH _2- , -C = NO-CH ₂ -CO ₂ H, O-morpholinoethyl- and- O-CO-CH ₂ -CH ₂ -CO ₂ H.
[104] For example, non-ionic side chains, including hydroxylate and polyoxymethylene side chains or various glucosides, may be attached to enhance solubility. These side chain groups are not only sustained release but also include polyethylene glycol derivatives used to increase solubility.
[105] Examples of derivatizing enzymes useful for adding chemical moieties to pre-existing functional groups on lead or other organic molecules include glycosyltransferase, acyltransferase, amidase, N-methyltransferase, phosphotransferase, aryl sulfo Transferase and the like.
[106] a. Acyl transferase
[107] Acylation is a form of modified chemistry that can theoretically provide considerable diversity in derivatization of organic molecules. However, conventional chemical reactions of acylation are usually nonselective and require multiple protection and deprotection steps. Enzymatic acylation with acyltransferases, such as lipases and proteases, in organic solvents can provide certain advantages such as substrate selectivity, stereoselectivity and regioselectivity. However, it is not easy to obtain from a group of naturally occurring acyltransferases having the various substrate specificity, stereospecificity or positional specificity required for a particular organic molecule. Accordingly, the present invention provides a library comprising a plurality of recombinant acyltransferases that can be used to synthesize acylated derivatives of lead and other organic molecules.
[108] Accordingly, the present invention provides a library of recombinant polynucleotides encoding lipase and protease enzymes and acyltransferases. These methods include generating a library of recombinant polynucleotides that are used as substrate polynucleotides encoding enzymes capable of carrying out an acylation reaction. Such enzymes include, for example, lipases and proteases. The reverse reaction in organic solvents of lipases and proteases can transfer various acyl groups onto the hydroxyl position of the complex natural product. These enzymes usually include a wide range of substrate specificities but have low activity.
[109] Lipase groups can be readily identified from, for example, publicly available databases. One example of a group of lipases suitable for shuffling (at least 50% amino acid identity) includes: Y00557, Vibrio chlerae; D50587, Pseudomonas sp KFCC10818 (AAD22078), Pseudomonas aeruginose (BAA23128), P.aeruginosa (D50587); Acinetovacter calcoacetius (AF047691); And P. wisconsinensis (U88907 and 2072017), Pseudomonas sp (P26877), Bacillus subsilis (M74101); Bacillus pumilus (A34992); Galatomyces geotrichium (A02813); Candida rugosa (WO 99/14338); And Acinetobacter calcoaceticus (S61927).
[110] Numerous genes encoding acyltransferases using various carboxylic acid derivatives of coenzyme A as substrates are known and enzymes catalyzing these reactions are widely occurring in eukaryotes and prokaryotes as unnaturally occurring compounds. Examples of nucleic acids suitable for use as substrates include, for example: galactosid 6-O acetyl transferase (EC2.3.1.18); lacA of E. coli (B0342 (lacA) or other organisms (GENBANK loci MG396; D02_orfl52 (lacA); MJl064 (1acA), MJ1678, MTHl067); serine O-acetyltransferase (EC 2.3.1.30, (GENBANK locus B3607) cysE), HI0606 (cysE), HP1210 (cysE), SLR1348 (cysE)); derived from alcohol O-acetyltransferase (EC 2.3.1.8zt) such as Saccharomyces cerevisiae (1oci YGR177C, YOR377W); Arylamine N-acetyltransferase (EC2.3.1.II8, representative GENBANK loci include Q00267, D90786, Z92774, I.78931, AF030398, AF008204, AF042740); camitin O-acetyltransferase (EC 2.3.1.7), such as Mammalian or yeast origin (GENBANK loci YAR035 (YATl), and YN18054.01 (CAT2)); choline O-acetyltransferase (EC 2.3.1.6), eg, mammalian origin, and acetyl CoA: deacetylvindoline 4 -O-acetyltransferase (EC 2.3.1.107) (St-Pierre et al. (1998) Plant J. 14: 703-713).
[111] Suitable acyl donors for the improved enzymes of the present invention include compounds that may serve as donors for particular enzymes, for example. Representative acyl donor substrates include benzyl and fatty acids as well as vinylesters, trifluoroethylesters and other aliphatic esters. Mozhaev et al. (1998) Tetrahedron 54: 3791-3982, specifically p3976. Reference.
[112] In a preferred aspect of the invention, the acyl transferase genes that are shuffled are those that provide for the delivery of acetyl groups and encode enzymes that use the endogenous pool of acyl-CoA compounds in the cells of the host microbial strain. The endogenous pool of acyl-CoA compounds can be enhanced by introducing acyl-CoA ligase (optionally improved by DAN shuffling) into a host microbial strain carrying out an acylation reaction. This strain is then fed to exogenous acetate or other carboxylic acid in the medium and then attached to CoA by acylase. Suitable acylase and optimization methods are described in "DNA SHUFFLING OF MONOOXYGENASE GENES FOR PRODUCTION OF INDUSTRIAL CHEMICALS," filed on August 12, 1999 and simultaneously pending US application 09 / 373,928.
[113] Compounds of interest which are derivatized by acylation are, for example, naturally occurring products and include non-naturally occurring compounds as well as polyketides, flavonoids, peptide antibiotics and the like. Such compounds have been found to be used, for example, as antibiotics, chemotherapeutic agents and the like. Typically, the substrate molecule has one or more hydroxyl residues where acylation occurs. Regioselectivity is particularly important for molecules that have multiple functional groups where acylation can occur. The method of the present invention provides a means to obtain functional groups or enzymes to acylate groups of interest, but excludes other groups that are otherwise susceptible to acylation.
[114] Acylation of certain molecules can alleviate undesirable properties. Anticancer agents, including those that act by disrupting microtubule dynamics, belong to compounds that are useful for developing derivatives of medicines in which the methods of the present invention have improved properties. These compounds can be mentioned, for example, colchicine, colchemid, grapephyloxotoxin, taxol, vinblastine, vincristine and the like. Specific examples of substrates of interest include epothilones, which are potential anticancer drug candidates currently in the research stage. Selective acylation of two optional hydroxyl groups on this compound can increase its water solubility. Derivatives that are specifically acylated at these positions can be obtained using the recombinant acyltransferase library of the present invention. Further examples include rapamycin and FK506. Immunosuppressive activity can be separated from their neuronal regeneration by using the C-28 hydroxyl group of rapamycin or the acylation of C-35 hydroxyl of undehydrogenated FK506 (Gold, BG (1997) Mol. Neurobiol 15: 285-306). It is known that FK506 (FK binding protein), which binds to a part of rapamycin or FKBP, is responsible for neuronal regeneration activity. Acylation may disrupt the binding of FKBP-rapamycin (or FK506) to effector protein (calcineurin). Thus, the acylation of the hydroxyl groups described above will destroy calcineurin bonds. Because there are several hydroxyl groups in both molecules, regioselectivity will play an important role in these alterations.
[115] Library screening of recombinant polynucleotides encoding lipase, protease, or other acylation enzymes (obtained by the DNA shuffling or other method described above) may be purified or partially purified by one or more of the following screening methods in an organic solvent system. Easily done in vitro using purified enzymes or bacterial or yeast filtrates. For example, by finding the physical difference between the derivative and the substrate resulting from the enzyme-catalyzed reaction, increased formation of small molecules and acylated derivatives of natural products can be observed. These methods include HPLC, mass-spectrometry, ultraviolet / visible and infrared spectroscopy, NMR and the like.
[116] Another currently preferred method uses labeled acyl-donor precursors (eg, labeled carboxylic acids or derivatives thereof) administered to cells expressing gene libraries encoding shuffled lipases, proteases or other acyltransferases. . The amount of label in the reaction product is measured. For hydrophobic reaction products, solid phase extraction of these compounds can be used by extracting the derivatives with a suitable organic solvent or by adding a sufficient amount of hydrophobic porous resin beads (eg, XAD1180, XAD-2, -4, -8). have. In the case of radiolabels, scintillation of the dye may be present in the organic solvent added to the sample and chemically incorporated into the bead polymer. The latter constitutes a modified scintillation proximity assay.
[117] Methods of discovering the regioselectivity of acylation reactions include, for example, HPLC, and HTP modalities, flow through NMR spectroscopy. NMR spectroscopy is used to determine the relative amounts of different regioisomeric acylation derivatives of natural products or small molecules, which are then obtained by the action of enzymes on isotopically labeled ( ¹³ C and / or ² H) labeled substrates. It is preferable. Another modified NMR technique involves the use of isotopically labeled precursors of acyl donor intermediates.
[118] b. Glycosyltransferase
[119] Another example of derivatization enzymes of interest for generating combinatorial libraries of organic molecular derivatives is glycosyltransferases. Glycosylation increases biocompatibility, decreases toxicity and increases the water solubility of organic molecules, including lead compounds. Since glycosylation is difficult to perform chemically, new sugar-containing antibiotics such as new glycopeptides and glycosylated macrolide antibiotics Is difficult to manufacture.
[120] However, the use of glycosyltransferases allows for the glycosylation of organic receptor compounds comprising one or more hydroxyl groups. Thus, if the glycosylation ability provided by the recombinant enzyme library of the present invention varies widely, many variants of organic molecules can be obtained. With the technology provided herein, new enzymes are provided that can catalyze a variety of glycosylation not previously used. For example, recombinant derivatization enzymes in the libraries of the present invention may exhibit altered specificity for both receptors (eg, natural complexes and synthetic organic molecules) and donors (eg, different sugars). Increased ability to synthesize aminodeoxy sugars can be obtained, for example, by bioconversion. With the recombinant derivatization enzymes of the present invention, new substrates can be accessed, new enzyme activity is created and improved; Difficult chemical processes can be replaced by biocatalysts and their scale can be extended.
[121] Glycosyltransferases can be evolved to produce recombinant glycosyltransferases that, for example, exhibit optimal performance in terms of diversity of various reaction parameters using the diversity production methods described herein (eg, shuffling). Conventional reaction parameters include, but are not limited to, the specificity of the reaction, the confusion of the enzyme, and the stereochemistry. For example, enzymes selectively evolve to convert various nucleotide diphosphate (NDP) sugars and NDP-sugar homologues, convert sugars to different receptor molecules, attach sugars at different positions compared to naturally occurring enzymes, and Ambiguity to the position at the receptor containing the site of catalyzes multistage glycosylation.
[122] In another embodiment, the enzyme is evolved to produce a recombinant derivatization enzyme, optionally using alternating sugars of synthetic form. For example, activated sugars (activated sugars such as desoxy and sulfated sugars, unnatural sugars such as nitrosylated, sulfonated, phosphonated sugars and didecoxy sugars), polyalcohols (eg inositol, inositol) Phosphates, and inositol phosphonates), structures and compounds such as other sugars and alternating nucleotides.
[123] Recombinant glycosyltransferases are optionally used to deliver sugars to alternating sugar receptors, which include but are not limited to polyketides, non-ribosome peptides, complex molecules derived from organic synthesis, and libraries of chemical compounds It doesn't work. Other sugar receptors of interest in the present invention are aglycosyl vancomycin hydrochloride (peptide antibiotics), somatostatin (growth hormones), insulin and glucagon related inhibitors, cholic acid (surfactant steroids), nogalamycin (anti-tumor antibiotics), L- Thyroxine (thyroid hormone), cyringalazine, aclarubicin (anti-tumor antibiotic and commercially available RNA synthesis inhibitor), ritodrine hydrochloride (adenergy antagonist and soft muscle relaxant), rifamycin (antibiotic) and Listoma Lysine sulfate (antibiotic), but is not limited to this. Each of these compounds has three-dimensional similarity with vancomycin aclicon as defined by the molecular dynamics contact area with the Available Chemical Database available through Chemweb (http://www.chemweb.com/database). . These compounds and their point of attachment to sugars are shown in Figures 1-10. Other natural products of interest for glycosylation include, for example, lovastatin, aglycosyl erythromycin, echinocandine, taxol, and cephalexin.
[124] Any molecule comprising at least one hydroxyl group is glycosylated with a selectively evolved glycosyltransferase. Pharmacologically interesting compounds are preferred. Sugar receptors with one or more hydroxyl groups are optionally glycosylated at only one position. Thus, different isomers can be prepared by glycosylation at one or another position. Alternatively, where NDP sugars are limited, for example, compounds having at least one hydroxyl group are optionally glycosylated to different degrees at different positions. In another embodiment, providing repetitive glycosylation, the compound can be multidimensionally processed in combination with NDP-sugars and glycosyltransferases.
[125] In some embodiments, the glycosyltransferase is selected from transferring hexose residues from UDP-hexose derivatives. Preferred hexoses include, for example, D-glocos, D-galactose and D-N-acetylglucosamine. Sugars of interest attached using evolved glycosyltransferases include, but are not limited to: UDP-N-acetylgalactosamine, UDP-N-acetylglucosamine, UDP-galactose, UDP-galactu Lonic Acid, UDP-Gluronic Acid, UDP-Mannose, UDP-Xylose, UDP-Glucose, TDP-Glucose, CDP-Glucose, ADP-Glucose, ADP-Ribose, ADP-Mannose, GDP-Fucose, GDP-Glucose and GDP Mannos, all of which are sold by Sigma (St. Louis, MO). 2-deoxy-D-xyllo-hexose, 2-deoxy-D-arabino-hexose, L-fucose, L-rhamnose, D-mycinose, L-balarose, D-fu Kos, D-Quinobose, D-Rhamnose, D-Canalos, D-Olios, D-Digitose, D-Boybinose, L-Oleandros, Calcos, D-Amisettos, L-Lodi Deoxy sugars such as north, ascarylose, avecus, paratose, tibelose, collitos and the like. These sugars and others are described in Annu. Rev. Microbiol. 48,223-256 (1994).
[126] Provided are methods for obtaining recombinant polynucleotides encoding glycosyltransferase enzymes that enhance certain properties that increase the utility of enzymes in the synthesis of glycosylated organic compounds. In presently preferred embodiments, polynucleotides encoding the improved glycosyltransferase enzyme are introduced into the microorganisms added to the biocatalyst reaction mixture. In some embodiments, the glycosyltransferase is expressed by a microbial species other than the microbial species from which the glycosyltransferase gene was obtained.
[127] In presently preferred embodiments, the glycosyltransferases used in the present invention can be optimized by recombining and subsequently selecting nucleic acids encoding enzymes to identify those recombinant polynucleotides encoding enzymes with enhanced properties of interest. have. For example, enzymes that glycosylate various organic compounds to naturally occurring glycosyltransferases and enzymes using a variety of sugars and sugar homologues that are not commonly used by naturally occurring glycosyltransferases and naturally occurring glycosyltransferases that are unable to attach sugar molecules. Those recombinant polynucleotides encoding enzymes capable of glycosylating a wide range of compounds, such as selectively glycosylating only in one hydroxyl group, or modulating regioselectivity to provide one of two possible isomeric compounds You can choose to.
[128] Libraries of recombinant polynucleotides that are selected and screened for identifying those encoding recombinant glycosyltransferases with enhanced properties can be used, for example, to generate diversity methods (eg, shuffling) based on the various recombinations described herein. It can be prepared by applying to nucleic acids encoding enzymes (these nucleic acids are substrates for use in recombination). Suitable glycosyltransferase gene sources for use as substrates in generating libraries of recombinant polynucleotides are gtf from A. orientalis, which encodes, for example, glycosyltransferases that catalyze the conversion of glucose to aglycosyl vancomycin. Include such as genes. Enzymes that catalyze these reactions are widespread in prokaryotes and eukaryotes.
[129] One or more glycosyltransferases are selected from the glycosyltransferase superfamily and arranged in similar homologous sequences and shuffled for these homologous sequences. Glycosyl conversion reactions are widespread in nature, and those skilled in the art can isolate the gene from one or more of several known methods using one or more known methods. The following are specific examples of glycosyltransferase encoding nucleic acids that can be used as source nucleic acids for making recombinant libraries for screening to identify improvements in glycosylation of organic compounds such as altered substrate specificity. For example, inositol, inositol 1-alpha-galactosyltransferase, EC 2.4.1.123; Phenol beta glucosyltransferase, EC 2.4.1.35 (NTU32643, NTU32644); Flavone 7-O-beta-glucosyltransferase, EC 2.4.1.81; Flavonol 3-O-glucosyltransferase, EC 2.4.1.91 (AB002818, ZMMCCBZ1, AF000372, AF028237, AF078079, D85186, ZMMC2BZ1, VVUFGT); o-dihydroxycoumarin 7-O-glucosyltransferase, EC 2.4 .1.104; Bitexin beta-glucosyltransferase, EC.2.4.1.105: cortyryl-alcohol glocosyltransferase, EC 2.4.1.111; Monoterphenol beta-glucosyltransferase, EC 2.4.1.127; Arylamine glucosyltransferase, EC.2.4.1.71: sn-glycerol-3-phosphate 1-galaltosyltransferase, EC.2.4.1.96: gluronosyl transferase, EC 2.4.1.17 (RNUDPGTR, AA912188, AA932333) ; Human UGT and isoenzyme (-35 gene), salicylic-alcohol glucosyltransferase, EC 2.4.1.172; 4-hydroxybenzoate 4-O-beta-D-glucosyltransferase, EC 2.4.1.194; Zeatin O-beta-D-glucosyltransferase, EC 2.4.1.203; D-fructose-2-glucosyltransferase, VFAUDPGFTA, and ecdysteroid UDP-glucosyltransferase (egt) MBU41999 can all be used as substrates for the production of recombinant libraries of the present invention.
[130] In addition, suitable glycosyltransferase genes can be found in many microorganisms that one of ordinary skill in the art can separate by enrichment techniques from various soil, sediment, air and aqueous samples. Glycosyltransferases specifically isolated from soil bacteria glycosylate several polyketided aglycones and these glycosylated natural products have a number of different biological activities, such as antibiotics or anticancer agents. Genes encoding these enzymes can be obtained from known databases. For example, glycosyltransferases (S. antibiotics, AJ002638; Sac erythraea, Y14332; S.venezuelae, AF079762; S.peucetius, L47164 and S.fradiae, X81885). These genes share at least 50% amino acid sequence identity, so any two or more are ideal for shuffling together as a group.
[131] By way of example, the glycosyltransferases used for initial shuffling are gtfA, gtfB, gtfC, gtfD and gtfE derived from different Amicollatops orientalis strains. These genes encode glycosyltransferases that convert sugar sites to aglycones of vancomycin and eremomycin but not ribosomal peptide antibiotics. Zmijewski & Briggs FEMS Microbiology Letters 59, 129-134 (1989). Solenberg et al, Chem & Biol. 4, 195-202 (1997). Wageningen et al. Chem & Biol. 5,155-162 (1998). For example, GtfB and gtfE deliver glucose from TDP-glucose or UDP-glocos to vancomycin phase. The glycosyltransferase gene shares similarities between 59% (gtfA-gtfD) and 82% (gtf B-gtfE). The protein sequence shares similarities between 52% (gtfA-gtfD) and 80% (gtf B-gtfE). Five known genes can be amplified from different Ami- coleotsis orientalis ssp olitianis strains (gtfD and gtf E from ATCC 43490 and ATCC 43491 and gtfA, gtfB, gtfC from NNRR 18098). The related glycosyltransferase gene, although not a number of other features, is optionally PCR amplified from other A. orientalis strains. (E.g., ATCC 19795, 21425, 35164, 15165, 15166, 39444, 43333, 53550, and 53630, and appropriate cloning and expression vectors. Additional genes are cloned into the valamycin producer Amicolatopsis mediterranei DSM5908 (Pelzer et al. (1997)). J Biotechno. 57: l15-128), and other Amicolatopsis strains The expression of the GTF-encoded protein in E. coli can be tested by SDS-PAGE and Coomassie stain and / or the detection tag is Western Added by blot A single clone, eg, a single clone of gtfB and gtfE, is tested for their wild-type activity, eg gtfB and gtfE convert glucose from TDP-glucose or UDP-glucose to aglycone of vancomycin Folena-Wassermann et al. J of Antibiotics 39, 1395-1406 (1986) In vitro glucosylation of vancomycin aglycone can be observed by reversed phase HPLC Solenberg et al. 4, 195-202 (1997) Subsequently, functional gtfB and gtfE clones and several other gene clones, such as gtfA, gtfC gtfD, etc., express the polypeptide chain of the required size and use it in connection with the screening vector. PCR products of the gtf genes can be prepared DNAse I fragments of each PCR product are prepared and resynthesized by, for example, various shuffling methods as described above Typically, fragment sizes range from 25 base pairs to 250 base pairs, The size can be easily determined experimentally according to methods known in the art.
[132] c. Methyltransferase
[133] Methyltransferases are another example of derivatizing enzymes of interest that can add chemical moieties to functional groups present on the lead or on other organic molecules. S-adenosylmethionine (SAM) dependent methyltransferases (MT) are, for example, methylesters, methylethers, methylthioethers, methylamine derivatives of methylamines and proteins, nucleic acids, sugar polysaccharides, lipids, lignin and various low molecular weights. It forms a group of enzymes that form compounds (such as macrolides). SAMs carry activated methyl groups that are efficiently delivered to nucleophiles with broad chemical reactivity. Transferring the activated methyl group from SAM to the receptor nucleophile is thermodynamically advantageous, thus nearly completing the methyl transfer reaction.
[134] One group of methyltransferases of interest is N-methyltransferase. As an example, the following N-methyltransferases make a particularly well suited group for shuffling because they have at least 59% amino acid sequence identity: putative TDP-N-dimethyldesosamin-N-methyltransferase (U77459; Saccharomyces) erythraea), methyltransferase (AJ002638; S. antibioticus), N, N-dimethyltransferase (AF079762; S. benezuelae), N-methyltransferase (X81885; S.fradiae). These groups of enzymes generally methylate the amine groups of amino deoxy sugars attached to complex natural products.
[135] Also of interest are O-methyltransferases, some of which are known. For example, the following group of methyltransferases can methylate hydroxyl groups of complex natural products: 31-dimethyl-FK506 methyltransferase (U65940; Streptomyces sp), methyltransferase (X86780; Streptomyces thermotolerans), and O-methyltransferase (M93958; Streptomyces mycarofaciens). Members of these groups are 45% identical at the amino acid level.
[136] d. Amidase
[137] The present invention also provides a recombinant library of amidase. A group of these enzymes can be used to introduce amide groups into organic molecules. The reverse reaction of the amidase reaction converts the carboxylic acid group to carboxylic acid amide. One such group suitable for use in the methods of the invention comprises the following amidase, which is at least 55% identical at the amino acid level: N-acetyl- anhydromuramil-L-alanine amidase (AF082575; Pseudomonas aeruginosa), N-acetyl-anhydromuramil-L-alanine amidase (U40785; Enterobacter cloacae), AmpD protein (X15237; E. coli) and AmpD protein (U32716; Haemophilus influenzae Rd).
[138] e. Phosphotransferase
[139] It is also of interest to add phospho groups as functional groups present in the lead or other organic molecules. The present invention therefore provides a library of recombinant phosphotransferases useful for obtaining phosphorylated organic molecular derivatives. By way of example, macrolides and peptide phosphotransferase groups (having at least 36% amino acid sequence identity) can be recombined (eg, macrolide 2'-phosphotransferase I (D16251; E. coli), macrolides). 2'-phosphotransferase II (D-85892; E coli), biomycin phosphotransferase (X02393; S-vinaceus) These groups of enzymes inactivate phospho groups on macrolides or peptide antibiotics. Delivery by method By using a library of recombinant phosphotransferases, phosphorylation can be obtained at different positions of macrolides or peptide antibiotics.
[140] f. Other Enzyme Classes
[141] Other classes of enzymes other than the above are also very important in terms of altering or introducing functional groups of the lead material and / or in terms of optimization. For example, it is very important that enzymes capable of catalyzing oxidation-reduction reactions oxidize functional alcohols to aldehydes / ketones or reduce aldehyde / ketone groups to alcohols in organic compounds. Thus these newly created groups can be further modified by other classes of enzymes as described above. Suitable groups for shuffling include lactate dehydrogenase (converting ketones to alcohols having at least 80% amino acid sequence identity) (Y00711, Homo sapiens; U07181, Rattus norvegicus; 77022A, Sus scrofa) domestica; L79954, Trachemys script, etc.). Alcohol dehydrogenases are another group of enzymes that oxidize alcohol groups to aldehydes. Genes suitable for this group of enzymes are readily available for shuffling (M84409, Homo sapiens; L15704, Peromyscus maniculatus; 156882, Struthio camelus; P80222, Alligator mississippiensis, etc.). Shuffling of these two groups of enzymes can alter substrate specificity for more complex organic compounds.
[142] Other groups of enzymes, such as sulfides as sulfoxides, enzymes capable of oxidizing thiols to thiolaldehyde, and enzymes capable of catalyzing cyanohydrin formation and epoxidation are also targets for DNA shuffling and therefore used in combinatorial biosynthesis. Is an important catalyst for.
[143] C. Use of Recombinant Derivatization Enzyme Libraries to Obtain Combination Libraries of Organic Molecular Derivatives
[144] The present invention further provides a method of obtaining a library of organic molecular derivatives. These methods include contacting organic molecules (substrates) with recombinant derivatization enzymes and other necessary reactants to form organic molecular derivatives. These derivatization enzymes can, as described above, a) modify one or more functional groups present on an organic molecule, b) add a chemical moiety to one or more functional groups present on an organic molecule, or c) introduce a new functional group onto an organic molecule. Catalyzes a reaction such as
[145] 1. Organic molecules of interest for derivatization
[146] Organic molecules of interest include, for example, those having pharmacological activity, herbicide or insecticide activity, and the like. Natural products such as antibiotics (including, for example, polyketides, steroids, non-ribosomal peptide antibiotics, etc.) belong to the organic molecules of interest. For example, steroids are a basic structure that is very widely used in medicine, so ring substituents target the medicine against many different therapeutic targets. Most of these are derived from natural sources and screened for efficiency. Substituents observed on steroid medicaments include hydroxyl, methoxy, alkoxy, glycosylation, sulfates, halogenation, double and triple bonds, carbonyls and the like. Chemical derivatization of the steroid ring structure is readily accomplished at a few well described positions or by modifications of naturally occurring structures or non-naturally occurring variants.
[147] Macrolides and cyclic glycopeptides such as vancomycin and erythromycin are also chemically difficult structures that can be modified by the application of shuffled enzyme libraries. There are a number of such structures that are isolated from natural products and they are described in the literature, are in company warehouses and have interesting bioactivity but are not good for anything else. Toxicity, biocompatibility, solubility, drug bioreactivity, and lack of selectivity are some of the reasons why candidate drugs cannot be drugs. Shuffled libraries can be applied and used to improve these and other properties.
[148] Prostaglandins, alkaloids, and anthraquinones are another group of molecules with many biologically active members. These are good candidates for improvement with shuffled enzyme libraries.
[149] Specific examples of pharmaceutical compounds that can be derivatized using recombinant derivatization enzymes include, for example, tubocurin chlorine, alkyronium chlorine, pancuronium bromine, becuronium bromine, atraccurium besylate, 776C85, 7CIMe-MDO-CPT, 9-aminocampotesin, A-007, A-108835, A-121798, furfura glycosides A and B, lanatosides A, B and C, α-acetyldigoxin, β-acetyl Digoxin, digoxin, beta -methyldigoxin, k-stropantoside, k-stropantin beta, convaloside, convalatoxin, glucosilaren A, silaren A, prossililadine, silalenin. Also of interest are cholesteric and cholekinetic medicines such as hymecromon, pebupol, kenodeoxycholic acid and ursodeoxycholic acid, fluorocortolone, paramethasone, dexamethasone, betamethasone, cortisone, hydrocortisone, prednisone, prednisolone , Triamcinolone acetonide, triamcinolone, methylprednisolone and prednillyne are among the suitable glucocorticoids for derivatization. Corticosteroids of interest include, for example, prednicabate, hydrocortisone acenate, fluorocortinbutyl, ioteprenol etabonate, and the like.
[150] 2. Enzymatic Reaction
[151] To obtain a library of organic molecular derivatives, the substrate is contacted with a member of the library of recombinant enzymes. Enzymatic reactions can be performed in a variety of ways, including, for example, the use of whole cell bioconversion, cells with elevated permeability, cell filtrate, and purified proteins.
[152] Bioconversion of whole cells occurs when a substrate (such as an organic molecule) is exposed to a cell comprising a library of recombinant derivatization enzymes. The library can be expressed as a surface protein on a replicable gene package (eg, on a phase or yeast display) or as a secreted protein that interacts with a substrate in solution. The enzyme can be expressed intracellularly, in which case the substrate will diffuse into the cell before the reaction takes place. In this case, the product of the derivatization enzyme activity can be separated from the cells by methods known to those skilled in the art, for example, centrifugation, precipitation, extraction with organic solvents, filtration and the like.
[153] Cells expressing the library can enhance permeability by adding a number of known permeability synergists, such as polymyxin B sulfate. The concentration of permeation synergist can be altered such that the passage of substrate and product freely diffuses into the enzymes in the library and back out of the cell. When the permeation enhancer is at a high concentration, the protein can be released into the solution. The compound of interest will be isolated from the whole cell.
[154] Since the library can be used as a cell filtrate, cells expressing the library are destroyed by adding surfactant PMBS and lysozyme or by adding known lytic conditions, including sonication. Cell fragments can be removed prior to reaction by centrifugation but are not essential. Subsequently, the substrate is added to the filtrate and incubated for a predetermined time at a predetermined temperature. The product is extracted as before and analyzed as described above.
[155] Alternatively, the recombinant derivatization enzyme encoded by the library can be purified by a number of known techniques prior to screening or use to produce derivatives of organic molecules. Such methods include, for example, gel filtration, ion exchange, affinity or hydrophobic chromatography and produce partially or fully purified proteins. Many other purification methods are known to those skilled in the art. The purified protein is then exposed to the substrate under conditions favorable for enzymatic activity.
[156] The reaction conditions used for transformation are optimized for maximum enzymatic metabolism by standard methods, which include the use of optimal salt concentrations, buffers, temperatures and reaction times. Substrates and any other substrates consumed in the enzymatic reaction are preferably used at concentrations that promote high turnover.
[157] Contact with the recombinant derivatization enzymes of organic molecules and other reactants can be done immediately using the entire enzyme library, or contacted with a pool of recombinant enzymes from the library or with a single recombinant enzyme in each reaction. You can. If pools are used, the pools can be divided into small pools for optimization (deconvoluting) to isolate specific clones that exhibit the required activity as long as the active pools are identified using the described methods. For example, colonies expressing each member of the recombinant derivatization enzyme library are placed in microtiter plates or other suitable containers and subjected to high efficiency screening.
[158] In some embodiments, library members of the recombinant enzyme are immobilized on a solid support prior to contact with other reactants. For example, a recombinant polynucleotide encoding an enzyme may be introduced into an expression vector that also includes the coding sequence of the tag to express the recombinant derivatization enzyme as a fusion protein with the tag. Alternatively, the tags can be attached to derivatizing enzymes after their expression. The tag is typically a member of a binding pair in which the corresponding member can be readily obtained and immobilized on a solid support. For example, the recombinant enzyme can be expressed as a fusion with biotin, which can then be immobilized by binding to streptavidin. Other suitable binding pairs include, for example, maltose binding proteins and amylose, histidine tags and immobilized metal ions, glutathione-S-transferase and reduced glutathione, streptavidin binding tags and streptavidin, epitope tags (e.g. For example, E-tag, myc-tag, HAG-tag, His-tag) and corresponding antibodies, chitin binding domains and chitin, S-tag and RNase minus S-peptide variants, cellulose binding proteins and domains and cellulose, thiores Toxin and DsbA and thiol compounds (e.g. Thiobond ^™ ), poly-protic tags (e.g. poly-arginine) and poly-anionic columns, IgG and IgG-derived peptides and proteins A, protein G, etc., calmodulin Binding peptides and calmodulin, histactophylline and immobilized metal chelate chromatography.
[159] The members of the binding pair to which the tag attached to the enzyme binds are preferably attached to the solid support. Solid supports suitable for use are known to those skilled in the art. As used herein, a solid support is a matrix of materials in a nearly fixed arrangement. Exemplary solid supports include glass, plastics, polymers, metals, metalloids, ceramics, organics, and the like. The solid support may be flat or planar or may have an almost different arrangement. For example, the substrate may be present as particles, beads, spirals, precipitates, gels, sheets, tubing, spheres, containers, capillaries, pads, slices, films, plates, diskettes, slides, and the like. Magnetic beads or particles such as magnetic latex beads and iron oxide particles are examples of solid substrates that may be used in the methods of the present invention. Magnetic particles are described, for example, in US Pat. No. 4,672,040 and are commercially available, for example, from PerSeptive Biosystems, Inc (Framingham MA), Ciba Corning (Medfield MA), Bangs Laboratories (Carmel IN) and BioQuest, Inc (Atkinson NH). have. The substrate is chosen to maximize the signal for noise rate primarily to minimize basal binding in terms of ease of cleaning and cost.
[160] Separation of recombinant enzymes from other cellular components or from reactants and the like may, for example, remove beads or diskettes from the reservoir and empty or dilute reservoirs such as microtiter plate wells, and beads (eg beads with iron cores may Can be easily separated and washed), particles, chromatographic columns or filters can be carried out by rinsing with a wash solution or solvent. The separating step sometimes includes additional washing or rinsing or multiple rinsing or washing steps. For example, if the solid substrate is a microtiter plate, the wells are washed several times with washes, which typically can interfere with the continuous screening of organic molecular derivatives such as salts, buffers, surfactants, nonspecific proteins, and the like. Components of the reaction mixture.
[161] The library of recombinant derivatization enzymes provided by the present invention is not only useful for obtaining libraries of organic molecular derivatives. It also provides a source for identifying recombinant enzymes that catalyze a particular reaction of interest. For example, as long as certain organic molecular derivatives are identified as having desirable properties, specific recombinant enzymes can be identified from enzyme libraries that can catalyze the formation of specific derivatives.
[162] 3. Screening of Organic Molecular Derivatives
[163] Libraries of recombinant derivatization enzymes are useful for generating combinatorial libraries of organic molecular derivatives, which can then be screened to identify those exhibiting desirable activity. In these embodiments, the product of screening is often a compound that has not been prepared before. In addition, libraries of recombinant enzymes provide a source from which enzymes can be identified that catalyze certain known modifications of organic molecules. Thus, for example, enzymes can be obtained from the library that allow enzymatic synthesis of known compounds that could be conventionally synthesized by less efficient methods such as chemical synthesis.
[164] Simply synthesizing a library of organic molecular derivatives, the library is usually screened to identify those derivatives of particular interest. In general, bioassays designed to enable the detection and / or quantification of the desired activity can be used to identify derivatives that show improvement in certain biological activities. Desirable biological activity (eg, cytotoxicity, gene toxicity, etc.), desirable biocompatibility (plasma half-life, kidney clearance, etc.), desirable physicochemical properties (water solubility, lipid solubility, solubility in organic solvents (eg n-octane) ), Water solubility, pH stability (eg, low pH environment of the stomach), temperature stability, resistance to intestinal enzymes, resistance to hepatic enzymes, resistance to plasma enzymes, tissue permeability (eg, subcutaneous, mucosa, etc.), Screening for blood brain barrier permeability) and other desirable properties obtainable by derivatization can all be performed randomly, e.g., to identify those having specific structures of interest or to be performed irrespective of the structure of the compound. Can be carried out by analysis of the compound structure in the library. Once a compound with the desired biological activity is identified, structural analysis is performed to identify the structural features imposed by the library of recombinant derivatization enzymes.
[165] In most cases, it was expected that recombinant derivatization enzymes present in the library would chemically modify a given substrate in predictable form. For example, glycosyltransferases can transfer sugar moieties to the amine or hydroxyl phase of the substrate. This will lead to predictable changes in the physical behavior of the molecule and can be used for screening. Chemical transformation catalyzed on any given substrate by a particular library is likely to be the same, eg, glycosyltransferase will place a sugar on the substrate and methyltransferase will add a methyl group and P450 is hydroxyl There is a tendency to add groups. This allows the general screening method to be modified for each library. For example, glycosyltransferases always produce sugar-substrate bonds, so certain chemical tests on the bound sugars will detect product formation. Kinase libraries deliver phosphate groups onto the substrate so certain phosphate tests will detect the presence of the product.
[166] Many analytical screening tools are useful for determining the compound structure of combinatorial libraries. For example, many methods are known for detecting low concentrations of compounds in high efficiency formats, including flow analysis NMR and mass spectrometry. These analytical tools or other tools, including ultraviolet / visible and infrared spectroscopy, fluorescent spectroscopy, luminescence, etc., can be used to detect and quantify new compounds produced in enzymatic reactions.
[167] Since 100% rotation of the substrate into the product is not expected in library screening, it is desirable to set up analytical techniques to detect specific changes produced by enzymatic activity. For example, the presence in a recombinant enzyme library of enzymes having methyltransferase activity on a particular substrate of interest may be detected by observing an increase of 14 amu in the mass spectrum after contact with the enzyme. Thus, alterations in the chemical structure of the substrate caused by the library can often be specifically observed and detected. They can then be correlated with members of a library of recombinant enzymes that catalyze a particular reaction.
[168] Another attempt to detect the presence in the enzyme library of recombinant enzymes that catalyze specific reactions to new substrates is to introduce molecular markers, for example, during the course of the reaction. Suitable labels include radiolabels such as, for example, ³ H, ¹⁴ C, ³² P, and the like. This can be achieved by labeling only the methylated product of the reaction by using a radioactive common substrate such as ³ H ₃ methyl S-adenosyl methionine. Other labels can also be used and are well known in the art. For example, glycosylation can be detected by the use of a sugar molecule comprising a label.
[169] In certain instances, the product of the action of the shuffled library on the substrate is expected to increase the solubility of the compound in a particular solvent or to provide a product that is more stable than the substrate against external stresses such as extreme pH. These changes in behavior can be observed by appropriate analytical or bioassay methods.
[170] In some cases, detection of newly formed products may require product form separation of the substrate by standard chromatography methods such as TLC, HPLC, CE or GC. Thereafter, spectroscopy or other methods for observing the formation of new compounds of interest (eg flame ionization, mass spectroscopy) are performed.
[190] The following examples are illustrative only and are not intended to limit the invention.
[191] Example 1
[192] High Efficiency Screening and Preparation of Glycosyltransferase Enzyme Libraries for the Production of Desvancosamine Vancomycin
[193] This example describes a method of preparing a library of recombinant glycosyltransferases and the use of enzymes for the production of desvancosamine vancomycin.
[194] Cloning of gtfA, B, C, D, E Genes from A. Amycolatopsys orientalis ssp orientalis
[195] 1. Preparation of GTF Encoding DNA
[196] Preparation of Genomic DNA
[197] Amycolatopsys orientalis ssp orientalis strains ATCC43490 and NRRL 18098 are obtained from ATCC and NRRL. Initial cultures on agarose petri dishes are prepared according to the supplier's instructions. Cultures are grown in TSB at 25 ° C. to 28 ° C. for 2 to 5 days. Genomic DNA is extracted according to standard methods (Ausubel et al. (1987) Current Protocols in Molecular Biology, 1st Edition, John Wiley & Sons, Inc., NY).
[198] PCR with add-on primers
[199] PCR was performed using genomic DNA, gene specific primer 1 pmol, 200 μmol dNTP, 2 units of Deep Vent Polymerase and 0.2 units of 5'-3 'exogenous nuclease deficient variants according to the enzyme supplier (New England biolabs) instructions. Performed in the presence of 50 μl volume of 1-3.5 mM MgSO ₄ and 1.5 M betaine. In all cases, a high temperature start with wax beads (MβP) is used. On the DNA engine heat cycler, the cycle was set up as follows: 95 ° C. initially for 5 minutes; 5 cycles: 95 ° C. 45 seconds, 76 ° C. 1 minute 20 seconds; 5 cycles: 95 ° C. 45 seconds, 75 ° C. 1 minute 20 seconds; 5 cycles: 95 ° C. 45 seconds, 74 ° C. 1 minute 20 seconds; 10 cycles: 95 ° C. 45 seconds, 73 ° C. 1 minute 20 seconds; 10 cycles: 95 ° C. 45 seconds, 73 ° C. 1 minute 20 seconds. All primers are designed according to the initial sequences U84349 and U84350. For amplification of gtfA, gtfA.For and gtfA.Rev are used. For amplification of gtfB, gtfB.For and gtfB.Rev are used. For amplification of gtfC, gtfC.For and gtfC.Rev are used. For amplification of gtfD, gtfD.For and gtfD.Rev are used. For amplification of gtfE, gtfE.For and gtfE.Rev are used (Table 1).
[200] Primers, oligonucleotides, polynucleotidesprimer SEQ ID NO: order GtfA.ForOneAGGAGATATACATATGCGCGTGTTGATTACGGGGTGTGGATCGCGC GtfB.For2AGGAGATATACATATGCGTGTGCTGTTGGCGACGTGTGGATCGCGC GtfC.For3AGGAGATATACATATGCGTGTGTTGTTGTCGACGGCTGGCAGCCGC GtfD.For4AGGAGATATACATATGCGTGTGTTGTTGTCGGTGTGCGGAACCCGC GtfE.For5AGGAGATATACATATGCGTGTGTTGTTGTCGACCTGTGGGAGCCG GtfA.Rev6ACCACCACCTTCGATATCGGAACCGGCGGGAACAGTCGGCTTTTC GtfB.Rev7ACCACCACCTTCGATATCGGAACCCGCGGAAACAGTCGGCTTTTC GtfC.Rev8ACCACCACCTTCGATATCGGAACCCGCGAGAACAGCCGACTTTTC GtfD.Rev9ACCACCACCTTCGATATCGGAACCCGCGGGAACGGCGGGCTCGTT GtfE.Rev10ACCACCACCTTCGATATCGGAACCGGCGGGAACGGCGGGCTGGTT Bio-Seq11CCTCTCCTTTGCTAGCCATCAGATTTCCCCTCGTGCTTTC CKFor112CGAATTTCTAGAGAAGGAGATATACATATG CKFor213CCCCAGGCTTTACACTTTATGCTTCCGGCT CKFor314GGTACCCGATAAAAGCGGCTTCCTGACAGG Birfor15TGGCATGGATGAGCTCTACAAATAAGGAGACAATTTCATGAAGGAT Birrev16GGGCTTATTTTTCTGCACTACGCA H3Rev17AATTTAAGGGTAAGTTTTCCGTATGTAG NIRev18CATGCCGTTTCATCTGATCCGGATAAC
[201] The resulting PCR product is digested with NdeI and EcoRV. Digested PCR products corresponding to the gtf gene are purified by agarose gel electrophoresis and QIAEXII (Qiagen).
[202] 2. Properties and structure of vector pCKZEBB
[203] The vector pCKZEBB is derived from pAK400 (Kreber et al. (1997) J. Immunol. Meth. 201: 35-55). The following features of pKA400 are retained. The lac ^q gene maintains the inhibition of lac operon. The transcription terminator (hp ^t ) between the lac ^q gene and the lac promoter (lac ^{p / o} ) terminates translation through transcription from the lacI promoter to the lac promoter regulated operon, which reduces the bottom non-induced expression. It is exhausted. The lac promoter effector is maintained for transcription initiation and transcriptional regulation, while the 10 T7g10 leader derived from the T7 phase gene in front of the target gene initiation codon is maintained to allow strong translation initiation from the ATG initiation codon at the NdeI restriction site. Following the regulated expression cassette, the NdeI-HindIII lac promoter effector, followed by the encoded lpp transcription terminator (lppt), followed by the f1 source of replication, enables single helix DNA generation, followed by the chloramphenicol resistance gene (cam ^R ), and the Co1E1 source of double helix DNA replication.
[204] In pCKZEBB, the lac promoter effector regulated polycistronic message replaces the lac promoter effector regulated monocitron message in pAK400. The lac promoter-transcribed operon is located between the unique NdeI and HindIII of the pAK400 vector. In pCKZEBB, variants of the lacZ gene (initiation codon ATG inserted into the NdeI site, internal NdeI removed, EcoRV site added to the gene terminus before the stop codon, and resulting EcoRV lacZ fragment inverted in the vector) were generated at the NdeI EcorV target gene cloning site. It is inserted as a stuffer fragment. This lacZ fragment is replaced by the target glycosyltransferase gene. After lacZ, there is an encoded biotinylated tag (aa sequence) followed by a translational coupling tag derived from the end of the trpB gene. Both tags are fused in frame to replace the lacZ stuffer fragment to become the target glycosyltransferase. The A nucleotide of the stop codon of the translational coupling tag (TGA) forms part of the translation initiation codon of the green fluorescent protein-coding gene (GFP; Crameri et al, (1996) Nature Biotechnol. 14: 315-319). Behind the GFP gene is a cloned birA gene PCR comprising a ribosomal binding site from BL21 (DE3). Since the NcoI restriction site is present, sequence ambiguity appears to be present in the birA gene. A map of pCKZEBB is shown in Figure 19 and the nucleotide sequence of the vector is shown in SEQ ID NO: 19. E. Coli transformed with pCKZEBB changed green fluorescence when grown on 30 μg / ml chloramphenicol and 1 mM IPTG. Don't let that happen. If the sputter lacZ fragment is replaced by a full-length target gene in a frame with a biotinylation-translational coupling tag, A) IPTG induced expression of the target gene results in the GFP gene plasmid immobilized bacterial green fluorescence by translational coupling. (Oppenheim & Yanofsky (1980) Genetics 95,785-795), and B) the target gene via birA derived biotin holozyme ligase (Smith et al (1998) Nucl. Acids Res. 26: 1414-1420). Biotinylation in vivo by biotinylation tag (Schaltz (1993) Bio / Technology 11: 1138-1143).
[205] 3. Cloning of gtf PCR into pCKZEBB
[206] The vector pCKZEBB was cut in two parts with NdeI and EcoRV removing the lacZ gene stuffer. The resulting vector is dephosphorylated using calf intestinal phosphatase. DNA fragments corresponding to the vector are separated from agarose gels by QIAEXII (Qiagen). The EcoRV and NdeI digested PCR products described above were ligated into vector fragments following standard procedures. After ligation, E.Coli TG1 electron-compatible cells (Stratagene) are electroplated by ligation reactions, plated on LB-Agar plates containing 1 mM IPTG and 30 μg / ml chloramphenicol and grown overnight at 37 ° C. Plasmid DNA is prepared by picking up green fluorescent colonies showing different degrees of fluorescence.
[207] 4. Restriction Analysis and Sequencing
[208] The resulting vector is analyzed by restriction enzymes and the clones containing the inserts are sequenced. A plasmid expressing one of the glycosyltransferases is identified as a biotinylation-translation coupling tag fusion protein. Gene-immobilized clones corresponding to known sequences are used as templates for shuffling.
[209] B. Recombination and Variation of Single, Double, Triple, Quad and All 5 Gene Combinations by Group Shuffling
[210] 1. Amplification of wt Gene in pCK Vector
[211] The glycosyltransferase gene is amplified from the resulting plasmid comprising some vector derived side regions by primers CK.For3 and H3.Rev using polymerase according to the manufacturer's instructions. PCR is purified by Qiaquick column (Qiagen).
[212] 2. Preparation of Random DNA Fragments
[213] PCR products derived from plasmids are digested with DNAseI (Boehringer). The reaction was stopped on dry ice and fragments of the required size range were removed from glass filter discs (Whatman) and Dialysis membranes (Stemmer (1994) Proc. Nat'l. Acad. Sci. USA 91: 10747-10751 and Stemmer (1994). Nature 370: 389-391) and separated from 2% agarose gel.
[214] 3. Combination of Glycosyltransferase Genes
[215] In each group's combined reaction, several concentrations and ratios of DNAsed DNA fragments and PCR cycling parameters were adjusted to obtain the maximum amount of shuffled gene in four steps (Crameri et al (1998) Nature 391: 288-291). Christians et al. (1999) Nature Biotechnol. 17: 259-264).
[216] 4. Rescue of glycosyltransferase gene by PCR
[217] 2 μl of the final combination reaction is used as template. In the final PCR reaction, 1 μM primers CK.For2 and N3.Rev, 0.2 mM of each nucleotide of tag polymerase 1 unit are added. PCR parameters were set as follows: 1 cycle, 96 ° C. 3 minutes; 30 cycles, 96 ° C. 0.5 minutes, 60 ° C. 0.5 minutes, 72 ° C. 0.5 m; 1 cycle, 72 ° C., 5 minutes.
[218] C. Cloning the gtf PCR Product into pCKZEBB
[219] Expression vectors pCKZEBB and PCR rescued shuffled glycosyltransferase genes are digested with XbaI and EcoRV. The vector pCKZEBB is further dephosphorylated. Vector fragments and glycosyltransferase encoding PCR fragments are isolated from agarose gels and ligated with each other.
[220] The electroreactive E.Coli TG1 is transformed with the ligation mixture and stirred for 1 hour at 37 ° C., then plated on LB-agar containing 30 μg / μl chloramphenicol, 1% glucose and grown at 37 ° C. overnight.
[221] D. Prescreening, Preparation of Master Plates and Expression of Glycosyltransferase Libraries
[222] Colonies are placed into LB-Cam-Glucose and continued to grow at 37 ° C. to prepare master plates. From the master plate, colonies are arranged on LB-cam-IPTG-Agar and plates are incubated overnight at 37 ° C. Green fluorescent colonies are identified by exposing the plates to 365 nm ultraviolet light. Each green fluorescent colony from the master plate is rearranged into a 96 well plate filled with 100 μl 2 YT-Cam 30-1% glucose and grown overnight at 37 ° C. 50 μl culture is delivered with 1 ml of 2 YTCam 30-1 mg / ml biotin and grown at 16 ° C. for 7 hours. 50 μl of 100 μM IPTG is then added and the culture grown at 16 ° C. overnight.
[223] E. Lysis of Cells by Combination of Lysozyme and Polymyxin B Sulfate
[224] The cells are pelleted by centrifugation (4000 rpm for 15 minutes). The cell pellet is washed with 500 μl of 50 mM ammonium formate, pH 7.4 and pelleted once more. Cells were prepared in 300 μl lysis buffer (10 μl Ready to Lyse lysozyme (Epicentre), 2 μl RNAse A (Qiagen), 2 μl DNAseI (Boehringer), 2 μl 1M MgSO in 10 ml 1 mg / ml polymyxin B sulfate (Sigma). ₄ , 2 mM DTT in 50 mM ammonium formate pH 7.4) and re-suspend at room temperature for 30 minutes. The filtrate is then clarified by centrifugation (15 minutes at 4000 rpm).
[225] F. Purification of Proteins from Monoclones by Magnetic Beads
[226] Streptavidin coated with magnetic beads is placed in a 96 well plate. The beads are washed with the magnetic properties of the beads (50 μM ammonium formate pH 7.4, 2 mM DTT) and resuspended in 20 μl buffer per well. The clarified cell filtrate (100 μl) is transferred from the lysis plate to the beads and incubated for 15 minutes at room temperature. The beads are then washed five times with buffer (150 μl) and finally resuspended with 20 μl buffer.
[227] G. Performing in vitro modification of compounds with glycosyltransferases derived from libraries
[228] The reaction mixture (80 μl) is added to the purified protein on the beads and the beads are stirred overnight at room temperature. The reaction mixture contains 150 μM vancomycin aglycone (synthesized as described in J. Chem. Soc. Chem. Commun (1998) 1306-1307), 500 μM UDP glucose, 2 mM DTT in 50 mM ammonium formate pH 7.4. The reaction is inhibited by adding 1 volume of methanol and the mixture is centrifuged (for 5 minutes at 2000 rpm). Supernatant (100 μL) is recovered in a fresh 96 well plate and subjected to mass spectrometry.
[229] H. Determination of Occurrence of Glycosylation
[230] The suppressed reaction mixture (10 μl) is injected into a set of triple quadrupole electrospray mass spectrometers in positive mode. Allow molecular ions to pass through the first quadrupole (1143 amu for vancomycin aglycone, 1305 amu for desvancosamine vancomycin), and impinge within the second quadrupole and then 100 amu at the third quadrupole The peaks of daughter ions are detected. The integration of the peaks obtained in this process is directly proportional to product formation. This determines the relative suitability of library clones in the production of desvancosamine vancomycin.
[231] I. Repeated use of the process
[232] If necessary, these processes can be repeated. For example, using multiple genes encoding variants of specific derivatization enzymes, using a single gene from a library, using a single gene shuffled into a wild-type gene for backcrossing, and with multiple genes B Steps to H can be repeated, each of which encodes an enzyme with a different activity.
[233] The process is altered to replace G-level UDP-glucose with another NDP-sugar. The MS parameters of step H are tailored to detect the predicted molecular ions.
[234] Example 2
[235] Evolution of Erythromycin 6-O-Methyltransferase and Production of Methyltransferase Library for the Production of Clarithromycin
[236] This example describes the use of an enzyme from the library for the preparation of a library of recombinant O-methyltransferase (OMTase) and for the synthesis of derivatives of clarithromycin (6-O-methyl erythromycin).
[237] Groups of erythromycin homologues with 6-methoxy groups have been known to have useful pharmaceutical properties. These compounds are currently prepared by multistep chemical methylation of erythromycin A and its homologues (FIG. 11). Enzymes capable of selectively transferring activated methyl groups to 6-hydroxyl groups of this group of erythromycin homologues in vivo Either one stage of high yield production is possible or as a single biotransformation in vitro. This example illustrates an attempt to obtain the methyltransferase.
[238] Erythromycin 6-OMTase activity was not detected at this time. Therefore, there is a need to prepare a novel specific OMTase. The chance of discovering new activity by sampling the shuffled library 10 ⁴ -10 ⁵ member is greatly increased if library sequence diversity results from naturally occurring sequences rather than from random point point mutations. The library occupies a large portion of the sequence space and is enriched in functional sequences. Thus, DNA shuffling is performed using a homogeneous group of genes that encode an OMTase that specifically methylates a 6-hydroxyl-like substrate of erythromycin. Because it is uncertain which members of this group are more influential in producing 6-OMTase activity, various shuffled libraries are prepared. For example, not only shuffling each of these subfamily alone, but also all of the entire group. This is accomplished using several shuffling formats designed to affect the recombination of genes with both high and low sequence identity.
[239] S-adenosylmethionine (SAM) dependent methyltransferases (MTs) are methylesters, methylethers, methylthioethers, methylamines, and methylamide derivatives of a group of proteins, nucleic acids, sugars, polysaccharides, lipids, lignin, And groups of enzymes that form various low molecular weight compounds (such as macrolides). SAM involves activated methyl groups that are efficiently delivered to nucleophiles with a wide range of chemical reactivity. The transfer of the methyl group activated from SAM to the receptor nucleophile is thermodynamically advantageous, so the methyltransfer reaction is almost complete (FIG. 12). A group of seven genes encoding SAM-dependent OMTases specific for carbomycin, midecamycin, sapramycin, rapamycin, rifamycin and secondary alcohols on FK506 are known (FIG. 13). Comparing these substrate nucleofiles with the 6-hydroxyl of erythromycin A, it can be seen that only minor adaptations of local specificity are required of the parent OMTase to accept erythromycin as the substrate. Another gene of interest is the encoding of ERYG, which synthesizes erythromycin A by O-methylating the micaros site of erythromycin C. EryG shares 54% identity with rapQ and DNA levels, which may provide an additional step in a subgroup of OMTases with tertiary alcohol OMTase activity (FIG. 14).
[240] Shuffled genes are synthesized by PCR from genomic DNA or synthetic oligonucleotides. These genes are then cloned into vectors suitable for expression. The complete sequence of the gene encoding carbomycin-4-OMTase is unknown, but the gene can be cloned or a partial sequence can be shuffled using the entire sequence of another OMTase.
[241] Several libraries of SMA dependent OMTases are prepared. These libraries are screened for erythromycin A and its analogs for 6-OMTase activity. Identified clones are pooled and further evolved to enhance the enzyme to a feasible level of activity.
[242] In general, 10 ⁴ -10 ⁵ clones from group shuffled libraries are screened to identify those with deerythromycin 6-OMTase activity. Cell cultures are grown in the presence of deserythromycin A and the supernatants of these cultures are recovered and analyzed for the presence of 6-O-methyl deserythromycin A oxime. OMTase genes derived from the identified clones are isolated, pooled, shuffled and screened for increased deserythromycin A 6-OMTase activity. Additional cycles of shuffling and screening can continue until the enzyme activity reaches a level suitable for the production of 6-O-methyl deserythromycin.
[243] In order to ensure useful activity homology, shuffled libraries are screened for 6-OMTase for erythromycin B, deserythromycin A, erythromycin A and their oxime derivatives. Although there is a possibility that deerythromycin A oxime 6-OMTase activity is not observed in the initial library, clones with other 6-OMTase activity may exist. These clones can then be used for an additional number of shuffling to further adapt 6-OMTase specificity. For example, if activity is observed in erythromycin A, a continuous library can be screened first for activity against deerythromycin A, and finally for deserythromycin oxime. In this way only subtle changes in specificity are expected from each new library.
[244] Gene and Library Generation
[245] Middemycin 3 ′ O-methyltransferase (mdmC) Sapromycin O-methyltransferase (safC), rapamycin 31-O-methyltransferase (rapI), and FK506-31-O-methyltransferase (fkbM The gene encoding the open reading frame of Fig. 13 is isolated and cloned into the appropriate E. coli expression vector (pET22B (+)). These genes, then 50-80% identical, are shuffled by group shuffling to generate a gene library encoding chimeric O-methyltransferase (OMTase). The library is cloned back into the expression vector and expressed in the appropriate E. Coli host (BL21 (DE3)). This library can be screened for chimeric enzymes with new properties such as new specificity for target methylation.
[246] General Screen for OMTase Activity
[247] OMTase activity can be measured with high efficiency using assays that measure the delivery of ( ³ H) S-adenosylmethionine to the required donor molecule of the radiolabeled methyl group (see FIG. 15). The assay is based on delivering methyl groups labeled with more hydrophobic molecules from highly charged molecules (SAM) (FIG. 12). The reaction is extracted with an organic solvent to leave unreacted SAM in the aqueous phase and optionally the methylated substrate is extracted into the organic phase. The organic phase is then measured for radioactive content. The advantages of this assay are that they are generally applicable to extractable substrates, which are high efficiency, which can be used simultaneously to screen activity against the pool of compounds. The method is as follows.
[248] Streptomyces lividans is a very suitable host for at least two reasons. First, it is transformed with high efficiency by plasmid DNA isolated from E. Coli. Secondly, it is highly permeable to erythromycin and its analogs, allowing analysis of all cells other than the filtrate. Alternatively, a high efficiency format can be used to measure enzyme activity from Escherichia coli or Bacillus subtilis cell extracts. Purified enzyme or cell filtrate was analyzed for 50 mM phosphate buffer (pH 7.5, 0.4 mM MgSO ₄ , 0.1 mM DTT, 0.1 mM ( ³ H) S-adenosylmethionine, and 1-10 mM target substrate (s)) Add to the mixture. After incubation, the reaction is inhibited by extraction with ethyl acetate. A sample (50 μl) of the organic phase is collected and mixed with scintillant (150 μl) and radioactivity is measured using a 96 well scintillation counter. Clones from samples with higher radioactivity than control samples without added enzymes can be considered positively and further studied in more quantitative assays.
[249] Evolution of clarithromycin synthase
[250] Clarithromycin is 6-O-methyl erythromycin. The current process for the preparation of clarithromycin is seven-step chemical methylation of erythromycin. Enzymes capable of carrying out this chemistry in one step may provide a means of preparing clarithromycin by fermentation or biotransformation (see FIG. 16). To prepare the enzyme, the OMTase library is screened for erythromycin-6-O methylase activity.
[251] The shuffled OMTase library is placed on solid medium to separate individual clones. Individual colonies are placed into 96 well plates containing LB medium (200 μl) and empicillin (100 μl / ml). These plates are grown at 30 ° C. for 10 hours or until the culture reaches an optimum density of 0.7. Isopropylthiogalactoside (IPTG) is added at 0.1 mM to induce expression of MTase and the cells are incubated for an additional 3 hours. Centrifuge this plate and discard the supernatant. Resuspend the cell pellet in lysis buffer (200 μl) in 50 mM phosphate buffer, (pH 7.5, 1 mM EDTA, 1 mM DTT, 2 μg / ml of polymyxin B sulfate and 1 μg / ml of T4 lysozyme) Let's do it. The reaction is incubated at 30 ° C. for 15 minutes.
[252] Samples in each well (20 μl) are transferred to a 96 deep well plate containing clarithromycin synthase assay buffer (280 μl) using a 96 head liquid handling station such as Multimek ^™ . The buffer is 50 mM phosphate buffer (pH 7.5, 0.4 mM MgSO ₄ , 0.1 mM DTT, 0.1 mM ( ³ H) S-adenosylmethionine and 1 mM erythromycin). Ethyl acetate (30 μL) is added to each well and the plate is vigorously stirred and centrifuged to recover the upper organic phase sample (50 μL) and added to the plate containing scintillant (150 μL). This plate is then read using a plate scintillation counter. Any sample that has higher radioactivity in the organic phase than that derived from a sample that immobilizes the parent gene or does not contain MTase is likely to include a transfer group of methyl groups for erythromycin. Since there are five potential hydroxyl groups on erythromycin to which methyl groups will be delivered, it is necessary to distinguish whether they will be delivered to 6-hydroxyl.
[253] Secondary analysis of clarithromycin synthase
[254] Secondary analysis of clarithromycin synthase activity is based on chemical modification with phenylboronate and assay using mass spectrometry. Erythromycin may be O-methylated at positions 6, 11 or 12 of the macrolide ring or at five positions with Cladinos or desosamin injury. Phenylboronate binds specifically to cis diols, such as the 11 and 12 diols of erythromycin. Thus, when phenylboronate binds to an enzymatically methylated erythromycin, the methyl group cannot be located at position 11 or 12. The following assay is performed to determine whether the modified erythromycin is clarithromycin.
[255] Enzymatic methylation of erythromycin is performed as described above, except that the SAM used for the alteration is not radiolabeled and the cell extract is from a cell showing a positive radioactivity assay. After extraction from the reaction mixture, the organic phase is analyzed by two-dimensional mass spectroscopy (MS / MS), at which time the ions are fragmented into submolecular fragments (see FIG. 17).
[256] Claritrimycin has a cationic molecular weight of 748.48 and the positive charge is due to the protonation of amines in the desoxamine moiety. Upon fragmentation of the clarithromycin cation, cladinos and desosamin are separated from the macrolide ring but only molecules containing the desosamin moiety are detected since they involve amines. Fragmentation of 748.48 ions results in two separate new ions 590.4 and 158.12. The 590 ion is 6-O-methyl deserythromycin A (Clarithromycin lacking the Cladinos moiety). The 158.12 ion is dehydrodesosamine and is the result of removing the 5-hydroxyl group of the macrolide ring. The MS / MS spectrum of the 748.48 peak with 590 ions and 158 ions is distinguished from the erythromycin derivative methylated on the macrolide ring (ie at the 6, 11 or 12 positions). If the sample exhibits this spectrum it is further analyzed to determine if it is methylated at position 6. The original extract is treated with excess phenylboronate under neutral conditions and analyzed by mass spectroscopy. Only when the modification is at position 6, positions 11 and 12 are free so that an adduct with clarithromycin with phenylboronate can be formed. Thus, the presence of 834.52 molecular ions (phenylboronyl adduct of clarithromycin) indicates that the sample contains clarithromycin and the corresponding clone encodes erythromycin 6-O-methyltransferase.
[257] It is to be understood that the examples and embodiments described herein are for purposes of illustration only and, in light of this, various changes or modifications may be suggested to one skilled in the art and are included within the scope of the appended claims and the scope and spirit of this application. All publications, patents, and patent applications cited herein are incorporated by reference.

权利要求:
Claims (50)
[1" claim-type="Currently amended] A method of obtaining a library of organic molecular derivatives, the method comprising contacting an organic molecule with at least one member of a library of recombinant derivatization enzymes and other necessary reactants to form a library of organic molecular derivatives, wherein derivatization The enzyme catalyzes a reaction selected from the group consisting of a) modification of at least one functional group present on an organic molecule, b) addition of a chemical moiety to at least one functional group present on an organic molecule, and c) introduction of a new functional group. .
[2" claim-type="Currently amended] The method of claim 1, comprising contacting the organic molecular derivative with at least one member of the second library of recombinant derivatization enzymes and other required reactants to form an additional library of organic molecular derivatives, wherein the second library of The derivatization enzyme catalyzes a reaction selected from the group consisting of a) modification of at least one functional group, b) addition of a chemical moiety to at least one functional group, and c) introduction of a new functional group.
[3" claim-type="Currently amended] The method of claim 2, wherein the derivatization enzyme of the second library catalyzes the modification of a functional group modified or added by the derivatization enzyme of the first library or the addition of a chemical moiety to the functional group.
[4" claim-type="Currently amended] The method of claim 1, wherein one or more members of the library of organic molecular derivatives are further derivatized by enzymatic or chemical reactions after contacting with a library of recombinant derivatization enzymes.
[5" claim-type="Currently amended] The method of claim 1, wherein the library of recombinant derivatization enzymes is obtained by shuffling.
[6" claim-type="Currently amended] The method according to claim 5, wherein the shuffling method is
(1) recombining at least a first and a second form of nucleic acid different from each other in at least two nucleotides encoding a derivatizing enzyme to generate a recombinant polynucleotide library; And
(2) expressing a library of recombinant polynucleotides to obtain a library of recombinant derivatization enzymes.
[7" claim-type="Currently amended] The method of claim 6, wherein the recombination step is performed in vitro.
[8" claim-type="Currently amended] The method of claim 6,
(3) recombining an additional library of recombinant nucleic acids by recombining one or more recombinant polynucleotides encoding a member of a recombinant derivatization enzyme library having additional forms of nucleic acids encoding derivatization enzymes, the same or different as the first and second forms Generating;
(4) expressing the recombinant polynucleotide addition library to obtain an additional library of recombinant derivatization enzymes; And
(5) if necessary, further comprising repeating steps (3) and (4) until the additional library of recombinant derivatization enzymes includes the required number of different recombinant derivatization enzymes.
[9" claim-type="Currently amended] The method of claim 8, wherein at least one recombination step is performed in vitro.
[10" claim-type="Currently amended] The method according to claim 5, wherein the shuffling method is
(1) providing one fragment as a template for the expansion of another fragment by subjecting the polynucleotide amplification process to conditions on overlapping fragments of the variant polynucleotide to produce a group of recombinant polynucleotides; And
(2) selecting or screening the recombinant polynucleotide for the required property.
[11" claim-type="Currently amended] The method of claim 10, wherein the overlapping fragments are produced by cleavage of a group of variant polynucleotides.
[12" claim-type="Currently amended] The method of claim 11, wherein the cleavage is by DNase I digestion.
[13" claim-type="Currently amended] The method of claim 10, wherein the overlapping fragments are produced by chemical synthesis.
[14" claim-type="Currently amended] The method of claim 10, wherein the overlapping fragments are produced by amplification of a group of polynucleotides.
[15" claim-type="Currently amended] The method of claim 10, wherein the set of variant polynucleotides are allelic variants.
[16" claim-type="Currently amended] The method of claim 10, wherein the set of variant polynucleotides is a species variant.
[17" claim-type="Currently amended] The method according to claim 5, wherein the shuffling method is
(1) hybridizing at least two nucleic acid sets, wherein the first set of nucleic acids comprises a single helix nucleic acid template and the second set of nucleic acids comprises one or more sets of nucleic acid fragments; And
(2) recombining the set of nucleic acid fragments by extending, ligating or extending and ligating sequence gaps between the hybridized nucleic acid fragments to produce at least nearly full length chimeric nucleic acid sequences corresponding to a single helix nucleic acid template. And a step.
[18" claim-type="Currently amended] The method of claim 17,
(3) denaturing at least nearly full length chimeric nucleic acid sequences and single helix nucleic acid templates;
(4) separating at least nearly full length chimeric nucleic acid sequences from a single helix nucleic acid template by one or more separation techniques; And fragmenting at least nearly full length chimeric nucleic acid sequences isolated by nuclease digestion or physical fragmentation to provide chimeric nucleic acid fragments.
[19" claim-type="Currently amended] The method of claim 1, wherein the organic molecule is a lead material.
[20" claim-type="Currently amended] The method of claim 1, wherein the organic molecule is a naturally occurring compound.
[21" claim-type="Currently amended] The method of claim 1, wherein the organic molecule is a non-naturally occurring compound.
[22" claim-type="Currently amended] The method of claim 1, wherein the library member of the recombinant derivatization enzyme is individually contacted with the organic molecule.
[23" claim-type="Currently amended] The method of claim 1, wherein the library member of the recombinant derivatization enzyme is subdivided into pools before contacting the organic molecule.
[24" claim-type="Currently amended] The method of claim 1, wherein the library member of the recombinant derivatization enzyme is contacted with the organic molecule as a mixture of the recombinant derivatization enzymes.
[25" claim-type="Currently amended] The method of claim 1, wherein the recombinant polynucleotide is expressed by introducing the recombinant polynucleotide into a replicable genetic package vector such that the encoded recombinant derivatization enzyme is generated as a fusion with protein presented on the surface of the replicable genetic package. How.
[26" claim-type="Currently amended] The method of claim 25, wherein the replicable genetic package is selected from the group consisting of bacteriophages, cells, spores, and viruses.
[27" claim-type="Currently amended] The method of claim 1, wherein the derivatization enzyme catalyzes modification of one or more functional groups on an organic molecule or replacement of one or more functional groups with other functional groups.
[28" claim-type="Currently amended] The method of claim 27, wherein the functional group is hydrogen and the substitution is by hydroxyl group.
[29" claim-type="Currently amended] The method of claim 28, wherein the derivatization enzyme is selected from the group consisting of monooxygenase and deoxygenase.
[30" claim-type="Currently amended] The method of claim 27, wherein the derivatization enzyme catalyzes the introduction of new functional groups on organic molecules.
[31" claim-type="Currently amended] 31. The method of claim 30, wherein the derivatizing enzyme is selected from the group consisting of halogenases and sulfotransferases.
[32" claim-type="Currently amended] The method of claim 1, wherein the derivatization enzyme catalyzes the addition of a chemical moiety to one or more functional groups.
[33" claim-type="Currently amended] 33. The method of claim 32, wherein the derivatizing enzyme is selected from the group consisting of glycosyltransferase, acyltransferase, amidase, methyltransferase and phosphotransferase.
[34" claim-type="Currently amended] 34. The method of claim 33, wherein the derivatizing enzyme is an acyltransferase and the chemical moiety is selected from the group consisting of vinyl esters, trihaloethyl, esters, vinylcarbonates, vinyl carbamates, oxime esters, oxime carbonates and bifunctional moieties. .
[35" claim-type="Currently amended] 34. The method of claim 33, wherein the derivatizing enzyme is glycosyltransferase and the chemical moiety is selected from the group consisting of glycosides, aminoglycosides and glycosidic acids.
[36" claim-type="Currently amended] 34. The method of claim 33, wherein the derivatizing enzyme is glycosyltransferase and the organic molecule is aglycosyl vancomycin hydrochloride, somatostatin, cholic acid, L-thyroxine, nogalamycin, siringaldizin, aclarubicin, ritodrine hydrochloride, lipa The method selected from the group consisting of mycin and ristomycin sulfate.
[37" claim-type="Currently amended] The method of claim 33, wherein the derivatizing enzyme is O-methyltransferase and the organic molecule is erythromycin.
[38" claim-type="Currently amended] The method of claim 33, wherein the derivatization enzyme is an amidase and the chemical moiety is selected from the group consisting of amides and peptides.
[39" claim-type="Currently amended] The method of claim 1, further comprising screening a library of organic molecular derivatives to identify those organic molecular derivatives that exhibit the required properties.
[40" claim-type="Currently amended] The method of claim 39, wherein said desired property binds to a target molecule.
[41" claim-type="Currently amended] The method of claim 40, wherein the target molecule is selected from the group consisting of receptors, signal proteins and ligands.
[42" claim-type="Currently amended] 40. The method of claim 39, further comprising the step of screening library members of the recombinant derivatization enzyme to identify members that catalyze the modification of the organic molecule that imparts the necessary properties to the resulting organic molecular derivative.
[43" claim-type="Currently amended] A method of obtaining an enzyme catalyzing the synthesis of a desired organic molecular derivative, the method comprising: contacting an organic molecule with a member of a library of recombinant derivatization enzymes and other required reactants to form a library of organic molecular derivatives; Identifying required organic molecular derivatives in a library of organic molecular derivatives; And identifying a member of the recombinant derivatization enzyme library that catalyzes the synthesis of the desired organic molecular derivative.
[44" claim-type="Currently amended] The method of claim 43, wherein the members of the recombinant derivatization enzyme library are individually contacted with the organic molecule.
[45" claim-type="Currently amended] The method of claim 43, wherein the members of the recombinant derivatization enzyme library are sub-separated into pools before contacting the organic molecules.
[46" claim-type="Currently amended] A library of recombinant derivatization enzymes, wherein when a recombinant derivatization enzyme contacts an organic molecule having at least one functional group, a) modification of at least one functional group, b) addition of a chemical moiety to at least one functional group, and c) introduction of a new functional group A library catalyzing a reaction selected from the group consisting of.
[47" claim-type="Currently amended] 47. The library of claim 46, wherein each of the recombinant derivatization enzymes comprises a plurality of amino acid blocks that do not contact naturally occurring derivatization enzymes.
[48" claim-type="Currently amended] The library of claim 47, wherein each of the recombinant derivatization enzymes comprises amino acid blocks derived from two or more homologs of the derivatization enzymes.
[49" claim-type="Currently amended] A library of organic molecular derivatives, wherein the library catalyzes a reaction selected from the group consisting of a) modification of one or more functional groups, b) addition of a chemical moiety to one or more functional groups, and c) introduction of new functional groups. The library is biocatalytically synthesized by contacting a plurality of members of an organic molecule having at least one functional group.
[50" claim-type="Currently amended] The method of claim 49, wherein the recombinant derivatization enzyme recombines at least one first and second form of nucleic acid that differs from each other in at least two nucleotides encoding the derivatization enzyme to generate a library of recombinant polynucleotides and a library of recombinant polynucleotides. A library obtained by expressing a to obtain a library of recombinant derivatization enzymes.

类似技术:

---

公开号 | 公开日 | 专利标题

---

Cobb et al.2015|High-efficiency multiplex genome editing of Streptomyces species using an engineered CRISPR/Cas system

---

Weber et al.2015|Metabolic engineering of antibiotic factories: new tools for antibiotic production in actinomycetes

---

JP6509727B2|2019-05-15|Methods for nucleic acid assembly and high-throughput sequencing

---

Zhang et al.2012|Radical-mediated enzymatic methylation: a tale of two SAMS

---

Heathcote et al.2001|Role of type II thioesterases: evidence for removal of short acyl chains produced by aberrant decarboxylation of chain extender units

---

Jaeger et al.2001|Directed evolution and the creation of enantioselective biocatalysts

---

Simunovic et al.2006|Myxovirescin A Biosynthesis is Directed by Hybrid Polyketide Synthases/Nonribosomal Peptide Synthetase, 3‐Hydroxy‐3‐Methylglutaryl–CoA Synthases, and trans‐Acting Acyltransferases

---

Wu et al.2001|Assessing the balance between protein− protein interactions and enzyme− substrate interactions in the channeling of intermediates between polyketide synthase modules

---

Hong et al.2015|Improving cell‐free protein synthesis through genome engineering of Escherichia coli lacking release factor 1

---

Seow et al.1997|A study of iterative type II polyketide synthases, using bacterial genes cloned from soil DNA: a means to access and use genes from uncultured microorganisms.

---

Yang et al.2009|Ultrahigh‐throughput FACS‐based screening for directed enzyme evolution

---

Lim et al.2004|A class of plant glycosyltransferases involved in cellular homeostasis

---

CA2320697C|2014-11-18|Oligonucleotide mediated nucleic acid recombination

---

US7442160B2|2008-10-28|Evolving new molecular function

---

Sun et al.2015|Recent advances in combinatorial biosynthesis for drug discovery

---

EP2175021B1|2013-06-19|Method for producing polymers

---

JP5837478B2|2015-12-24|RAPID display method in peptide translation synthesis

---

Shen2003|Polyketide biosynthesis beyond the type I, II and III polyketide synthase paradigms

---

EP2489671B1|2015-03-25|Programmable oligonucleotide synthesis

---

AU2007238624B2|2012-05-31|Kits and methods for generating 5' capped RNA

---

AU2003263937B2|2010-04-01|Evolving new molecular function

---

Sylvers et al.1993|A 2-thiouridine derivative in tRNAGlu is a positive determinant for aminoacylation by Escherichia coli glutamyl-tRNA synthetase

---

US7915026B2|2011-03-29|Host cells for production of isoprenoid compounds

---

EP1696025B1|2010-04-21|Screening methods for enzymes and enzyme kits

---

Liscombe et al.2012|Architectures, mechanisms and molecular evolution of natural product methyltransferases

同族专利:

---

公开号 | 公开日

---

AU7057500A|2001-03-13|

---

JP2003529328A|2003-10-07|

---

EP1208209A1|2002-05-29|

---

CN1378598A|2002-11-06|

---

CA2380948A1|2001-02-22|

---

WO2001012817A1|2001-02-22|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

法律状态:
1999-08-12|Priority to US14884899P

---

1999-08-12|Priority to US60/148,848

---

2000-08-11|Application filed by 리우, 루, 추후제출, 맥시겐, 인크.

---

2000-08-11|Priority to US63730900A

---

2000-08-11|Priority to US09/637,309

---

2000-08-11|Priority to PCT/US2000/022080

---

2002-03-27|Publication of KR20020022808A

优先权:

---

申请号 | 申请日 | 专利标题

---

US14884899P| true| 1999-08-12|1999-08-12|

---

US60/148,848|1999-08-12|

---

US63730900A| true| 2000-08-11|2000-08-11|

---

US09/637,309|2000-08-11|

---

PCT/US2000/022080|WO2001012817A1|1999-08-12|2000-08-11|Evolution and use of enzymes for combinathorial and medicinal chemistry|