Paramyxoviridae virus vector defective in envelope gene

专利摘要:
Using the Sendai virus genome cDNA that deleted the F gene, we succeeded in recovering the virus virion that deleted the F gene. Furthermore, using F-expressing cells as helper cells succeeded in producing F-deficient infectious virus particles. In addition, using the viral genomic cDNA which deleted both the F and HN genes, it succeeded in recovering the virus virion lacking the F and HN genes. In addition, F and HN-expressing cells were used as helper cells to produce F, HN gene-defective infectious virus particles. In addition, F and HN gene-deficient viruses with F protein were also produced using F-expressing cells as helper cells. VSV-G pseudotyped virus was also successfully produced using VSV-G expressing cells . These techniques for producing defective viruses pave the way for the development of vectors for gene therapy in paramyxoviruses.
公开号:KR20020014786A
申请号:KR1020017012612
申请日:2000-05-18
公开日:2002-02-25
发明作者:기타자토가이오；슈쯔구미네；우에다야스지；하세가와마모루；이이다아키히로；도키토우후미노；히라타다카히로；도쿠스미쯔요시；구마히데카즈；아사카와마코토
申请人:나카토미 히로타카；가부시키가이샤 디나벡크 겐큐쇼；
IPC主号:

专利说明:

Envelope gene deletion < RTI ID = 0.0 > paramyxoviridae < / RTI > virus vector defective in envelope gene &
[2] Most of the approaches to clinical trials of gene therapy so far have been using viral vectors such as retroviruses, adenoviruses and adenoviruses. These gene therapy vectors have large problems in medical applications, such as limited introduction efficiency and persistent expression, and cytotoxicity and immunogenicity in the vector itself (Lamb, RA & Kolakofsky, D., Paramyxoviridae: the (1996)). As a countermeasure for these problems, lentiviruses and lentiviruses have been used as a countermeasure against these viruses and their replications in fields. Virology, 3rd edn, edited by BNFields, DM Knipe & PP Howley, pp.1177-1204 A new vector based on HSV has been proposed and further studies on the improvement of existing vectors have been conducted energetically However, all of these vectors exist in the form of DNA in the nucleus in the living circle, It is difficult to completely avoid the risk of safety with respect to random interaction with.
[3] Rapid advances in recent reverse genetics technology have made it possible to develop vectors based on RNA viruses, which had been under development in the past. Recombinant RNA viruses exhibit high gene transfection efficiency and expression ability and show high potential as vectors for gene therapy (Roberts, A. & Rose, J., K., Virology 247, 1-6 (1998); Rose, J USA, 93, 11354-11358 (1996)), Proc. Natl Acad Sci USA 94, 14998-15000 (1996); Palese, P. et al., Proc. Natl Acad Sci. However, a practically usable attenuated virus-defective genome-derived paramyxovirus vector has not yet been reported.
[4] Paramyxovirus vectors with negative strand RNA in the genome have several characteristics that are significantly different from retroviruses, DNA viruses, or positive strand RNA viral vectors. The genome or anti-genome does not function directly as an mRNA and can not initiate protein synthesis or genome replication of the virus. The RNA genome and antigene of the virus are always present in the form of a ribonucleoprotein complex (RNP), which hybridizes to naked genomic RNA in which the mRNA is complementary as shown in the positive strand RNA virus The problem of antisense to interfere with assembly of the genome into RNP hardly occurs. These viruses have their own RNA polymerase, and use the RNP complex as a template to transcribe the virus mRNA or replicate the virus genome. It should be noted that the negative strand RNA (nsRNA) virus only proliferates in the cytoplasm of the host cell and does not have a DNA phase, so that integration into the chromosome does not occur. Furthermore, homologous recombination between RNAs is not recognized. These properties are believed to contribute significantly to the stability and safety of the negative strand RNA virus as a gene expression vector.
[5] The present inventors have paid attention to Senda virus (SeV) among negative strand RNA viruses. SeV is a non-segmented negative strand RNA virus, belonging to paramyxovirus, and is a type of murine parainfluenza virus. The virus binds to the host cell membrane via two envelope proteins, hemagglutinin-neuraminidase (HN) and fusion protein (F), and causes membrane fusion, RNA genomes present in the form of their RNA polymerase and ribonucleoprotein (RNP) complex are released into the cytoplasm, where transcription of the mRNA of the virus and replication of the genome are carried out (Bitzer, M. et al. J. Virol., 71 (7): 5481-5486, 1997). The virus envelope protein F is synthesized as a non-active precursor protein (F ₀ ) and is divided into F1 and F2 by proteolytic cleavage by trypsin (Kido, H. et al., Biopolymers (Peptide Science) 51 ): ≪ / RTI > 79-86, 1999), resulting in an active protein and membrane fusion. It is said that the virus is not pathogenic to humans. In addition, the attenuated laboratory strain (Z strain) is also isolated, resulting in mild pneumonia in rodents as a natural host. This gene has been widely used as a research model in the molecular level of the transcriptional replication machinery of paramyxoviruses and has also been used in the production of hybridomas. In addition to this high safety, the virus exhibits high production titers of 10 ^{9 to 11} pfu / ml in cell lines or eggs. Recently, in the system for recovering the recently succeeded negative strand RNA virus vector from cDNA, the Sendai virus shows particularly high reconstruction efficiency. Recombinant wild viruses into which foreign genes have been introduced have attracted attention for their ability to efficiently and stably express introduced foreign genes.
[6] As described above, the negative strand RNA virus has many advantages as a gene introduction vector. However, in order to apply it to gene therapy, it is desired to develop a highly safe vector that does not release infectious particles when infected with cells. To accomplish this, a technique for mass production of defective viruses deficient in the ability to produce wild-type viruses is required. However, development of a vector based on an envelope gene lacking genome that has been applied so far has not yet been successful.
[7] DISCLOSURE OF INVENTION
[8] It is an object of the present invention to provide a paramyxovirus vector lacking an envelope gene.
[9] In order to construct a suitable paramyxovirus vector by gene therapy lacking propagation ability, the inventors of the present invention have found that the F value of SeV is deleted from the genome and the GEP gene is introduced as a reporter, A method of recovering infectious viral particles from cell lines expressing proteins was established. This F gene deficient virus vector was highly transfected into various cells such as primary cultured rat neurons, primitive mouse blood hepatocytes, human normal cells, and showed high gene expression. Furthermore, in vivo, high expression was obtained when administered to the brain of rats. This F gene-defective SeV vector expresses genes relatively long, continuously, and strongly in the infected cells, and does not propagate to adjacent cells because it does not produce secondarily infectious viral particles. Therefore, its usefulness as a vector for gene therapy It was suggested.
[10] Furthermore, the inventors of the present invention have established a method for recovering infectious viral particles from a cell line expressing the F protein and HN protein of Sendai virus by preparing SeV vector cDNA in which both the F gene and the HN gene are deleted. Furthermore, by introducing the SeV vector cDNA into the F-expressing cells, SeV vectors deficient in the HN protein were successfully produced.
[11] As described above, the present invention is to first establish a practically usable new envelope gene-deleted vector system using the negative strand RNA virus as a basic framework. Successful recovery of infectious defective virus particles from helper cells from F genetic defects or FHN gene defective genomic cDNAs paves the way for research and development of novel gene therapy vectors that take advantage of the excellent features of Sendai virus.
[12] The isolated Sendai virus vector of the present invention has an extremely high gene introduction efficiency for a wide variety of cell types and has the ability to express foreign genes stably. Furthermore, it has been found that the vector is highly safe, which completely eliminates the propagation of the virus, since it is continuously expressed in infected cells and does not release secondary infectious viral particles.
[13] In the case of the RNA virus, the problem of stability of the genome can be pointed out. However, as a result of heterologous gene expression by the SeV vector, even when the virus is continuously transferred, almost no base mutation appears and the heterologous gene is expressed stably over a long period of time (Yu, D. et al., Genes cells 2, 457-466 (1997)). The vector based on the negative strand RNA virus replicon is a vector of the already successful positive strand RNA virus Semliki forest virus or Sindbis viruses Compared to replicon-based viral vectors, there are several advantages over viral vectors, such as the stability of the genome, the size of the transgene by virtue of not having a vesicle structural protein, or the flexibility of packaging. The wild-type Sendai virus vector can introduce foreign DNA to at least 4 kbp, and the deletion type vector has a larger introduction size. It may be possible to simultaneously express two or more genes by adding a transcription unit. The replicon-based vector of the Sendai virus is theoretically expected to be continuously expressed because the RNP replicated in the cytoplasm is also distributed to the daughter cells accompanying the division of the cells. In fact, it has been proved by in vitro experiments in any one kind of blood cells. Furthermore, the present inventors have confirmed that the Sendai virus vector is introduced into cells of hematopoietic system, particularly, granulocyte cells with high efficiency and also introduced into c-kit positive primitive cells. Therefore, Suggests that it can be a highly applicable vector with a very wide tissue coverage.
[14] That is, the present invention relates to an envelope gene deletion Sendai virus, and more specifically,
[15] (1) a complex of a negative strand single strand RNA derived from a paramyxovirus modified to not express at least one envelope protein of the paramyxovirus and (b) a protein which binds to the corresponding negative strand single strand RNA Lt; RTI ID = 0.0 > viral < / RTI > vector,
[16] (2) The vector according to (1), wherein the negative strand single strand RNA expresses the NP protein, the P protein and the L protein, and the vector modified so as not to express the F protein and /
[17] (3) A vector according to (1) or (2), comprising at least one of the envelope proteins modified so as not to express from the negative strand single stranded RNA,
[18] (4) The vector according to any one of (1) to (3), wherein the VSV-G protein-
[19] (5) The vector according to any one of (1) to (4), wherein the negative strand single strand RNA is derived from Sendai virus,
[20] (6) The vector according to any one of (1) to (5), wherein the negative strand single stranded RNA further encodes a foreign gene,
[21] (7) a negative strand single-stranded RNA contained in the vector of any one of (1) to (6) or a DNA encoding the complementary strand thereof,
[22] (8) A method for producing a vector according to any one of (1) to (6)
[23] (a) introducing a negative strand single strand RNA derived from a paramyxovirus modified to not express at least one envelope protein of a paramyxovirus and a vector DNA encoding the complementary strand into a cell expressing the envelope protein And
[24] (b) culturing the cell, and recovering the virus particles from the culture supernatant,
[25] (9) A method for producing a vector according to any one of (1) to (6)
[26] (a) a complex of a negative strand single strand RNA derived from a paramyxovirus modified to not express at least one envelope protein of a paramyxovirus and a protein that binds to the negative strand single strand RNA, A step of introducing the cells into an expressing cell and
[27] (b) culturing the cell, and recovering the virus particles from the culture supernatant,
[28] (10) The method according to (8) or (9), wherein the culturing of the cells in the step (b) is a co-culture with cells expressing the envelope protein,
[29] (11) The method of (8) or (9) above, which comprises culturing the cells in the step (b) in which the cells expressing the envelope protein are superposed,
[30] (12) The method according to any one of (8) to (11), wherein at least one of the envelope proteins expressed by the cells is the same as at least one of the envelope proteins modified so as not to express from the negative strand single-
[31] (13) The method according to any one of (8) to (12), wherein at least one of the envelope proteins expressing cells is a VSV-G protein.
[32] In the present invention, "vector" refers to a virus particle packaged with a nucleic acid molecule for expressing a foreign gene in a host.
[33] The "NP, P, M, F, HN and L genes" of paramyxoviruses and viruses refer to nucleocapsid, phospho, matrix, fusion, hemagglutinin, Refers to a gene encoding hemagglutinin-neuraminidase and a large protein. Each gene in each virus belonging to Paramyxoviridae is generally expressed as follows. Also, in general, the NP gene may be referred to as " N gene ".
[34] Lepidoptera virus N P / C / V M F HN - L
[35] Lupoviridae N P / V M F HN (SH) L
[36] Genotypic viruses N P / C / V M F H - L
[37] For example, the accession number of each gene sequence of Sendai virus classified as Paramyxoviridae Respirovirus is M29343, M30202, M30203, M30204, M51331, M55565, M69046, and X17218; for the P gene, M11206, M30203, M30204, M55565, M69046, X00583, X17007, X17008, For the F gene, for the D26475, M12397, M30202, M30203, M30204, M69046, X00586, X02808, X56131, L genes for D00152, D11446, D17334, D17335, M30202, M30203, M30204, M69046, X00152, X02131, See D00053, M30202, M30203, M30204, M69040, X00587, X58886.
[38] The present invention relates to an envelope gene-defective type of paramyxovirus vector. Wherein the viral vector comprises negative strand single strand RNA derived from a paramyxovirus that has been modified so as not to express at least one envelope protein. Paramyxoviruses generally contain a complex of RNA and protein (ribonucleoprotein; RNP) inside the envelope. The RNA contained in the RNP is a single strand RNA of the negative strand (negative strand) of the genome of Paramyxovirus, and the protein binds to this RNA to form a complex. The paramyxoviral vector of the present invention comprises (a) a negative strand single strand RNA derived from a paramyxovirus that has been modified so as not to express at least one envelope protein of a paramyxovirus, and (b) a single strand of said negative strand And contains a protein complex that binds to RNA in the viral particle. A protein that binds to a negative strand single strand RNA refers to a protein that directly and / or indirectly binds to the negative strand single strand RNA to form a complex with the negative strand single strand RNA. Generally, negative strand RNA (genomic RNA) of paramyxovirus binds NP protein, P protein and L protein. The RNA contained in this RNP serves as a template for transcription and replication of the viral genome (Lamb, RA, and D. Kolakofsky, 1996, Paramyxoviridae : The viruses and their replication, pp.1177-1204. In Fields Virology, 3rd edn Fields, BN, DM Knipe, and PM Howley et al. (Eds.), Raven Press, New York, NY). The complex of the present invention includes a complex of a negative strand single strand RNA derived from paramyxovirus and a protein derived from paramyxovirus binding thereto. The vector of the present invention includes, for example, RNP in which these proteins (NP, P and L proteins) are bound to negative strand single strand RNA of Paramyxovirus. In general, RNP complexes of paramyxoviruses have the ability to replicate RNP complexes autonomously in a cell. Thus, the vector introduced into the cell increases the number of copies of the gene (RNA contained in the complex) by amplifying the RNP in the cell. This leads to high expression of the foreign gene from the vector having the foreign gene. The vector of the present invention preferably has an ability to replicate RNA contained in a complex (RNP) in a cell.
[39] Examples of the paramyxoviruses to which the present invention can be applied include, but are not limited to, three types of measles viruses, measles viruses, monkey parainfluenza viruses (SV5), and human parainfluenza viruses in addition to Sendai viruses.
[40] Negative stranded single stranded RNAs in viral vectors are typically modified to express NP, P and L proteins and not to express F and / or HN proteins.
[41] In the case of Sendai virus (SeV), the genome size of the native virus is about 15,000 bases and the negative strand is linked to the 3 'leader region, which is NP (nucleoside seed), P (Short) 5 'trailer region, and a short 5' trailer region, which is composed of six genes coding for M (matrix), F (fusion), HN (hemagglutinin-neuraminidase) At the other end. In the present invention, by designing a genome that deletes any one of F, HN, and M genes, or a combination thereof, it can be modified so as not to express an envelope protein. Preferably, the F gene or the HN gene or both the F gene and the HN gene are deleted. Since these proteins are not necessary for the formation of RNP, the RNP of the present invention can be produced by transfecting the genomic RNA (positive strand or negative strand) in the presence of NP, P and L proteins. Formation of RNP can be performed, for example, in LLC-MK2 cells. The supply of the NP, P and L proteins can be performed by introducing an expression vector encoding each gene into the cells (see Examples). In addition, each gene may be incorporated into the chromosome of the host cell. The NP, P, and L genes that are expressed to form RNP need not be identical to the NP, P, and L genes that are encoded in the genome of the vector. That is, the amino acid sequence of the protein encoded by these genes is not limited to the amino acid sequence of the protein encoded by the RNP genome, so long as it has an activity of binding to the genomic RNA to replicate RNP in the cell, Or may be substituted with homologous genes of other viruses. When one end RNP is formed, NP, P and L genes are expressed from the RNP, and RNP is replicated in the cells in a self-contained manner to produce a viral vector.
[42] When an envelope protein is expressed in a cell when the vector is reconstituted in the cell, the envelope protein can be incorporated into the viral vector to produce a viral vector that maintains infectivity by the envelope protein. Such a vector can not reproduce a virus having the same envelope protein as the first, since it infects cells once and can proliferate RNP in the cells, but does not have an envelope gene itself. Such vectors are extremely useful in fields requiring high safety, particularly gene therapy.
[43] Upon viral rearrangement, a viral vector having an infectious property equivalent to that of a wild-type virus can be prepared by expressing an enveloped protein that has not been expressed in the negative strand single strand RNA, that is, an envelope gene deficient in the genome. It is also conceivable to express a part of the envelope gene deficient in the genome. For example, when only the F protein is expressed in the genome deficient in both the F gene and the HN gene, a virus vector having the F protein in the envelope is produced. A virus having no HN protein and having only F protein can be used as a vector specifically infecting hepatic cells via an asialoglycoprotein receptor (ASG-R). As such, paramyxovirus vectors comprising at least one envelope protein that has been modified so as not to be expressed in negative strand single stranded RNA are also included in the present invention.
[44] It is also possible to reconstruct the vector of the present invention by using an envelope protein different from the envelope protein modified so as not to be expressed in the negative strand single strand RNA. There is no particular limitation to such an envelope protein. For example, an envelope protein of another virus, for example, a G protein of VSV (VSV-G) can be mentioned. The paramyxovirus vector of the present invention includes a pseudotypic virus vector including an envelope protein derived from a virus other than the genome-derived virus, such as VSV-G protein.
[45] The viral vector of the present invention usually comprises (a) a negative strand single strand RNA derived from a paramyxovirus that has been modified so as not to express at least one envelope protein of a paramyxovirus, or a vector DNA encoding the complementary strand thereof, (Helper cells) expressing the envelope protein, and (b) culturing the cells, and recovering the virus particles from the culture supernatant. When vector DNA is expressed, RNP is formed by co-expressing NP, L and P proteins, and a virus having an envelope protein is constructed.
[46] Vector DNA that expresses in helper cells encodes a negative strand single strand RNA (negative strand) or its complementary strand (positive strand) contained in the vector of the present invention. For example, negative strand single stranded RNA or DNA encoding its complementary strand is ligated downstream of the T7 promoter and transcribed into RNA by T7 RNA polymerase. The vector DNA may be cloned into a plasmid so as to be amplified in E. coli. The chain to be transcribed in the cell may be a negative strand or a negative strand, but it is preferable that the positivity chain is transcribed to increase the efficiency of reconstitution.
[47] As helper cells, cells expressing the envelope protein are used. As described above, the helper cell is not limited to cells expressing all the envelope gene proteins deficient in the viral vector. For example, for the F, HN gene-deficient Sendai virus vector DNA, It is also possible to use cells as helper cells. Further, it may be a cell expressing an envelope protein different from the protein encoded by the envelope gene deficient in the viral vector. For example, as described above, it is also possible to use an envelope protein (for example, VSV-G protein) that is not an envelope protein of a paramyxovirus as an envelope protein.
[48] For example, a plasmid expressing a recombinant Sendai virus genome deficient in an envelope gene is transfected into a host cell together with a vector expressing a defective envelope protein and an expression vector of NP, P / C and L proteins, Whereby the virus vector can be reconstructed. In addition, for example, it is also possible to prepare a host cell in which the F gene is introduced into a chromosome. These protein groups, which are supplied from other than the viral genome, may be introduced into the viral genome by introducing a mutation or introducing a mutation into the viral genome if the activity in the introduction of the nucleic acid is equal to or more than that of the native form, As a homologous gene. Generally, since the envelope protein often exhibits cytotoxicity, it is also possible to express it only at the time of reconstitution of the vector under the control of an inducible promoter (see Examples).
[49] When the RNP or virus is formed, the vector of the present invention can be amplified by re-introducing the RNP or the virus into the above helper cell and culturing. The process comprises the steps of: (a) contacting a complex of a negative strand single strand RNA derived from a paramyxovirus modified to not express at least one envelope protein of a paramyxovirus and a virus and a protein binding to the negative strand single strand RNA, Into a cell expressing an envelope protein, and (b) culturing the cell, and recovering the virus particles from the culture supernatant.
[50] In order to introduce RNP into a cell, it is possible to introduce a complex with a lipofectamine or polycationic liposome to form a complex. Specifically, various transfection reagents can be used. Examples include DOTMA (Boehringer), Superfect (QIAGEN # 301305), DOTAP, DOPE, DOSPER (Boehringer # 1811169) and the like. It is also possible to add chloroquine to prevent degradation in the endosome (Calos, M.P., 1983, Proc. Natl. Acad. Sci. USA 80: 3015).
[51] When the viral vector is constructed in the cell as described above, the viral vector can be further amplified by co-culturing the cell with the cells expressing the envelope protein. As such a method, for example, as described in Example 12, a method of layering cells expressing an envelope protein in cells producing virus is suitable.
[52] The envelope protein includes, in addition to the envelope protein of the virus, for example, a polypeptide derived from an extracellular domain such as an adhesion factor, a ligand, or a receptor capable of adhering to a specific cell and having a polypeptide derived from the virus envelope in the intracellular domain It is possible to use a chimeric protein or the like. This makes it possible to generate a vector targeting a specific tissue. The viral vector of the present invention may be, for example, a viral gene contained in a vector in order to lower the immunogenicity or increase the transcription efficiency and replication efficiency of RNA.
[53] The viral vector of the present invention may comprise RNA encoding a foreign gene in the negative strand single stranded RNA. As a foreign gene, it is possible to use a gene to be expressed in a target cell. For example, in the case of gene therapy or the like, a gene for treatment of a disease to be a target of the viral vector DNA is incorporated. When a foreign gene is introduced into the viral vector DNA, for example, a Sendai virus vector In DNA, it is preferable to incorporate a sequence having a base number in multiples of 6 between the transcription termination (E) sequence and the transcription initiation (S) sequence (Journal of Virology, Vol. 67, No. 8, 1993, p .4822-4830). The foreign gene can be introduced before or after each gene of the virus (NP, P, M, F, HN and L genes) (see Examples). E-I-S sequence (transcription initiation sequence-intervening sequence-transcription termination sequence) or its part is appropriately inserted before or after the foreign gene so as not to interfere with the expression of the front and rear genes. The expression amount of the introduced exogenous gene can be regulated depending on the type of the transcription initiation sequence added upstream of the foreign gene. It can also be regulated by the position of the gene insertion and also by the sequence of the gene back and forth. For example, in Sendai virus, the closer the insertion position is to the 3 'end of the negative strand RNA (the closer to the NP gene the gene arrangement on the genome of the wild type virus), the higher the expression amount of the inserted gene. In order to obtain a high expression of the foreign gene, it is preferable to incorporate the foreign gene into the upstream region in the negative strand genome, such as upstream of the NP gene (3 'side in negative strand) or between NP gene and P gene. Conversely, the closer the insertion site is to the 5 'end of the negative strand RNA (the closer to the L gene in the genomic arrangement of the wild-type virus), the lower the expression amount of the introduced gene. In order to suppress the expression of the foreign gene low, for example, in the 5 'side of the negative strand, that is, in the wild type viral genome, downstream of the L gene (in the negative strand, 5' (In the negative strand, 3 ' adjacent region of the L gene). In order to facilitate the incorporation of foreign genes, a cloning site can be designed at the site of insertion. The cloning site can be, for example, a recognition sequence of a restriction enzyme. The foreign gene fragment can be incorporated into the corresponding restriction enzyme site in the vector DNA encoding the genome. The cloning site may be a so-called multicloning site having a plurality of restriction enzyme recognition sequences. The vector of the present invention may retain the foreign gene other than those mentioned above at the insertion site.
[54] Recombinant Sendai virus vectors with foreign genes are described, for example, in Kato, A. et al., 1997, EMBO J. 16: 578-587 and Yu, D. et al., 1997, Genes Cells 2: 457-466 Can be constructed in the following manner.
[55] First, a DNA sample containing the cDNA sequence of the desired foreign gene is prepared. It is preferable that the DNA sample can be confirmed to be a single plasmid electrophoretically at a concentration of 25 ng / μl or more. Hereinafter, the case where the foreign gene is inserted into the DNA encoding the viral genome using the NotI site will be described as an example. When the NotI recognition site is included in the desired cDNA sequence, the base sequence is changed so that the encoded amino acid sequence is not changed by site-specific mutagenesis, and the NotI site is deleted It is preferable to remove it in advance. The target gene fragment from this sample is amplified and recovered by PCR. In order to add a copy of the transcription termination sequence (E), the intervening sequence (I) and the transcription initiation sequence (SIS) (EIS sequence) of Sendai virus to the NotI site at both ends of the amplified fragment, As a pair of pro-amers comprising a cleavage site sequence and a transcription termination sequence (E), an intervening sequence (I) and a transcription initiation sequence (S) and a sequence of a part of the objective gene, a forward side synthetic DNA sequence and a reverse side synthetic DNA sequence Antisense chain).
[56] For example, the forward-side synthetic DNA sequence may contain any two or more nucleotides on the 5 'side (preferably 4 bases that do not contain the sequence derived from the NotI recognition site of GCG, GCC, Preferably ACTT) is selected, a NotI recognition site gcggccgc is added to the 3'-side thereof, and further a base is added to the 3'-side of the base by adding 9 bases or 9 to 6 as a spacer sequence, Further, a sequence corresponding to about 25 bases of the ORF is added to the 3 'side from the initiation codon ATG of the target cDNA. It is preferable that about 25 bases are selected from the cDNA of interest so that the last base is G or C, and the 3 'end of the forward-side synthetic oligo DNA is selected.
[57] The reverse-side synthetic DNA sequence is obtained by selecting any two or more nucleotides (preferably, four bases not containing the sequence derived from the NotI recognition site of GCG or GCC, more preferably ACTT) from the 5 'side, The NotI recognition site gcggccgc is added to the 3'-side of the NotI recognition site, and furthermore, the oligo DNA of the insertion fragment for controlling the length is added to the 3'-side thereof. The length of this oligonucleotide is designed such that the NotI recognition site gcggccgc is included and the total of the complementary strand base sequence of the cDNA and the EIS base sequence of the Sendai virus genome, which will be described later, is a multiple of 6 (the so-called &Quot; rule of six "; Kolakofski, D. et al., J. Virol. 72: 891-899, 1998). In addition, the complementary chain sequence of the Sendai virus S sequence, preferably 5'-CTTTCACCCT-3 ', I sequence, preferably 5'-AAG-3', the complementary chain sequence of E sequence, And the length is selected so that the last base of the complementary chain of about 25 bases corresponding to the termination codon of the cDNA sequence of interest at the 3 'side thereof is G or C on the 3' side, Thereby forming the 3 'terminus of the reverse-side synthetic oligo DNA.
[58] As the PCR, for example, a conventional method using ExTaq polymerase (Takara) can be used. Preferably, Vent polymerase (NEB) is used. The amplified target fragment is digested with NotI and inserted into the NotI site of the plasmid vector pBluescript. The nucleotide sequence of the obtained PCR product is confirmed by a sequencer, and the plasmid of the correct sequence is selected. From this plasmid, the inserted fragment is cut out into NotI and cloned into the NotI site of the plasmid containing the genomic cDNA lacking the envelope gene. It is also possible to obtain the recombinant Sendai virus cDNA by directly impregnating into the NotI site without mediation of the plasmid vector pBluescript.
[59] The viral vector DNA of the present invention can be transcribed in vitro or intracellularly, and the virus vector containing the RNP can be produced by reconstituting RNP with the L, P, NP protein of the virus. Reconstitution of the virus from the viral vector DNA can be carried out according to known methods using cells expressing the envelope protein (WO 97/16539; WO 97/16538; Durbin, AP et al. 1997, Virology 235: 323-332; Whelan, SP et al., 1995, Proc Natl Acad Sci USA 92: 8388-8392; Schnell MJ et al., 1994, EMBO J. 13: 4195-4203 ; Radecke, F. et al., 1995, EMBO J. 14: 5773-5784; Lawson, ND et al., Proc Natl Acad Sci USA 92: 4477-4481; 1995, EMBO J. 14: 6087-6094; Kato, A. et al., 1996, Genes Cells 1: 569-579; Baron, MD and Barrett, T., 1997, J. Virol. Bridgen, A. and Elliott, RM, 1996, Proc Natl Acad Sci USA 93: 15400-15404). When the F gene, the HN gene and / or the M gene are deleted in the viral vector DNA, the infectious viral particle is not formed as it is, but the gene encoding the deleted gene or the envelope protein of another virus And the like can be separately introduced to express the infectious virus particle.
[60] Methods for introducing viral vector DNA into cells include the following methods: (1) a method of making a DNA precipitate that can be contained by a target cell, (2) a method of preparing a DNA precipitate suitable for incorporation by a target cell, A method of making a complex containing DNA, and (3) a method of instantaneously punching a hole in the target cell membrane by electric pulse enough to allow the DNA molecule to escape.
[61] As for (2), various transfection reagents can be used. Examples include DOTMA (Boehringer), Superfect (QIAGEN # 301305), DOTAP, DOPE, DOSPER (Boehringer # 1811169) and the like. (1) is a transfection method using, for example, calcium phosphate, and it has been known that DNA introduced into cells by this method is incorporated into phagosomes, but a sufficient amount of DNA also enters the nucleus (Graham , FL and Van Der Eb, J., 1973, Virology 52: 456; Wigler, M. and Silverstein, S., 1977, Cell 11: 223). Chen and Okayama reviewed the optimization of transfer technology and found that 1) the cells incubated with DNA at 2-4% CO ₂ at 35 ° C for 15-24 hours, and 2) the DNA is more active in the ring than in the linear (3) The optimum precipitation is obtained when the concentration of DNA in the precipitate mixture is 20 to 30 ㎍ / ml (Chen, C. and Okayama, H., 1987, Mol. Cell Biol. . The method of (2) is suitable for transient transfection. As the older method, a method is known in which a mixed solution of DEAE-dextran (Sigma # D-9885 MW 5 × 10 ⁵ ) is prepared at a target DNA concentration ratio and transfection is performed. Since most of the complexes are degraded in endosomes, it is also possible to add chloroquine to enhance the effect (Calos, MP, 1983, Proc Natl Acad Sci USA 80: 3015). The method of (3) is a method called electroporation, and is more versatile than the method of (1) or (2) in that it has no cell selectivity. The efficiency is said to be good under the optimum conditions of pulse current duration, pulse shape, electric field strength (gap between electrodes, voltage), conductivity of buffer, DNA concentration and cell density.
[62] Of the three categories above, the method (2) is easy to operate and allows examination of a large number of test samples using a large number of cells. Therefore, in the present invention, a transfection reagent is suitable. Suitably, Superfect Transfection Ragent (QIAGEN, Cat No. 301305) or DOSPER Liposomal Transfection Reagent (Boehringer Mannheim, Cat No. 1811169) is used.
[63] Reconstitution from cDNA can be carried out in the following manner.
[64] (MEM) containing 10% fetal bovine serum (FCS) and antibiotics (100 units / ml penicillin G and 100 μg / ml streptomycin) on plastic plates or 100 mm Petri dishes at 24- ) Was used to inoculate a cell line LLC-MK2 derived from monkey kidney to 70-80% confluent and inactivated by UV irradiation for 20 minutes in the presence of, for example, 1 ug / ml psoralen (psoralen) Recombinant vaccinia virus vTF7-3 (Fuerst, TR et al., Proc. Natl. Acad. Sci. USA 83: 8122-8126, 1986, Kato, A. et al. , Genes Cells 1: 569-579, 1996). The addition amount of psoralen and the UV irradiation time can be appropriately adjusted. After 1 hour of infection, the recombinant Sendai virus cDNA of 2 to 60 μg, more preferably 3 to 5 μg, is incubated with a recombinant Sendai virus cDNA expressing the viral protein which acts as a trans for the production of the full-length Sendai virus genome Plasmids (24-0.5 占 퐂 pGEM-N, 12-0.25 占 퐂 pGEM-P and 24-0.5 占 퐂 pGEM-L, more preferably 1 占 퐂 pGEM-N, 0.5 占 퐂 pGEM-P and 1 占 퐂 pGEM-L) (Kato, A. et al., Genes Cells 1: 569-579, 1996) with a Superfect (QIAGEN). Cells transfected were transfected with 100 / / ml of rifampicin (Sigma) and cytosine arabinoside (AraC), more preferably 40 ㎍ / ml of cytosine arabinoside AraC) (Sigma) to minimize cytotoxicity by Vaccinia virus and to maximize the recovery of virus (Kato, A. et < RTI ID = 0.0 > al., 1996, Genes Cells 1: 569-579). After transfection, the cells are cultured for 48 to 72 hours. Cells are collected and frozen and thawed three times to disrupt the cells. Then, LLC-MK2 cells expressing the envelope protein are transfected and cultured. After 3 to 7 days of culture, the culture medium is recovered. Alternatively, infectious viral vectors can be obtained more efficiently by transfecting the NP, L, P expression plasmids into LLC-MK2 cells expressing the envelope protein from the beginning, or by transposing the envelope expression plasmids together. These cells can be amplified by overlaying LLC-MK2 cells expressing the envelope protein (see Examples). The virus titers contained in the culture supernatant can be determined by measuring erythrocyte aggregation activity (HA). HA can be determined by "endo-point dilution" (Kato, A. et al., 1996, Genes Cells 1: 569-579). The resulting virus stock can be stored at -80 占 폚.
[65] The recombinant Sendai virus vector of the present invention can be made into a composition by appropriately diluting it with, for example, physiological saline or phosphate buffered saline (PBS). When the recombinant Sendai virus vector of the present invention is proliferated in an egg or the like, it is also possible to include an entero-urinary fluid. The composition containing the recombinant Sendai virus vector of the present invention may contain a physiologically acceptable medium such as deionized water and 5% dextrose solution. In addition, stabilizers, antibiotics, and the like may be contained.
[66] As long as the viral vector is reconstituted, the host cell used for reconstitution is not particularly limited. For example, in the reconstitution of Sendai virus vector, cultured cells such as CV-1 cells derived from monkey kidney, LLC-MK2 cells, and BHK cells derived from hamster kidney can be used. It is also possible to obtain infectious viral particles having the envelope protein by expressing an appropriate envelope protein in these cells. Further, in order to obtain a large amount of Sendai virus vector, for example, a virus vector obtained from the above host together with a vector expressing an envelope gene may be infected to a developing egg to amplify the vector. Alternatively, it is also possible to produce viral vectors using transgenic eggs in which envelope protein genes are incorporated. Methods for the preparation of viral vectors using eggs have already been developed (Nakanishi, et al. (Des), 1993, "Shinkei-kagaku Kenkyu-no Sentan-gizu Protocol III", Molecular Neurocyte Physiology Specifically, for example, the embryo is placed in an incubator and cultured at 37 to 38 ° C for 9 to 12 days to grow a embryo (embryo). And the viral vector is propagated by culturing the egg for several days. The conditions such as the incubation time and the like may vary depending on the recombinant Sendai virus to be used. Then, the virus (viral vector) . The isolation and purification of the Sendai virus vector from the entero-urinary fluid can be performed according to a general method (Tashiro, M., " Virus Experiment Protocols ", Nagai and Ishihama (eds.), Medicalview, pp. 68-73 (1995)).
[67] The viral vector of the present invention can be used as a vector for expressing an envelope protein. For example, when an envelope gene deficient in the genome is introduced into the same cell, two defective envelope proteins are supplied by the expression from the other one, Virus particles are formed, the replication cycle is reversed, and the virus is amplified. That is, when two or more vectors of the present invention are inoculated in a combination complementing the envelope protein, a mixture of each of the envelope-defective viral vectors can be produced in a large amount and at a low cost. Mixed viruses thus produced are also useful for vaccines and the like. In addition, as the envelope gene is defective, these viruses have a smaller genome size than viruses that do not lack an envelope gene, and can retain a long foreign gene. In addition, these viruses, which are not infectious, are diluted extracellularly to make it difficult to maintain coinfection and become sterilized.
[68] When a viral vector is prepared using a gene for treating a disease as a foreign gene, gene therapy can be performed by administering this vector. As the application of the viral vector of the present invention to gene therapy, the gene expression by direct administration or the gene expression by indirect administration (ex vivo) can be applied to a foreign gene or a patient's body It is possible to express an inherent gene or the like which is lacking in supply. The foreign gene is not particularly limited and may be a nucleic acid which does not encode a protein such as antisense or ribozyme in addition to a nucleic acid encoding a protein. Further, as a foreign gene, when a gene encoding an antigen of a bacterium or a virus related to an infectious disease is used, it is possible to induce immunity in the animal by administering it to the animal. That is, as a vaccine.
[69] When used as a vaccine, it is conceivable to apply the viral vector of the present invention to, for example, tumors, infectious diseases and other common diseases. For example, as a tumor treatment, a gene having a therapeutic effect can be expressed by using the vector of the present invention in an antigen presenting cell (APC) such as a tumor cell or DC cell. Examples of such genes include cancer antigen Muc-1 or Muc-1 mutin tandem repeat peptide (US Patent No. 5,744,144), melanoma gp100 antigen, and the like. Treatment with these genes can be widely applied, such as breast cancer, colon cancer, pancreatic cancer, prostate cancer, and lung cancer. It is also effective to combine cytokines to enhance the adjuvant effect. These genes include, for example, i) a combination of IL-2 and single-stranded IL-12 (Proc. Natl. Acad Sci. USA 96 (15): 8591-8596, 1999) (GM-CSF), iv) a combination of GM-CSF and IL-4 for the treatment of brain tumors (US Pat. No. 5,798,100), iii) granulocyte colony-stimulating factor J. Neurosurgery 90 (6), 1115-1124 (1999), and the like.
[70] In the case of influenza, for example, virulent strain H5N1 type envelope, Japanese encephalitis, for example, envelope chimera (Vaccine, vol. 17, No. 15-16, 1869- 1882 (1999)), for HIV, for example, HIV gag or SIV gag protein (J. Immunology (2000) vol. 164, 4968-4978), polyacetate-glycol copolymer microparticles In the case of cholera, for example, the B subunit (CTB) of the cholera toxin (Arakawa T, et al., Nature In rabies, for example, glycoprotein of rabies virus (Lodmell DL et al (1998) 16 (10): 934-8, Arakawa T, et al., Nature Biotechnology , 1998, Nature Medicine 4 (8): 949-52). In uterine cervical cancer, capsid pr (papilloma virus 6) of human papilloma virus 6 otein L1 (J. Med. Virol., 60, 200-204 (2000)).
[71] In addition, application to general bottles can be considered. In diabetes, for example, expression of an insulin fragment peptide has been performed in animal models of type I diabetes (Coon, B. et al., J. Clin. Invest., 1999, 104 (2): 189-94 ).
[72] Brief Description of Drawings
[73] BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a photograph showing the results of western blotting analysis in which the expression of F protein is expressed by Cre-loxP induction expression system. FIG. The result of detection of the protein on the transcriptional membrane which crosses with the anti-SeV-F antibody by chemiluminescence is shown.
[74] Fig. 2 is a diagram showing the results of analysis of display on the cell surface of F protein induced expression by Cre-loxP system. Fig. The result of flow cytometry analysis of LLC-MK2 / F7 using anti-SeV-F antibody is shown.
[75] Fig. 3 is a photograph showing the result of cleavage by trypsin of the expressed F protein by Western blotting. Fig.
[76] Fig. 4 is a photograph showing the results of confirming the expression of HN on the cell surface by adsorption experiments of erythrocytes on the cell surface. Fig.
[77] 5 is a photograph showing the result of attempting to recover deletion viruses using deletion protein-expressing cells. It was found that the expression of F protein from the helper cell line was rapidly stopped by the vaccinia virus used at the time of rebuilding the F deficient SeV.
[78] 1. LLC-MK2 and CV-1 refer to the cell lysate of each cell line only.
[79] 2. LLC-MK2 / F + ad and CV-1 / F + ad refer to each inducible cell lysate supplemented with the adenovirus AxCANCre.
[80] 3. LLC-MK2 / F-ad and CV-1 / F-ad refer to cell lysates from each F gene transfected without the adenovirus AxCANCre.
[81] 4. LLC-MK2 / F + ad 3rd refers to the lysate of cells that have been induced to express adenovirus AxCANCre three times.
[82] 5. 1d and 3d indicate 1 day and 3 days after induction, respectively.
[83] 6. Vac1d and Vac3d refer to cells 1 and 3 days after infection with vaccinia virus, respectively.
[84] 7. AraC1d and AraC3d refer to cells that were added 1 day and 3 days, respectively, with AraC.
[85] 8. CHX 1d and CHX 3d refer to cells that are 1 and 3 days old with the addition of the protein synthesis inhibitor cycloheximide, respectively.
[86] FIG. 6 is a photograph showing the results of observation of expression of GFP (detection of RNP) by transfecting F-non-expressing LLC-MK2 cells with GFP-introduced F-deficient SeV cDNA (pSeV18 ⁺ /ΔF-GFP). As a control, SeV cDNA (F shuffle SeV) in which F gene was shuffled at the 3 'end of NP gene and GFP was introduced in F deletion region was used. &Quot; all " indicates that the plasmids expressing NP, P, and L genes (pGEM / NP, pGEM / P and pGEM / L) were transfected simultaneously in addition to the SeV cDNA. & Quot ^; cDNA " indicates transfection of only cDNA (pSeV18 ⁺ / DELTA F-GFP). RNP transfection was performed by recovering P0 cells expressing GFP, suspending (10 ⁷ cells / ml) in OptiMEM (GIBCO BRL), lyophilizing 100 μl of the lyse which was repeated three times by freezing and thawing, using cationic liposome DOSPER (Boehringer Mannheim ), Allowed to stand at room temperature for 15 minutes, and then added to F-expressing cells (+ ad) to carry out RNP transfection. As a control for the cells, recombinant adenovirus-free (-ad) cells expressing Cre DNA recombinase were used. As a result, in LLC-MK2 cells of P0, GFP was found to be expressed dependent on the formation of SeV virus RNP, and in P1, it was found that F-defective virus was amplified depending on F induction expression.
[87] Fig. 7 is a photograph showing the result of investigating whether functional RNP reconstructed from F-deficient genomic cDNA can be rescued into F-expressing helper cells to form deletion virus virions having infectivity. RNP / o refers to cells overlaying RNP, and RNP / t refers to cells transfected with RNP.
[88] 8 is a photograph showing the result of confirming that the F-deficient virus was specifically amplified in F-expressing cells. The lysate containing the functional RNP constructed from the gene deletion type genome was lipofected into the F-expressing cells described in Example 2, and the culture supernatant was recovered. The culture supernatant was added to the culture medium for F-expressing cells and infected. The culture supernatant recovered on the third day was simultaneously added to F-expressing cells and F-non-expressing cells and cultured for 3 days in the presence and absence of trypsin. The results are shown. In F-expressing cells, the virus was amplified only in the presence of trypsin.
[89] FIG. 9 is a photograph showing the result of confirming that the F-deficient virus was specifically released into the culture supernatant when it was introduced into the F-expressing cell. The lysate containing the functional RNP constructed from the genetically deleted genome was subjected to lipofection on the F-expressing cells described in Example 2, and the culture supernatant was recovered. The culture supernatant was added to the culture medium for F-expressing cells and infected. The culture supernatant recovered on the third day was simultaneously added to F-expressing cells and F-non-expressing cells and cultured for 3 days in the presence and absence of trypsin. And the bottom shows the results in the case of the supernatant of F-non-expressing cells.
[90] Fig. 10 is a graph showing the results of the detection of viruses in the culture medium of F-expressing cells, extracting total RNA, and using F and HN as probes to confirm the genomic structure of virions recovered from F- A photograph showing the results of a nothern blot analysis. The HN gene was detected in the virus recovered from the F-expressing cells, but the F gene was not detected and it became clear that the F gene was not present in the viral genome.
[91] 11 is a photograph showing the result of RT-PCR showing that the GFP gene is present at the deletion site of the same F as in the construction of the cDNA. 1: + 18-NP, +18 Not I Confirmation of existence of site. 2: Identification of the presence of M-GFP, GFP gene in F-deficient region. 3: Identification of the presence of F gene and F gene. Genome structure of wild-type SeV and F-deficient GFP expression SeV was shown above. It was confirmed that the GFP gene was present in the F-deficient region and the NotI site derived from +18 at the 3'-end of NP, so that the F gene was not present anywhere in the RNA genome.
[92] FIG. 12 is a photograph showing the results of immunoelectron microscopy using gold colloid-bound IgG (antiF, antiHN) specifically reacting with F and HN of viruses. The spike-like structure of the envelope of the virus has become apparent from proteins of F and HN.
[93] 13 is a diagram showing the results of RT-PCR in which the structure of a gene other than the GFP gene is confirmed to be the same as that of the wild type.
[94] 14 is a photograph showing the result of examination of the form of the F-deleted viral particle by an electron microscope. The F-defective virus particles had a helical RNP structure and a spike-like structure inside the virus as the wild-type virus.
[95] 15 is a photograph showing the results of high-efficiency gene introduction into various cells in vitro by F-defective SeV vectors.
[96] 16 is a diagram showing the results of analysis of introduction of a F-defective SeV vector into mouse primary bone marrow cells (BM c-kit +/-). White bars indicate PE positive / GFP negative, and black bars indicate PE positive / GFP positive.
[97] 17 is a photograph showing the results of in vivo administration of a vector into a rat ventricle.
[98] FIG. 18 shows that the culture supernatant containing F-deficient SeV virus recovered from F-expressing cells was infected with F-non-expressing LLC-MK2 cells and cultured for 3 days in the presence or absence of trypsin to detect the presence of viruses assay. < / RTI >
[99] Fig. 19 is a photograph showing the result of HA assay of the prolonged urine fluid 2 days after the re-inoculation of the prolonged urine (lane 11 and lane 12) in the developing egg in the developing egg in the developing egg in the developing egg in Fig. 18B.
[100] FIG. 20 is a photograph showing the result of irradiation of virus-free and infectious virus solution with an immunoelectron microscope. The presence of virus particles was confirmed, and the virion envelope reacted with antibodies recognizing HN protein labeled with gold colloid, but not with antibodies recognizing F colloid labeled F protein.
[101] 21 is a photograph showing the results of transfection of F-deficient virus particles into cells.
[102] Fig. 22 is a photograph showing the result of examination of the composition of F, HN co-expressing cells by Western blotting. LLC / VacT7 / pGEM / FHN is a cell transfected with pGEM / FHN plasmid after infection with vaccinia in LLC-MK2 cells. LLC / VacT7 is a vaccinia infected LLC-MK2 cell. LLCMK2 / FHNmix is an LLC-MK2 cell into which the F, HN gene has been introduced. The LLC / FHN was obtained by introducing the F, HN gene into LLC-MK2 cells and inducing expression of the adenovirus (after 3 days), 1-13, 2-6, 2-16, 3-3, 3-18, 3-22, 4-3, 5-9 indicate the number (name) of the cell line when cloned.
[103] 23 is a photograph showing the result of confirming the formation of virus due to the difference in the presence or absence of addition of pGEM / FHN. FHN-deficient GFP expression SeV cDNA, pGEM / NP, pGEM / P, pGEM / L and pGEM / FHN were mixed and transfected into LLC-MK2 cells. After 3 hours of transfection, the medium was replaced with a medium containing AraC and trypsin, and further cultured for 3 days. On the second day after the gene introduction, the cells were observed with a stereoscopic fluorescence microscope, and the difference in the presence or absence of pGEM / FHN was examined, and the formation of virus was confirmed by the diffusion of GFP-expressing cells. The results are shown. When pGEM / FHN was added at the reconstitution, diffusion of GFP - expressing cells was observed. When pGEM / FHN was not added, GFP expression was observed only in single cells.
[104] 24 is a photograph showing reconstruction and amplification of F, HN defective virus by RNP transfection. P0 RNP was lipofectioned on FHN coexpressing cells (12 wells) 3 days after induction of expression using middle layer or DOSPER, and GFP was observed after 4 days. In the case of RNP transfection, the virus was successfully recovered from the FHN expressing cells of P1 (above) as in the case of F deficiency. We confirmed that FHN-infected cells infected with Ade / Cre-infected cells could be amplified after 6 hours (see below).
[105] 25 shows the results of culturing the virus solution reconstituted from cDNA expressing FHN-deficient GFP into LLC-MK2, LLC-MK2 / F, LLC-MK2 / HN and LLC-MK2 / FHN, FIG. After 3 days of culture, diffusion of GFP protein-expressing cells was confirmed. The results are shown. GFP spread was observed only in LLC-MK2 / FHN, and it was confirmed that this virus solution was specific for FHN coexpression and also amplified in trypsin-dependent manner.
[106] 26 is a photograph showing the results of confirming the genomic structure of RNA from the culture supernatant of FHN expressing cells.
[107] FIG. 27 is a photograph showing the result of confirming the genomic structure of RNA from the culture supernatant of F-expressing cells infected with the FHN deficient virus. FIG.
[108] 28 is a diagram showing inactivation of Vaccinia virus and T7 activity when the concentration of psoralen is changed in psoralen / UV irradiation.
[109] 29 is a diagram showing the inactivation of Vaccinia virus and T7 RNA polymerase activity when UV irradiation time in psoralen · UV irradiation is changed.
[110] 30 is a photograph showing cytotoxicity (CPE) of psoralen UV-irradiated vaccinia virus. 3 x 10 < ⁵ > LLC-MK2 cells were plated in 6 well plates. Cells were cultured overnight, and infected with vaccinia virus at moi = 2. After 24 hours, the CPE was measured. CPE by vaccination with vaccinia virus was shown in B, C and D by vaccinia virus treated with A, 15, 20 and 30 minutes, respectively.
[111] 31 is a graph showing the effect of the UV treatment time of Vaccinia virus on the Sendai virus reconstitution efficiency.
[112] 32 is a diagram showing the potency of a replicable vaccinia virus remaining in the cells used for the Sendai virus reconstitution experiment.
[113] 33 is a photograph showing the results of analysis of Western blotting by anti-VSV-G antibody.
[114] 34 is a diagram showing an analysis result of a flow cytometry using an anti-VSV-G antibody. The results of the analysis of LLC-MK2 VSV-G inducible expression L1 (moi = 0, 2.5, 5) on the fourth day of AxCANCre infection are shown. Anti-VSV-G antibody (MoAb I-1) was used as the primary antibody and anti-mouse Ig labeled with FITC as the secondary antibody.
[115] FIG. 35 is a diagram showing the results obtained by changing the infectious amounts (MOI = 0, 1.25, 2.5, 5, 10) of AxCANCre and recovering the supernatant after infection with a pseudotype Sendai virus having a genome in which a certain amount of F gene has been deleted, (-) and (+) cells before and after VSV-G induction and observing cells expressing GFP on day 5.
[116] Fig. 36 is a photograph showing the result of examining the virus production amount over time.
[117] FIG. 37 is a photograph showing the results of investigating whether the pseudotyped Sendai virus and the FHN-deficient Sendai virus having genomes lacking the F gene obtained by using the VSV-G expression strain were treated with an anti-VSV antibody to be infected.
[118] 38 is a graph showing the expression of the GFP gene in the presence of the VSV-G gene expressing cells LLCG-L1 by infecting the F, HN deletion type Sendai virus containing the GFP gene and showing the production of pseudotype virus having the VSV- As a result of the survey.
[119] 39 is a photograph showing the result of investigation of the viruses grown in the VSV-G gene expressing cells by the Western analysis of the proteins of the infected cell extracts, showing that the viruses were F and HN deletion types.
[120] 40 is a photograph showing the result of observing GFP-expressing cells under a fluorescence microscope.
[121] Fig. 41 is a diagram showing an improvement in the reconstitution efficiency of SeV / F-GFP by combination of an envelope expression plasmid and an intercellular layer. Significant improvement was recognized in d3 to d4 (from the third day to the fourth day) of P0 (before transfer).
[122] Fig. 42 is a diagram showing the result of reviewing the conditions for reconstituting SeV / F-GFP by combination of an envelope expression plasmid and an intercellular layer. Fig. GFP-positive cells represent the amount of reconstituted virus.
[123] Fig. 43 is a diagram showing the result of examining rescue of F-deficient Sendai virus from cDNA. Fig. Showing improvement of recombination efficiency of SeV / DELTA F-GFP by combination of an envelope expression plasmid and an intercellular layer. On the seventh day, all the challenges were positive, but attention was focused on the third day, in which the probability of success was intermediate, and the efficiency was examined.
[124] 44 is a photograph showing the expression of lacZ of the LacZ-bearing F-deleted Sendai virus vector containing no GFP.
[125] 45 is a diagram showing the subcloning (A) of the Senda virus genome cDNA fragment and the structure (B) of the five kinds of Sendai virus genome cDNA constructed by newly introducing the NotI site.
[126] 46 is a diagram showing the structure of a plasmid for cloning for adding a NotI site, a transcription initiation signal, an intervening sequence, and a transcription termination signal to SEAP.
[127] 47 is a photograph showing the results of a plaque-assay of each Sendai virus vector. Shows a part of a fluorescence image of a plaque assay obtained by LAS1000.
[128] 48 is a diagram showing the results of comparing differences in the expression levels of reporter genes (SEAP) between respective Sendai virus vectors. Data of SeV18 + / SEAP was taken as 100, and relative values were shown. It was found that the activity, that is, the expression level, of the SEAP gene was decreased as the SEAP gene was located downstream.
[129] 49 is a photomicrograph showing GFP expression in P1 FHN coexpressing cells.
[130] 50 is a graph showing the results of an experiment using an extract of VSV-G pseudo-type SeV / F: GFP infected cells using anti-F antibody, anti-HN antibody and anti- SeV antibody And the results of Western blotting analysis are shown.
[131] 51 is a photograph showing the fluorescence of GFP in cells infected with VSV-G pseudo-type SeV deficient in F and HN in the presence or in the absence of a neutralizing antibody (VGV antibody).
[132] 52 is a photograph showing the results of Western analysis of VSV-G pseudotyped Sendai virus having a genome in which the F gene or the F, HN gene was deleted by the density gradient ultracentrifugation method.
[133] 53 is a photograph showing the erythrocyte aggregation reaction by the Sendai virus having the genome in which the F gene is deleted or the VSV-G pseudotyped Sendai virus having the genome in which the F gene or F, HN gene is deleted.
[134] 54 shows infection specificity of cultured cells with Sendai virus or VSV-G pseudotyped Sendai virus having genome deficient in F gene.
[135] 55 is a photograph showing the structure confirmation of the F-deleted type Sendai virus (NGF / SeV / F) carrying NGF expression.
[136] 56 is a graph showing the activity of NGF expressed from NGF-loaded F-deficient SeV infected cells. At the initiation of culture, the culture supernatant diluted with SeV-infected cells or NGF protein as a control group was added to the primary neuronal cell culture system of the posterior ganglion of the chicken, and viable cells were quantified with mitochondrial reducing activity as an indicator after 3 days ( n = 3). The culture supernatant was added in an amount equivalent to 1/1000 dilution.
[137] 57 is a photograph showing the activity of NGF expressed from NGF-loaded F-deficient SeV infected cells. At the initiation of culture, NGF protein as a culture supernatant diluted solution of SeV infected cells or as a control group was added to the primary neuronal cell culture system of the posterior ganglion of chicken, and after 3 days, it was observed under a microscope.
[138] A) Control (no NGF added),
[139] B) Addition of 10 ng / mL of NGF protein,
[140] C) NGF / SeV infected cell culture supernatant 1/100 dilution added,
[141] D) NGF / SeV infected cell culture supernatant 1/100 dilution added,
[142] E) NGF / SeV / △ F infected cell culture supernatant was diluted 1/100,
[143] F) Culture of cells infected with NGF / SeV / ΔF-GFP Supernatant diluted 1/100
[144] FIG. 58 is a photograph showing the expression of moi and F protein of Ad-Cre. FIG.
[145] FIG. 59 is a photograph showing the expression of LLC-MK2 / F by Adeno-Cre. FIG.
[146] Fig. 60 is a photograph showing the continuity of expression by passage. Fig.
[147] 61 is a photograph showing the localization of F protein by the passage.
[148] FIG. 62 is a diagram showing the correlation between GFP-CIU and anti-SeV-CIU. FIG.
[149] BEST MODE FOR CARRYING OUT THE INVENTION
[150] Hereinafter, the present invention will be described in detail by way of examples, but the present invention is not limited to these examples.
[151] [Example 1] Construction of F-deleted Sendai virus
[152] <1> Construction of F-deficient SeV genome cDNA and F expression plasmid
[153] Sendai virus (SeV) genomic full-length ^{cDNA, pSeV18 + b (+)} (Hasan, MK et al, 1997, J. General Virology 78:. 2813-2820) ( "pSeV18 ⁺ b ^(+)" means "pSeV18 ^+" ) Was digested with SphI / KpnI and the fragment (14673 bp) was recovered and cloned into pUC18 called plasmid pUC18 / KS. Construction of the F-deficient site was performed on this pUC18 / KS. The deletion of the F gene was performed by a combination of PCR-ligation methods. As a result, the ORF (ATG-TGA = 1698 bp) of the F gene was removed and ligated with atgcatgccggcagatga (SEQ ID NO: Deletion type SeV genomic cDNA (pSeV18 ⁺ / DELTA F) was constructed. The PCR was carried out at the upstream of F (forward: 5'-gttgagtactgcaagagc / SEQ ID NO: 2, reverse: 5'-tttgccggcatgcatgtttcccaaggggagagttttgcaacc / SEQ ID NO: , reverse: 5'-tgggtgaatgagagaatcagc / SEQ ID NO: 5) was ligated with EcoT22I. The thus obtained plasmid was digested with SacI and SalI, and a fragment (4931 bp) of the region containing the F-deficient region was recovered and cloned into pUC18 to obtain pUC18 / dFSS. This pUC18 / dFSS was digested with DraIII, and the fragment was recovered and replaced with the DraIII fragment in the region containing the F gene of pSeV18 ⁺ , followed by ligation to obtain plasmid pSeV18 ⁺ /ΔF.
[154] Further, in order to construct a cDNA (pSeV18 ⁺ / F-GFP) carrying the EGFP gene at the F deletion region, the EGFP gene was amplified by PCR. 5 'is an NsiI-tailed primer (5'-atgcatatggtgatgcggttttggcagtac SEQ ID NO: 6), 3' is NgoMIV (SEQ ID NO: 6) to match the EGFP gene to a multiple of 6 (Hausmann, S. et al., RNA 2, 1033-1045 -tailed primer (5'-Tgccggattattacttgtacagctcgtc SEQ ID NO: 7). The PCR products were digested with restriction enzymes NsiI and NgoMIV and the fragments were recovered from the gels and ligated to restriction sites NsiI and NgoMIV at the F deletion sites of pUC18 / dFSS to confirm the sequence. From this, the DraIII fragment containing the EGFP gene was recovered, replaced with the DraIII fragment of the region containing the F gene of pSeV18 ⁺ , and ligated to obtain the plasmid pSeV18 ⁺ /ΔF-GFP.
[155] On the other hand, construction of a Cre / loxP-inducible expression plasmid expressing the F gene is performed by amplifying the SeV F gene by PCR, confirming the sequence, and then allowing the gene product to be induced by the Cre DNA recombinase Was inserted into the unique site SwaI site of the designed plasmid pCALNdlw (Arai et al. J. Virology 72, 1998, p1115-1121) to obtain the plasmid pCALNdLw / F.
[156] <2> Production of helper cells inducing SeV-F protein induction
[157] In order to recover the infectious viral particles from the F-deficient genome, a helper cell line expressing SeV-F protein was established. The cells used were the monkey kidney-derived cell lines, LLC-MK2 cells, which are frequently used for SeV proliferation. LLC-MK2 cells were incubated with MEM supplemented with 10% heat-treated fetal bovine serum (FBS), 50 units / ml penicillin G sodium and 50 ug / ml streptomycin at 37 ° C and 5% CO ₂ . Since the SeV-F gene product has cytotoxicity, the plasmid pCALNdLw / F, which is designed to induce expression of the F gene product by Cre DNA recombinase, is introduced into the calcium phosphate method (mammalian transfection kit (Stratagene)) , The gene was introduced into LLC-MK2 cells according to the protocol.
[158] 10 占 퐂 plasmid pCALNdLw / F was introduced into LLC-MK2 cells grown to 40% confluency using a 10 cm plate, and the cells were cultured in MEM medium containing 10 ml of 10% FBS at 37 占 폚 in 5% CO _{2 &lt; /} RTI &gt; incubator for 24 hours. After 24 hours, the cells were detached and suspended in 10 ml of medium. Five 10-cm chalks were used to sprinkle one 5 ml, two 2 ml, and two 0.2 ml fractions into a G418 (GIBCO-BRL) Was cultured in MEM medium containing 10 ml of 10% FBS containing 1200 占 퐂 / ml and cultured for 14 days while changing the medium every two days to select the gene stability. Cells resistant to G418 grown by the medium were harvested for 30 weeks using a cloning ring. Each clone continued to expand until it became a confluent on a 10 cm plate.
[159] After infection with the recombinant adenovirus AxCANCre expressing Cre DNA recombinase for each clone, the SeV-F protein monoclonal IgG (f236, J. Biochem. 123: 1064-1072) Expression was examined by Western blotting as follows.
[160] Each clone was grown in a 6 cm chalet to confluent and then the adenovirus AxCANCre was grown by the method of Saito et al., Nucl. Acids Res. 23: 3816-3821 (1995); Arai, T. et al. , J Virol 72, 1115-1121 (1998)), and then cultured for 3 days. After removing the culture supernatant, the cells were washed twice with PBS buffer, the cells were removed with a scraper, centrifuged at 1500 x g for 5 minutes, and the cells were collected.
[161] The cells can be stored at -80 ° C and thawed if necessary. The collected cells were suspended in 150 μl of PBS buffer and then diluted with an equal volume of 2 × Tris-SDS-BME sample loading buffer (0.625 M Tris, pH 6.8, 5% SDS, 25% 2-ME, 50% glycerol, 0.025% Ltd.) was added and heated at 98 占 폚 for 3 minutes and used for electrophoresis. The sample (1 × 10 ⁵ cells per 1 lane) was fractionated by electrophoresis using SDS-polyacrylamide gel (Multigel 10/20, manufactured by Daiichi Kagaku), and the fractionated Proteins were transferred to a PVDF transfer membrane (Immobilon-P transfer membranes, Millipore) by semi-dry blotting. The transfer was carried out for 1 hour under the condition of 1 mA / cm ² constant current using a transfer film immersed in 100% methanol for 30 seconds and water for 30 minutes.
[162] The transcription membrane was shaken for 1 hour in Block Ace (Snow Brand Milk Products) supplemented with 0.05% Tween 20 and 1% BSA, followed by incubation with anti SeV antibody diluted 1/1000 with a blocking solution containing 0.05% Tween 20 and 1% BSA -F antibody (f236) at room temperature for 2 hours. The transferred membrane was washed three times with 20 ml of PBS-0.1% Tween 20 for 5 minutes, shaken for 5 minutes with PBS buffer, and washed. 10 ml of an anti-mouse IgG antibody (Goat anti-mouse IgG, manufactured by Zymed) labeled with peroxidase diluted 1/2000 with a blocking solution containing 0.05% Tween 20 and 1% BSA was added to the transcription membrane at room temperature for 1 hour Lt; / RTI &gt; The transcription membrane was washed 3 times with 20 ml of PBS-0.1% Tween 20 for 5 minutes, then washed with PBS buffer for 5 minutes.
[163] The protein on the transcriptional membrane, which crosses with the anti-SeV-F antibody, was detected by a chemiluminescence method (ECL western blotting detection reagents, Amersham). The results are shown in Fig. Expression of AxCANCre-specific SeV-F was detected and it was confirmed that LLC-MK2 cells inducing expression of the SeV-F gene product were obtained.
[164] One of the obtained cell lines, LLC-MK2 / F7 cells, was subjected to flow cytometry analysis using an anti-SeV-F antibody (Fig. 2). That is, 1 × 10 ⁵ cells were centrifuged at 15,000 rpm at 4 ° C. for 5 minutes to precipitate, washed with 200 μl of PBS, and incubated with anti-F monoclonal antibody (f236), 0.05% sodium azide sodium azide) and 2% FCS in PBS (NIKKEN CHEMICALS) for 1 hour at 4 ° C. The mixture was centrifuged at 15,000 rpm at 4 ° C for 5 minutes to obtain a precipitate, washed with 200 μl of PBS, and reacted with 1 μg / ml of FITC labeled anti-mouse IgG (CAPPEL) for 30 minutes on ice, , And centrifuged at 15,000 rpm at 4 DEG C for 5 minutes to obtain a precipitate by centrifugation and suspended in 1 ml of PBS for FACS. Using an EPICS ELITE (Clulter) argon laser, the excitation wavelength was 488 nm and the fluorescence wavelength was 525 nm. As a result, in LLC-MK2 / F7, high reactivity with the antibody was specifically detected upon expression of SeV-F gene induction, and it was confirmed that SeV-F protein was expressed on the cell surface.
[165] [Example 2] Identification of function of SeV-F protein expressed in helper cells
[166] The SeV-F protein induced in helper cells was examined for the maintenance of conventional protein function.
[167] LLC-MK2 / F7 cells were plated in a 6 cm chalet and grown to confluent. After adenovirus AxCANCre was infected with moi = 3 by the method of Saito et al., Trypsin (7.5 g / ml, GIBCOBRL) For 3 days in a 37 ° C 5% CO ₂ incubator.
[168] After removing the supernatant of the culture, the cells were washed twice with PBS buffer, the cells were removed with a scraper, centrifuged at 1500 x g for 5 minutes, and cells were collected. Cleavage by trypsin of the F protein expressed by the above-mentioned Western blotting method was confirmed (Fig. 3). The SeV-F protein is synthesized as an inactive precursor protein, F0, and is cleaved and activated by two subunits, F1 and F2, by proteolytic action of trypsin. Thus, LLC-MK2 / F7 cells induced by F-protein induction continue to express F protein even when they pass through the same cells as normal cells, and cytotoxicity due to the expressed F-protein is not observed, Cell fusion was not observed. However, when the F-expressing cells were transfected with SeV-HN expression plasmid (pCAG / SeV-HN) and cultured in MEM containing trypsin for 3 days, fusion between cells was observed. The expression of HN on the cell surface was confirmed by the hematoadsorption assay (Had assey) of red blood cells (Fig. 4). Namely, 1 ml of chicken erythrocytes was added to the cultured cells, and the cells were allowed to stand at 4 ° C for 10 minutes. Cells were washed three times with PBS buffer to detect erythrocyte colonies on the cell surface. Cell fusion was observed in the aggregated cells of red blood cells, and it was found that F protein interacted with HN to cause cell fusion, and that the F protein continuously expressed in LLC-MK2 / F7 maintained the conventional function .
[169] [Example 3] Formation of functional RNP and virion with F deletion genome
[170] In order to recover virions from deletion viruses, it is necessary to use deletion protein expressing cells. However, when the deletion-type virus was recovered using the deletion protein-expressing cells, the expression of the F protein from the helper cell line was quickly stopped by the vaccinia virus used at the time of rebuilding the F-deficient SeV (FIG. 5) , The virus was not successfully reconstituted by supplying the F protein directly from the helper cell line. It has been reported that the treatment with long-wave UV (long-wave UV) treatment (PLWUV treatment) by the addition of psoralen to vaccinia virus inactivates the replication ability of vaccinia virus and does not impair T7 expression activity (Tsung et al., J Virol 70, 165-171, 1996). Therefore, an attempt was made to reconstruct the virus using the PLWUV-treated Vaccinia virus (PLWUV-VacT7). The ultraviolet irradiation apparatus was a UVStratakinker 2400 (Cat. No. 400676 (100 V), Stratagene, La Jolla, CA, USA) equipped with five 15-watt bulbs. As a result, although the expression of F protein was inhibited from the F-expressing cells used for reconstitution, even when the lysate of cells reconstructed with PLWUV-VacT7 was infected with helper cells, Vaccinia hardly proliferated in the presence of araC, And it has little effect on F protein expression from the cell line. Furthermore, in the reconstruction of the recombinant wild-type SeV using the PLWUV-VacT7, viruses could be recovered from 10 ³ cells even when viruses were not collected without cells having 10 ⁵ or more in the past, Improved. Using this method, an attempt was made to rebuild the F-deficient SeV virus.
[171] <Rebuilding and amplification of F-defective SeV virus>
[172] The expression of GFP was observed by transfecting the pSeV18 ⁺ / DELTA F-GFP obtained by introducing enhanced green fluorescent protein (EGFP) gene as a reporter into the LLC-MK2 cell as described below. At this time, the influence of the presence or absence of three virus-derived genes NP, P, and L, which are components necessary for RNP formation, was also examined.
[173] LLC-MK2 cells were plated on a 100 mm Petri dish at 5 × 10 ⁶ cells / dish, cultured for 24 hours, treated with psoralen and long wavelength ultraviolet light (365 nm) for 20 minutes to obtain recombinant T7 RNA polymerase (Moi = 2) (moi = 2 to 3, preferably 1 to 3) at room temperature for 1 hour at room temperature Moi = 2 is used). After the cells were washed three times, plasmids pSeV18 ⁺ /ΔF-GFP, pGEM / NP, pGEM / P and pGEM / L (Kato, A. et al., Genes cells 1 and 569-579 (1 μg DNA / 5 μl of SuperFect, QIAGEN) was added to each well, and the mixture was allowed to stand at room temperature for 10 minutes. Then, Finally, the cells were added to 3 ml of OptiMEM containing 3% FBS, and the cells were added to the cells and cultured. (Kato, A. et al., Genes cells 1, 569-579 (1996)) as a control in place of pSeV18 ⁺ / F-GFP. After incubation for 3 hours, the cells were washed twice with serum-free MEM and incubated with 40 ㎍ / ml cytosine 棺 -D-arabinohuranoside (AraC, Sigma), 7.5 ㎍ / ml &lt; / RTI &gt; (GIBCO) for 70 hours. These cells were recovered and the pellet was suspended in OptiMEM (10 ⁷ cells / ml). Repeating freezing and thawing 3 times to lipofection reagent DOSPER (Boehringer mannheim) and mixed with ^{(10 6 cells / 25 ㎕ DOSPER} ) was allowed to stand at room temperature for 15 minutes, transfected to F expressing LLC-MK2 / F7 cell line (10 ⁶ cells / well in 12-well plate) and cultured in serum-free MEM (containing 40 / / ml AraC, 7.5 / / ml trypsin).
[174] As a result, the expression of GFP was recognized only when all three components of the virus, NP, P and L, were found, and it was found that a deletion virus RNP expressing a foreign gene can be formed (Fig. 6).
[175] <Confirmation of F-deletion type virion>
[176] The functional RNP reconstructed from the F-deficient genomic cDNA as described above was rescaled with F-expressing helper cells to investigate whether it could form deletion virus virions having infectivity. Conditions that form a functional RNP, as described above ^{(pSeV18 + / △ F-GFP} , pGEM / NP, pGEM / P , and pGEM / L at the same time trans defective condition that) and not forming conditions (pSeV18 ⁺ / △ F-GFP , and pGEM / NP), the lysate obtained by freezing / thawing the cells was subjected to lipofection with F-expressing cells and non-expressing cells by mixing with a cationic liposome, The formation of viral particles was observed by the diffusion of GFP-expressing cells. As a result, diffusion of GFP-expressing cells was observed only when the functional RNP was introduced into the F-expressing cells using the ligature under the reconstructed condition (FIG. 7). Also, in the plaque assay, formation of plaques was observed under the same conditions. From these results, it was revealed that functional RNPs formed from the F-deficient viral genome were further formed as infectious viral particles in the presence of the F protein derived from the F-expressing cells and released out of the cells.
[177] The presence of the infectious F deletion type virion in the stomach audiences was demonstrated by the following experiments. The lysate containing the functional RNP constructed from the F gene deletion type genome was subjected to lipofection on the F-expressing cells described in Example 2, and the culture supernatant was recovered. The culture supernatant was added to the culture medium for F-expressing cells and infected. The culture supernatant recovered on the third day was simultaneously added to F-expressing cells and F-non-expressing cells and cultured for 3 days in the presence and absence of trypsin. In the F-expressing cells, the virus was amplified only in the presence of trypsin (Fig. 8). It was evident that virus particles not infectious were released from F-expressing cells cultured in the absence of trypsin in the supernatant of the F-non-expressing cells (bottom of FIG. 9). Taken together, it became apparent that the F-deficient GFP-expressing virus was specific to F-expressing cells and amplified dependent on trypsin cleavage. The inverted version of the infectious F-deficient Sendai virus thus amplified ranged from 0.5 × 10 ^{7 to} 1 × 10 ⁷ CIU / ml.
[178] [Example 4] Analysis of virus expressing F-deficient GFP
[179] To confirm the genomic structure of the virion recovered from the F-deleted cDNA, the virus in the seed of the F-expressing cells of the F-expressing cells was recovered, total RNA was extracted, and northern blotting analysis was performed using F and HN as probes. As a result, the virus recovered from the F-expressing cells was detected as the HN gene, but the F-gene was not detected and it became clear that the F-gene was not present in the viral genome (FIG. 10). Furthermore, it was confirmed by RT-PCR that the gene of GFP was present at the deletion site of the same F as in the construction of the cDNA (Fig. 11), and the structure of the other gene was the same as the wild type. From the above, it can be seen that the genome has not been reorganized during virus reconstitution. The recovered F virus virus particles were examined by electron microscope for their morphology. The F-defective virus particles had spiral RNP structure and spike-like structure inside as well as wild-type virus (Fig. 14). Furthermore, when examined by immunoelectron microscopy using gold colloid-conjugated IgG (antiF, antiHN) that specifically reacts with F and HN of the virus, it has become clear that the spike quantity structure of the virus envelope is composed of proteins of F and HN 12), it was found that the F protein produced by helper cells was efficiently incorporated into this virion. It will be described in detail below.
[180] <Extraction of total RNA, Northern blotting analysis and RT-PCR>
[181] F-expressing cells LLC-MK2 / F7, and the total RNA was extracted according to the protocol using the QIAamp Viral RNA mini kit (QIAGEN) from the culture supernatant on the third day. The purified total RNA (5 μg) was separated by centrifugation on a 1% denaturing agarose gel containing formaldehyde, and then purified by Hybond-N + using a vacuum blotting device (Amersham Pharmacia) I transferred to Membrane. The prepared membrane was fixed with 0.05 M NaOH, rinsed with SSC buffer (Nacalai tesque) diluted twice, and prehybridization was performed for 30 minutes with hybridization (Boehringer Mannheim). A probe of F or HN gene prepared by random prime DNA labeling (DIG DNA Labeling Kit, Boehringer Mannheim) using digoxigenin (DIG) -dUTP (alkali susceptible) Hybridize. The membrane was then washed, reacted with alkaline phosphatase labeled anti-digoxigenin-AP and analyzed using a DIG ditection kit. As a result, the virus recovered from the F-expressing cells was detected as the HN gene, but the F-gene was not detected and it became clear that the F-gene was not present in the viral genome (FIG. 10).
[182] Furthermore, detailed analysis was performed by RT-PCR. For the RT-PCR, first strand cDNA was synthesized using the SUPERSCRIPTII Preamplification System (Gibco BRL) according to the protocol, and PCR was performed using the LA PCR kit (TAKARA ver2.1) under the following conditions I did. After 30 cycles of 94 ° C / 45 sec, 55 ° C / 45 sec, and 72 ° C / 90 sec, amplification was carried out at 72 ° C for 10 min, followed by washing with 2% agarose gel at 100 v / After electrophoresis for 30 minutes, ethidium bromide was stained and photographed. The primers used for identification of the EGFP inserted into the M gene and the F deletion region were forward 1: 5'-atcagagacctgcgacaatgc (SEQ ID NO: 8), reverse 1: 5'-aagtcgtgctgcttcatgtgg (SEQ ID NO: The primers used for identification of EGFP and HN genes were forward 2: 5'-acaaccactacctgagcacccagtc (SEQ ID NO: 10), reverse 2: 5'-gcctaacacatcagagatcg (SEQ ID NO: 5'-acattcatgagtcagctcgc (SEQ ID NO: 12) and reverse2 primer (SEQ ID NO: 11). As a result, it was confirmed that the GFP gene was present at the deletion site of the same F as in the construction of the cDNA (Fig. 11), and the structure of the other gene was the same as the wild type (Fig. From the above, it is revealed that the genome is not regrouping during virus reconstitution.
[183] <Analysis of Gold Colloid Immunoassay Electron Microscope>
[184] The recovered F virus virus particles were examined by an electron microscope for their morphology. First, the supernatant of the defective virus-infected cells was centrifuged at 28,000 rpm for 30 minutes to pellet the virus, resuspended in 10-fold diluted PBS to 1 × 10 ⁹ HAU / ml, Was dropped onto a microgrid having a support membrane attached thereto and dried at room temperature. Treated with PBS containing 3.7% formalin for 15 minutes, pretreated with a PBS solution containing 0.1% BSA for 30 minutes, and further treated with the same solution as anti-F monoclonal antibody (f236) or anti-HN monoclonal antibody Clone antibody (Miura, N. et al., Exp. Cell Res. (1982) 141: 409-420) was added dropwise and reacted for 60 minutes in a humidified state. Thereafter, the grit was washed with PBS, and 200-fold diluted gold-colloid labeled anti-mouse IgG antibody was added thereto, followed by reaction for 60 minutes in a humidified state. Next, the grit was washed with PBS, sterilized distilled water, dried at room temperature, air dried, stained with 4% uranium acetate solution for 2 minutes on a grid, and then dried with a JEM-1200EXII electron microscope (JEOL. ) Was used for observation and photographing. As a result, it was apparent that the spike amount structure of the virus envelope was composed of the protein of F and HN (FIG. 12), and it was found that the F protein produced by the helper cell was efficiently incorporated into this virion. In addition, the F-defective virus particles had a spiral RNP structure and a spike amount structure inside the same as the wild type virus (Fig. 14).
[185] [Example 5] High-efficiency gene introduction into various cells in vitro by F-defective SeV vector
[186] <Introduction of rat cerebral cortical neurons into primary cultured cells>
[187] Primary cultured cells of rat cerebral cortical neurons were prepared and cultured as follows. On the 18th day of pregnancy, SD rats (SPF / VAF Crj: CD, female, 332 g, ~9 weeks Charles River) were deeply anesthetized with diethyl ether and euthanized by bloodletting from axillary arteries. The fetus was removed from the uterus, and the skin was incised and the brain was taken out. The cerebral hemispheres were transferred to DMEM in working fluid (containing 5% horse serum and 5% calf serum, 10% DMSO) under stereoscopic microscope and sliced to give ice-cold papain solution (1.5 U, cysteine 0.2 mg, bovine serum 0.2 mg of albumin, 5 mg of glucose, and 0.1 mg / ml of DNase) was added, and the mixture was stirred at 32 캜 for 5 minutes every 5 minutes and incubated for 15 minutes. Pipetting was repeated until the suspension became sufficiently turbid and the tissue pieces became translucent and the tissue pieces disappeared. The cells were resuspended in B27 supplemented neural basal medium (GibcoBRL, Burlington, Ontario, Canada) and plated in poly-d-lysine , USA) at 1 × 10 ⁵ cells / dish, and cultured at 37 ° C. and 5% CO ₂ .
[188] The cerebral cortex primary cultured neurons were cultured for 5 days at 5 × 10 ⁵ / well, then infected with the F-defective SeV vector (moi = 5) and further cultured for 3 days. The cells were fixed in a fixative solution containing 1% paraformaldehyde, 5% goat serum and 0.5% Triton-X for 5 minutes at room temperature and blocked with Block Ace (Snow Brand Milk Products) for 2 hours at room temperature to obtain a 500-fold diluted goat anti- -associated protein 2 (MAP-2) (Boerhinger) IgG for 1 hour at room temperature. After washing three times every 15 minutes with PBS (-), the cells were incubated with cys3-conjugated anti-mouse IgG diluted 100 times with 5% goat serum / PBS for 1 hour at room temperature. The cells were washed three times with PBS (-) three times every 15 minutes. Vectashield mounting medium (Vector Laboratories, Burlingame, USA) was added to the cells and confocal microscopy (Nippon Bio-Rad MRC 1024, Immunostaining of MAP-2 and fluorescence observation of double staining by GFP fluorescence were performed on a Nikon Diaphot 300 inverted microscope equipped with an excitation band-pass filter of 500-nm or 510-550-nm. As a result, it became apparent that almost 100% of GFP was introduced into MAP2-positive neurons (Fig. 15).
[189] &Lt; Introduction into normal human cells >
[190] Normal human smooth muscle cells, normal human hepatocytes, normal human lung lung capillary endothelial cells (Cell Systems) were purchased from Dainippon Pharmaceuticals and cultured in SFM CS-C medium (Cell Systems) at 37 ° C, 5% CO ₂ .
[191] Human normal cells such as normal human smooth muscle cells (Fig. 15, Muscle), normal human hepatocytes (Fig. 15, liver) and normal human lung lung capillary endothelial cells (Fig. 15, Lung) = 5), GFP expression was observed. It was confirmed that strong GFP gene expression was achieved in almost all cells with almost 100% introduction efficiency (Fig. 15).
[192] <Introduction into primary mouse bone marrow cells>
[193] Further, an experiment was conducted in which mouse primary bone marrow cells were separated into lineage markers and infected with F-defective SeV vectors. First, 5-fluorouracil (5-FU, Wako Pure Chemical Industries) was intraperitoneally injected (IP injection) into C57BL mice (male, 6 weeks old) to 150 mg / kg, and bone marrow cells were recovered from the femur did. Monocytes were isolated by density gradient centrifugation using Lympholyte-M (Cedarlane). For 3 mononuclear cells of × 10 ^6, Biotin (biotin) labeled anti-CD45R (B220), anti-Ly6G (Gr-1), anti-Ly-76 (TER-119) , anti-1 (Thy1.2), wherein Mac which streptavidin magnetic beads (streptavidine-magnetic beads) coupled -1; was added to a mixture of 3 × 10 (Pharmingen Funakoshi) ⁷ and 1 h at 4 ℃, recover the fractions, except for, Lin ⁺ cells by a magnetic (Lin ^- cells) (Erlich, S. et al., Blood 1999. 93 (1), 80-86). Lin ^- about the cells 4 × 10 ⁵ cells, 2 × 10 ⁷ were added to SeV in HAU / ml, Moreover, was added recombinant rat SCF (100 ng / ml, BRL ), recombinant human IL-6 (100 U / ml ) . In addition, 8 × 10 ⁵ total bone marrow cells were supplemented with 4 × 10 ⁷ HAU / ml of F-deficient SeV and 5 × 10 ⁷ HAU / ml of GFP-SeV per 1 × 10 ⁶ cells. In addition, GFP-SeV contains a green fluorescent protein (GFP) gene (structural gene length (SEQ ID NO: 2)) at the restriction enzyme NotI cleavage site of SeV transcription unit pUC18 / T7HVJRz.DNA (+18) (Genes Cells, 1996, 1: 569-579) 711 bp) was amplified by PCR and introduced into a NotI fragment to which a transcription initiation (R1), a termination (R2) signal and an intervening (IG) sequence were added. According to a known method (Genes Cells, 1996, 1: 569-579), the virus containing the GFP gene was reconstructed using LLC-MK2 cells and developmental eggs to recover the virus containing the target gene. Cells were divided into two groups, one with a phycoerythrin (PE) labeled anti-CD117 (c-kit, Pharmingen) for one hour, and the other one with a GFP-SeV The army was a control group. After washing three times with PBS, analysis was performed by a flow cytometer (EPICS Elite ESP; Coulter, Miami, FL).
[194] As a result, F-defective SeV vector was also infected with enrichment of marrow cells with anti-c-kit antibody as a marker of primary hepatocytes of blood, and GFP gene expression was observed (FIG. 16). Identification of the infectious particles in the culture medium was carried out by treating the cell culture supernatant with trypsin, adding it to LLC-MK2 cells, and depending on the presence or absence of GFP-expressing cells three days later. It was confirmed that no infectious virus particles were released in any of these cells.
[195] [Example 6] Administration of vector into rat ventricle
[196] (5 mg / ml) Nembutal sodium solution (Dainabot) diluted 10-fold with physiological saline (Otsuka Pharmaceutical co., Ltd.) was added to rats (F334 / Du Crj, female, Was anesthetized by intraperitoneal injection and the virus was administered using a brain stereotaxic apparatus (DAVID KOPF) for small animals. The site of administration was 20 μl with an exchangeable needle (Hamilton) of 30 G at 5.2 mm from the interaural line to the bregma, 2.0 mm to the right edge from lambda and 2.4 mm from the brain surface (10 ⁸ CIU). High expression of GFP was observed in the ependymal cell of the ventricle (Fig. 17). Furthermore, in the F-defective SeV vector, expression of GFP protein was not observed in cells or nerve cells in the vicinity of the injection site capable of contacting viruses, and no lesion was observed in these sites. In the administered rats, no apparent behavioral abnormalities or changes in body weight were observed until dissected, and no lesions were observed in any tissue organs such as liver, lung, kidney, heart, spleen, stomach, Was not observed.
[197] [Example 7] Formation of F-less viral particles from F-deficient SeV genome
[198] <1>
[199] F-deficient SeV virus was infected with F-non-expressing LLC-MK2 cells and F-expressing LLC-MK2 cells (LC-MK2 / F7) and cultured in the absence (+) and absence (-) of trypsin The results of the HA assay of the culture supernatant were shown (Fig. 18A). These culture supernatants were each inoculated into the developing eggs, and the results of HA assay of the egg long urine fluid after 2 days of culture were shown (Fig. 18B). &Quot; C &quot; at the top of the panel indicates PBS used as a control group. Dilution (dilution) represents the dilution factor of the virus solution. Further, the prolonged urine (lane 11 and lane 12), which was HA-positive in the developing eggs, was re-inoculated into the developing eggs and HA assay of the urine was performed 2 days after the incubation (Fig. 19C). As a result, even in the case of the F non-expressing cells or the developmental eggs infected with the F-deficient SeV virus, even when the HA was positive, the virus was not amplified at all even when the egg was re-inoculated, and the HA- Proved.
[200] &Lt; 2 &
[201] F non-expressing cells was examined for the presence of viral particles in the non-infectious virus solution amplified. F-expressing cells and non-infectious enriched urine (HA-positive) and wild-type SeV were subjected to Northern blotting using F gene and HN gene as probes, using total RNA prepared by QIAamp viral RNA mini kit (QIAGEN). As a result, bands were detected in the probes of the HN gene, but no bands were detected in the probes of the F gene (Fig. 10), in all of the RNAs derived from the culture supernatant virus of the prolonged urine juice or F-expressing cells. In this HA-positive, infectious fluid, non-infectious virus-like particles bearing the F-deficient genome were found to be present. Furthermore, when the HA-positive, infectious virus solution was examined by immunoelectron microscopy, viral particles were confirmed, and the envelope of the virion was reacted with an antibody recognizing the HN protein labeled with gold colloid. However, the gold colloid labeled F protein (Figure 20). &Lt; tb &gt; &lt; TABLE &gt; This indicates the presence of virion of F-less, and even if there is no F protein, it turns out that virus is formed as virion by HN protein alone. (Leyer, S. et al., J. Gen. Virol 79, 683-687 (1998)). This result suggests that SeV virions alone can form SeV virions The first thing that can be formed is clear. The fact that these F-less virions can be prepared on a large scale on a day-to-day basis in the developing eggs indicates that a large amount of virions can be produced to encapsulate SeV F-deficient RNPs.
[202] &Lt; 3 &
[203] As described above, the F-less viral virions that are amplified routinely in the developing eggs do not show any infectivity to the cells susceptible to the Sendai virus. Thus, to confirm that the functional RNP structure is enveloped in the envelope, it was mixed with cationic liposomes (DOSPER, Boehringer mannheim) and incubated at room temperature for 15 minutes to transfect F and non-expressing cells. As a result, no GFP-expressing cells were observed when mixed with cationic liposome, whereas GFP expression was observed in both cells when mixed with cationic liposome. F-expressing cells, GFP was expressed in single cells and not in neighboring cells, whereas in F-expressing cells, GFP-expressing cells were diffused and colonies were formed (FIG. 21). From this, it became clear that virion that was not infectiously amplified in the developing egg on a day-to-day basis was introduced into the cell using a method such as transfection, and the gene could be expressed.
[204] [Example 8] FHN deficiency Reconstruction and amplification of virus from SeV genome
[205] &Lt; Construction of FHN-deficient genome cDNA >
[206] Construction of the FHN deletion-type SeV genomic cDNA (pSeV18 ⁺ / DELTA FHN) was performed by first digesting pUC18 / KS with EcoRI to construct pUC18 / Eco and amplifying the entire sequence between the start codon of the F gene and the stop codon of the HN gene 4866-8419) were deleted and constructed by ligating at BsiwI site (cgtacg). After confirming the sequence of the FHN deletion site by base sequencing, the EcoRI fragment (4057 bp) was recovered from the gel and replaced with the EcoRI fragment of pUC18 / KS. This FHN to the KpnI / SphI fragment (14673 bp) comprising a defect region gel recovered by replacing the KpnI / SphI fragment of pSeV18 ^+, the plasmid pSeV18 ⁺ / △ FHN was obtained.
[207] On the other hand, construction of FHN-deficient SeV cDNA into which GFP was introduced was carried out as follows. SalI / XhoI fragment (7842 bp) was recovered from pSeV18 ⁺ / DELTA FHN and cloned into pGEM11Z (Promega) to give plasmid pGEM11Z / SXdFHN. A PCR product obtained by adding a BsiwI site to both ends of ATG-TAA (846 bp) of d2EGFP (Clontech) at the FHN deletion site was digested with BsiwI enzyme and ligated to the BsiwI site of the FHN deletion site of pGEM11Z / SXdFHN. The obtained plasmid was pSeV18 ⁺ / DELTA FHN-d2GFP.
[208] &Lt; Preparation of FHN-deficient protein coexpressing cells >
[209] The plasmid expressing the F gene was the same as that used for producing the F-deficient protein-expressing cell line. The plasmid expressing the HN gene was constructed in the same manner as described above. The fragment containing the ORF of HN was constructed by pCALNdlw (Arai et al. Above) to give a plasmid pCALNdLw / HN.
[210] LLC-MK2 cells were mixed with pCALNdLw / F and pCALNdLw / HN in the same amount or different amounts, and transfection was carried out using a mammalian transfection kit (Stratagene) according to the protocol. G418 for 3 weeks and then cloned. The resulting drug resistant clones were infected with recombinant adenovirus (Ade / Cre) (Saito et al., Supra) expressing Cre DNA recombinase (moi = 10) Washed three times with PBS (-), recovered, and detected by monoclonal IgG of anti-SeV F and anti-SeV HN proteins using the Western blotting method (FIG. 22).
[211] <Construction of pGEM / FHN>
[212] The F and HN fragments used for construction of pCALNdLw / F and pCALNdLw / HN were cloned into pGEM4Z and pGEM3Z (Promega), respectively, to obtain pGEM4Z / F and pGEM3Z / HN. The region containing the T7 promoter of pGEM3Z / HN and HN was digested with PvuII enzyme, and the resulting fragment was recovered and ligated to a site that had been digested and cleaved at the SacI unique site downstream of the F gene of pGEM4Z / F. The fact that F gene and HN gene were arranged in the same direction was confirmed by Western blotting with anti-F or anti-HN monoclonal antibody so that both F and HN proteins could be expressed simultaneously.
[213] <Rebuilding of FHN deficient virus>
[214] The reconstruction (P0) of the FHN deficient virus was performed in two ways. One used RNP transfection as well as reconstitution of F-deficient virus. The other was reconstitution by supplying a plasmid carrying the FHN protein with T7. That is, a plasmid expressing the F, HN protein under the control of the T7 promoter was separately prepared, and F and HN proteins were supplied thereto to perform reconstruction. In either method, the reconstruction was performed in FHN expressing cells. FHN-deficient GFP-expressing SeV cDNA (pSeV18 ⁺ / △ FHN-d2GFP), pGEM / NP, pGEM / P, pGEM / L and pGEM / FHN were applied to 12 ㎍ / 10 cm dish, 4 ㎍ / (Final volume, 3 ml / 10 cm dish) was prepared by the same method as the reconstruction of the F-deficient SeV described above, using LLC-MK2 The gene was introduced into the cell. Three hours after the transfection, the medium was replaced with MEM containing AraC (40 / / ml, SIGMA), trypsin (7.5 / / ml, GIBCO) and further cultured for 3 days. On the second day after the gene introduction, a fluorescent stereomicroscope was used to examine the difference in the presence or absence of addition of pGEM / FHN, and the formation of virus was confirmed by the diffusion of GFP-expressing cells. As a result, the diffusion of GFP-expressing cells was confirmed when pGEM / FHN was added at the time of reconstitution, and GFP expression was observed only in single cells without addition of pGEM / FHN (FIG. 23). The addition of FHN protein at the time of construction of the protein showed that virion was formed. On the other hand, in the case of RNP transfection, the virus was successfully recovered from FHN expressing cells of P1 in the same manner as the F deficiency (Fig. 24).
[215] It was confirmed that FHN protein-inducible cells were able to be amplified by infecting the FHN deficient virus solution after Ade / Cre infection and after 6 hours (FIG. 24, below).
[216] The virus solution reconstituted from cDNA expressing FHN-deficient GFP was infected with LLC-MK2, LLC-MK2 / F, LLC-MK2 / HN and LLC-MK2 / FHN and cultured with or without trypsin. GFP spread was observed only in LLC-MK2 / FHN, and it was confirmed that this virus solution was specific for FHN coexpression and was also trypsin-dependent (FIG. 25) .
[217] To identify the FHN-deficient viral genome, the culture supernatant recovered from LLC-MK2 / FHN cells was centrifuged, followed by RNA extraction according to the protocol with a QIAamp Viral RNA mini kit (QIAGEN). This RNA was subjected to template synthesis by RT-PCR using Superscript Preamplification System for first Strand Synthesis (GIBCO BRL), and PCR was performed using TAKARA Z-Taq (Takara). The control group used F-deficient virus. PCR primer was performed using a combination of M gene and GFP gene or a combination of M gene and L gene (forward: 5'-atcagagacctgcgacaatgc / SEQ ID NO: 13 for M gene and GFP gene combination (M-GFP) reverse: 5'-aagtcgtgctgcttcatgtgg / SEQ ID NO: 14; forward: 5'-gaaaaacttagggataaagtccc / SEQ ID NO: 15, reverse: 5'-gttatctccgggatggtgc / SEQ ID NO: 16 for the combination of ML gene and M gene. As a result, when the M and GFP genes were used as primers, specific bands were detected for F defects and FHN deficient viruses under RT conditions. When M and L genes were used as primers, a band of a predetermined size including GFP was detected in the FHN deletion, and a band longer in the size including the HN gene was observed in the case of F deletion. The genomic structure became clear that FHN was missing (Fig. 26).
[218] On the other hand, the FHN deficient virus was infected with the F-expressing cells in the same manner as the F deficiency, and the culture supernatant was recovered on the fourth day, and the infection test with LLC-MK2, LLC-MK2 / F and LLC-MK2 / FHN was carried out. As a result, GFP-expressing cells were not observed in any of the infected cells, indicating that they were not infectious to these cells. However, it has been previously reported that F protein alone can form viral particles (Kato, A. et al., Genes cells 1, 569-579 (1996)), asialoglycoprotein receptor ASG-R) (Spiegel et al., J. Virol 72, 5296-5302, 1998). Thus, with the FHN-deficient RNA genome, it is believed that the viral envelope can be released into the culture supernatant of F-expressing cells, only virions formed with F protein. Thus, the culture supernatant of the F-expressing cells infected with the FHN deficient virus was recovered, centrifuged, RNA extraction was carried out in the same manner as described above, and analyzed by RT-PCR in the same manner as described above. As a result, it was found that RNA containing the FHN deletion genome was present as shown in Fig.
[219] In addition, it is clear that F and HN proteins are not expressed by Western blotting analysis of VSV-G and pseudovirus viral virions. The production system of FHN defective virus virions has been established.
[220] Furthermore, virions released from F protein expressing cells were overlaid on FHN expressing cells or non-expressing LLC-MK2 cells with or without mixing with cationic liposomes (50 μl of DOSPER / 500 μl / well). As a result, as in the case of the above-mentioned F-less particles, diffusion of GFP-expressing cells was observed when the cells were mixed with DOSPER, but no HN-less virion was infectious to cells, and GFP No expression cells were observed. GFP-expressing cells were observed in the FHN-non-expressing cells, but the virus was not re-formed and diffused.
[221] The virus-like particles recovered from these F-expressing cells are infected with a cell line or non-expressing cell line or a hepatocyte which continuously expresses the ASG-R gene and are infected with liver-specific or ASG-R by means of Spiegel et al. You can check if you are infected.
[222] [Example 9] Application of defective genomic RNA viral vector
[223] 1. The amplified F-deficient RNP in the system described above is enclosed in the viral envelope of F-less, and this envelope can be added to the intended cell introduction ability by a chemical modification method or the like, (RNP transfection or RNP injection), it is possible for the recombinant RNA genome to autonomously produce RNA replication or protein in the transfected cells.
[224] 2. Fusion of a ligand capable of specifically targeting an extracellular domain with another receptor, leaving the intracellular domain of HN, and incorporating a recombinant gene capable of producing chimeric protein into the viral genome, And the vectors can be prepared from the cells that produce the recombinant protein. These vectors are applicable to gene therapy, vaccine, and the like.
[225] 3. Because of the successful reconstruction of the defective SeV viruses, all of the FHN-deficient SeV viruses were successfully reconstituted in the same manner as the FHN-deficient vector by introducing a gene of the targetable envelope chimeric protein instead of the GFP gene into the FHN deletion region. Once amplified to infect non-expressing cells and recovering virions formed only by the targetable chimeric envelope protein transcribed from the viral genome, production of the targeting vector becomes possible.
[226] Until now, virions formed by the F protein alone, which encodes the mini genome and simultaneously introduced the gene into the cells from the mini genome of Sendai virus and the NP, P, L and F genes (Leyer et al., J. Gen. Virol 79,683- 687, 1998), and also vectors that hypertransmit murine leukemia virus to Sendai F protein (Spiegel et al. J. Virol 72, 5296-5302, 1998). It has also been reported that F protein can be specifically targeted to hepatic cells via ASG-R after cleavage with trypsin (Bitzer et al., J. Virol. 71, 5481-5486, 1997). The above reported system is a routine particle formation system, and it is difficult to continuously collect the vector particles continuously. In addition, Spiegel et al. Report retroviral vectors pseudotyped with Sendai F protein, but retroviruses inherently have inherent problems such as the inability to transduce genes other than dividing cells. In the present invention, virus particles having an FHN bovine SeV viral genome and having an envelope protein only with F protein are novel viral particles which can be autonomously replicated in an efficient cytoplasm regardless of cell division, It is a practical system that can produce.
[227] [Example 10] FHN deficiency Reconstruction and amplification of virus from SeV genome
[228] In most single-stranded negative strand RNA viruses such as Sendai virus and measles virus, a technique has been established for reconstituting infectious virus particles from cDNA cloned from the viral genome.
[229] In most systems, a plasmid into which cDNA, NP, P, and L genes are introduced downstream of the T7 promoter is introduced into the cell, and T7 polymerase is used to reconstitute the cDNA and each gene. However, T7 polymerase , Recombinant vaccinia viruses expressing T7 polymerase have been mainly used.
[230] T7 expressing vaccinia virus can efficiently express T7 polymerase in almost all cells, but because of cytotoxicity from vaccinia virus, infected cells can survive only for a few days. In most cases, rifampicin is used as anti-vasicin agent, but in the system of rabbit (Kato, A. et al., Genes cells 1, 569-579 (1996)), AraC is used in addition to rifampicin , The propagation of Vaccinia virus was minimized, and successful reconstruction of Sendai virus was successfully performed.
[231] However, the reconstitution of negative strand RNA viruses including Sendai viruses is efficient in that the virus reconstituted in 1 × 10 ⁵ cells has several particles or less, which is still considerably lower than other viruses such as retroviruses. The reason for this is that the virus itself has a complicated process until reconstitution (a leaked RNA is separately transcribed and translated into an RNP-like structure by the attached protein, and then transcribed by polymerase, , As well as cytotoxicity by using vaccinia virus.
[232] As a means of supplying T7 polymerase, an attempt was made to adenovirus in addition to vaccinia, but good results could not be obtained. In addition to T7 polymerase, Vaccinia virus encodes an RNA-capping enzyme which functions in the cytoplasm as its own protein. This enzyme encodes and stabilizes the RNA transcribed by the T7 promoter in the cytoplasm, thereby enhancing translation efficiency . In the present invention, by treating the vaccinia virus with the Psoralen-Long-Wave-UV method, attempts have been made to avoid the cell disorder derived from the vaccinia virus and to improve the reconstitution efficiency of the Sendai virus.
[233] By corsslinking DNA with psoralen and long wavelength ultraviolet light, it is possible to create a state that inhibits the replication of the virus having the DNA in the genome but does not particularly affect the expression of the initial gene. Since vaccinia viruses have a long genome length, the effect of this system on viral inactivation appears to be significant (Tsung, K. et al., J Virol 70, 165-171 (1996)).
[234] In the case of wild-type viruses capable of self-sustaining growth, it is possible to propagate Sendai virus by inoculating transfected cells into a developing egg if a virus even if a particle is formed by reconstitution, so that the efficiency of reconstitution and the efficiency of restoration of Vaccinia virus You do not have to worry too much.
[235] However, in the reconstruction of various mutant viruses for examining the replication of viruses, the mechanism of particle formation, etc., development eggs can not be used for proliferation, and in some cases, cell lines expressing virus-derived proteins may be used . Also, it can be considered that the mutant virus or the defective virus is significantly slower in proliferation than the wild-type virus.
[236] In order to propagate the Sendai virus having such a mutation, the cells after transfection must be overlaid on the next generation of cells and cultured for a long time. Therefore, the efficiency of the reconstitution and the remaining titer of Vaccinia virus become a problem. In the present method, it was possible to increase the reconstitution efficiency and reduce the titer of the remaining vaccinia virus.
[237] Using this method, a mutant virus that could not be obtained in the system using untreated vaccinia virus to date can be obtained by reconstruction (F, FHN defective virus). This system is thought to be a great tool for restructuring mutant viruses that are expected to increase in the future. Therefore, the inventors of the present invention examined the amount of psoralen and ultraviolet (UV), and examined inactivating conditions of Vaccinia virus.
[238] <Experiment>
[239] First, the irradiation time was set to 2 minutes, and the concentration of psoralen was examined. The inactivation test was carried out by measurement of vaccinia virus titer by plaque formation and measurement of T7 polymerase activity by the pGEM-luci plasmid and Sendai virus minigene under T7 promoter control. The measurement of T7 polymerase activity by the Sendai virus minigenome was carried out using a plasmid of Sendai virus minigenome and pGEM / NP, pGEM / P, pGEM / L plasmid expressing Sendai virus NP, P, L protein with T7 To form a ribonucleoprotein complex, and to examine the transcription of luciferase enzyme protein by an RNA polymerase of Sendai virus.
[240] At 2 minutes of UV irradiation, a decrease in Vaccinia virus titer was observed depending on the concentration of psoralen. However, the T7 polymerase activity did not show a change in psoralen concentration up to 0, 0.3, or 1 占 퐂 / ml, and decreased to about 1/10 at 10 占 퐂 / ml (Fig. 28).
[241] Furthermore, the concentration of psoralen was fixed at 0.3 占 퐂 / ml, and ultraviolet irradiation time was examined. As the irradiation time increased, the titer of vaccinia virus decreased, but up to 30 minutes of irradiation had no effect on T7 polymerase activity. At this time, under the condition of 0.3 / / ml for 30 minutes irradiation, it was possible to reduce the titer to 1 / 1,000 without affecting T7 polymerase activity (FIG. 29).
[242] However, even in vaccinia viruses whose titer decreased by a factor of 1000, the CPE after 24 hours when infected at moi = 2 (moi = 0.002 with the remaining titer after treatment) in terms of the pre-treatment titer, and was not different from that when infected at moi = 2 (Fig. 30).
[243] The efficiency of the Sendai virus reconstitution was examined using Vaccinia virus treated under these conditions. The reconstruction was carried out in the following order by slightly modifying the method described in Kato et al. LLC-MK2 cells were plated at 3 × 10 ⁵ cells / well on a ^6- well microplate and incubated overnight. Vaccinia virus was diluted to 6 × 10 ⁵ pfu / 100 μl in terms of titer before PLWUV treatment, The cells after washing were infected. After 1 hour of infection, 10 μl of Superfect (QIAGEN) was added to 100 μl of OPTI-MEM to which 1, 0.5, 1, and 4 μg of plasmid, pGEM-NP, P, After standing for 15 minutes, 1 ml of OPTI-MEM (GIBCO) (containing Rif. AraC) was added and the cells were overlaid.
[244] Cells were collected on days 2, 3, and 4 after transfection, centrifuged and suspended in PBS at 300 ㎕ / well. The suspension concentrate, or 10 times, and 4 per inoculation, each diluted in growth of eggs 10 days after fertilization a cell solution 100 ㎕ diluted 100 times ^{(1 × 10 5, 1 ×} 10 4, 1 × 10 ³ cells, respectively, inoculation). Three days later, the urine was collected from the eggs and examined for the presence of virus reconstitution by HA test (Table 1). Among the eggs inoculated with 1 × 10 ⁵ cells, the reconstitution efficiency (Reconstitute Score) was obtained by counting eggs with HA activity at 1 point, 10 ⁴ points at 10 ⁴ , and 100 points at 10 ³ (FIG. 31). The calculation formula is shown in Table 1.
[245] Table 1 Effect of UV treatment time of vaccinia virus on the efficiency of Sendai virus reconstitution
[246]
[247] Further, when the titer of Vaccinia virus remaining in the cells at 2, 3, and 4 days after transfection was measured, the number of tinctures of Vaccinia virus remaining in the cells was decreased in proportion to the titer given before transfection ).
[248] By inactivating Vaccinia virus with PLWUV, it was possible to lower the titer by a factor of 1000 without affecting T7 polymerase activity. However, the CPE derived from Vaccinia virus was not different from that of the virus having a 1000-fold titer, which was not treated in the microscopic observation.
[249] By using Vaccinia virus treated under this condition for the reconstitution of Sendai virus, the reconstitution efficiency of Sendai virus was increased by several tens to hundreds of times (Fig. 31). At the same time, the titer of the remaining vaccinia virus after transfection was not more than 5 pfu / 10 ⁵ cells. Therefore, the remaining amount of replication-competent Vaccinia virus was suppressed to 0.005% or less.
[250] [Example 11] Production of pseudotype-type Sendai virus
[251] <1> Production of helper cells inducing expression of VSV-G gene product
[252] Since the VSV-G gene product has cytotoxicity, the plasmid pCALNdLG (Arai T. et al., J. Virology 72 (1998) p1115-1121), which is designed to induce expression of VSV-G gene product by Cre recombinase, Was used to generate stability in LLC-MK2 cells. The introduction of the plasmid into the LLC-MK2 cells was performed according to the attached manual by the calcium phosphate method (CalPhosTMMammalian Transfection Kit, Clontech).
[253] 10 μg of plasmid pCALNdLG was introduced into LLC-MK2 cells grown to 60% confluency using a 10 cm plate, and the cells were cultured in 10 ml of MEM-FCS 10% medium, in a 5% CO ₂ incubator at 37 ° C And cultured for 24 hours. After 24 hours, the cells were detached and suspended in 10 ml of medium. Five 10-cm chalks were used to spray 1 ml of 5 ml, 2 ml of 2 ml, and 0.5 ml of 2 ml of the solution, and 1200 μg of G418 (GIBCO-BRL) / ml in MEM-FCS 10% medium, and cultured for 14 days while changing the medium every two days to select gene stability. Cells showing resistance to G418 grown by the above cultivation were harvested at 28 weeks using a cloning ring. Each clone continued to expand until it became a confluent on a 10 cm plate.
[254] For each clone, the expression of VSV-G was examined by the Western blotting method described below, using an anti-VSV-G monoclonal antibody after infection with a recombinant adenovirus AxCANCre containing Cre recombinase.
[255] Each clone was grown in a 6 cm chalet until confluent, and adenovirus AxCANCre was cultured for 3 days after infection at MOI = 10 by the method of Saito et al. (Supra). After removing the culture supernatant, the cells were washed with PBS buffer, and 0.5 ml of PBS buffer containing 0.05% trypsin, 0.02% EDTA (ethylenediaminetetraacetic acid) was added, and the cells were detached from the cholesteryte by incubating at 37 ° C for 5 minutes . The cells were suspended in 3 ml of PBS buffer, centrifuged at 1,500 x g for 5 minutes, and the cells were collected. The obtained cells were suspended again in 2 ml of PBS buffer, and centrifuged at 1,500 x g for 5 minutes to collect the cells.
[256] The cells can be stored at -20 占 폚 and can be thawed if necessary. The collected cells were dissolved by 100 μL of a cell lysis solution (RIPA buffer, Boehringer Mannheim), and western blotting was performed using the total protein (1 × 10 ⁵ cells per 1 lane) of the cells. The cell lysate was resuspended in a sample buffer for SDS-polyacrylamide gel electrophoresis [6 mM Tris-HCl (pH 6.8), 2% SDS, 10% glycerol, 5% Buffer solution of [kappa] ethanol], heated at 95 [deg.] C for 5 minutes, and then used for electrophoresis. The sample was fractionated by electrophoresis using SDS-polyacrylamide gel (Multigel 10/20, Daiichi Pure Chemicals Co., Ltd.), and the fractionated protein was subjected to a semi-dry blotting method ) To a transfer membrane (Immobilon-P Transfer Membranes, Millipore). The transfer was carried out for 1 hour under the condition of 1 mA / cm ² constant current using a transfer film immersed in 100% methanol for 20 seconds and water for one hour.
[257] The transferred membrane was shaken in 40 ml of blocking solution (Block-Ace, Snow Brand Milk Products Co., Ltd.) for 1 hour and then washed once with PBS buffer.
[258] 5 ml of anti-VSV-G antibody (clone P4D4, Sigma) diluted 1/1000 with the PBS containing the transcriptional membrane and 10% blocking solution was sealed in a plastic bag and left to stand still at 4 ° C.
[259] The transfer membrane was immersed twice in 40 ml of PBS-0.1% Tween 20 for 5 minutes, washed, immersed in PBS buffer for 5 minutes, and washed.
[260] 5 ml of an anti-mouse immunoglobulin (anti-mouse immunoglobulin, Amersham) labeled with peroxidase diluted 1/2500 in PBS buffer containing the transfer membrane and 10% blocking solution was placed in a plastic bag, Time was shaken.
[261] After shaking, the transfer membrane was immersed in PBS-0.1% Tween 20 for 5 minutes, washed, immersed in PBS buffer for 5 minutes, and washed.
[262] Detection of the protein on the transcriptional membrane, which crosses with the anti-VSV-G antibody, was performed by a luminescence method (ECL Western blotting detection reagents, Amersham). The results are shown in Fig. 3 clone, the expression of VSC-G gene specific to AxCANCre was detected and the formation of LLC-MK2 cells inducing expression of VSV-G gene product was confirmed.
[263] One week of the obtained cell line was called LLCG-L1, and flow cytometry analysis was performed using an anti-VSV antibody (Fig. 34). As a result, in LLCG-L1, the reactivity with the antibody was specifically detected upon expression of the VSV-G gene induction, and it was confirmed that the VSV-G protein was expressed on the cell surface.
[264] &Lt; 2 > Production of pseudotype Sendai virus having a genome in which F gene was deleted using helper cells
[265] G virus-expressing cells were transfected with VSV-G gene expressing cells and the production of pseudotype virus having VSV-G on the outer skin was observed. F Using the deletion Sendai virus, the expression of the GFP gene was examined as an index. As a result, in LLCG-L1 not infected with the recombinant adenovirus AxCANCre containing Cre recombinase, the viral gene was introduced by the infection of F-deleted Sendai virus, and GFP-expressing cells were detected, In the cells expressing VSV-G, GFP-expressing cells were observed to increase with time. When an amount of 1/5 of the supernatant was further added to the cells in which the new VSV-G was induced to be expressed, no gene introduction was observed in the electron-derived supernatant. In the latter supernatant, gene transfer and GFP- An increase was recognized. When the latter-derived supernatant was added to LLCG-L1 cells that did not induce VSV-G, gene introduction was observed, but no increase in GFP expressing cells was observed. From the above results, it was recognized that viruses proliferate specifically for VSV-G expressing cells, and generation of pseudo-type F-deleted Sendai virus with VSV-G was recognized.
[266] &Lt; 3 > Review of production conditions of pseudotype Sendai virus having a genome which deleted F gene
[267] In order to investigate the effect of the expression level of VSV-G gene, the amount of infection of AxCANCre (MOI = 0, 1.25, 2.5, 5, 10) was changed and a pseudo-type Sendai virus The number of cells expressing GFP on day 5 was compared with the number of cells infected with VSV-G induced cells before and after VSV-G induction. As a result, when MOI = 0, Production was not recognized at all and it was found that MOI = 10 was the largest (Fig. 35). Further, when the virus production amount was examined over time, the production was increased from the fifth day after the pseudo-type Sendai virus infection, and the production was confirmed until the eighth day (Fig. 36). The virus titer was measured by adding virus solution diluted stepwise to cells before VSV-G induction, and counting the number of GFP-expressing cells on the 5th day after infection, (CIU) was obtained. As a result, the peak virus production was 5 × 10 ⁵ CIU / ml.
[268] &Lt; 4 > Effect of infectivity caused by anti-VSV antibody of pseudo-type Sendai virus having a genome deleted from F gene
[269] Regarding whether the pseudotype Sendai virus carrying the genome deficient in the F gene obtained using the VSV-G expression strain has a VSV-G protein in the envelope, the anti-VSV antibody is used to neutralize the neutralizing activity I investigated. The viral solution and the antibody were mixed, allowed to stand at room temperature for 30 minutes, and then infected with LLCG-L1 cells that did not induce VSV-G, and the presence of GFP expressing cells was examined at 5 days. As a result, complete inhibition of infectivity by the anti-VSV antibody was recognized, and inhibition was not observed in the Sendai virus having the genome in which the F gene having the original envelope was deleted (Fig. 37). From this, it is clear that the virus obtained this time is a pseudo-type Sendai virus having a VSV-G protein in the outer skin, and the infectivity thereof is specifically suppressed by the antibody.
[270] &Lt; 5 > A study on whether pseudotype Sendai virus has F-deleted genome
[271] It was examined by Western analysis of the infected cell extract protein that the virus propagated in this VSV-G gene expressing cell was the F deletion type. Western analysis was performed by the method described above. As the primary antibody, anti-Sendai virus polyclonal antibody prepared from rabbit, anti-F protein monoclonal antibody prepared from mouse, anti-HN monoclonal antibody prepared from mouse, and anti-Sendai virus polyclonal antibody In the case of antibodies, peroxidase-labeled anti-rabbit IgG antibody, anti-F protein monoclonal antibody, and anti-HN monoclonal antibody, peroxidase-labeled anti mouse IgG antibody were used. As a result, the protein and HN protein derived from Sendai virus were detected, but F protein was not detected and it was confirmed to be F-deleted type.
[272] &Lt; 6 > Production of pseudotype Sendai virus having a genome in which F and HN genes were deleted using helper cells
[273] F and HN genes were transfected with VSV-G gene expressing cells LLCG-L1 to determine whether production of pseudotype virus having VSV-G on the outer skin was observed. The GFP gene described in the above Example Using the F, HN deletion-type Sendai virus containing the GFP gene as an indicator. As a result, it was recognized that viruses proliferated specifically for VSV-G expressing cells, and generation of pseudo type F, HN deletion Sendai viruses with VSV-G was recognized (FIG. 38). The virus titer was measured by adding virus solution diluted stepwise to the cells before VSV-G induction and counting the number of cells expressing GFP on the 5th day after infection to determine the number of infected particles CIU) was obtained. As a result, the maximum virus production was 1 × 10 ⁶ CIU / ml.
[274] &Lt; 7 > Confirmation that pseudotype type Sendai virus has F and HN deletion type genome
[275] The viruses grown in the VSV-G gene expressing cells were found to be F and HN deletion types, and were examined by Western analysis of the infected cell extract protein. As a result, a protein derived from Sendai virus was detected, but F and HN proteins were not detected and thus it was confirmed to be F and HN deletion type (FIG. 39).
[276] [Example 12] Review of virus reconstitution method
[277] &Lt; Conventional method &
[278] LLC-MK2 cells were plated on a 100 mm Petri dish at 5 × 10 ⁶ cells / dish, cultured for 24 hours, washed once with MEM-free medium, and cultured with 3 ㎍ / ml psoralen and long wavelength ultraviolet Recombinant vaccinia virus (Fuerst, TR et al., Proc. Natl. Acad. Sci. USA 83, 8122-8126 1986) expressing T7 RNA polymerase treated for 5 minutes at 365 nm (vTF7-3 ) At room temperature for 1 hour (moi = 2) (moi = 2-3, preferably moi = 2 is used). The cells were washed twice with MEM medium containing no serum, and then the plasmids pSeV18 ⁺ / F-GFP, pGEM / NP, pGEM / P and pGEM / L (Kato, A. et al., Genes cells 1, (1 μg DNA / 5 μl of SuperFect, QIAGEN (Gibco)) was suspended in Opti-MEM medium (GIBCO) at a ratio of 12 μg, 4 μg, 2 μg and 4 μg / ) Was added and allowed to stand at room temperature for 15 minutes. Finally, a DNA-SuperFect mixture in 3 ml of Opti-MEM medium containing 3% FBS was added to the cells and cultured. After culturing for 3 hours, the cells were washed twice with MEM medium containing no serum, and cultured for 70 hours in MEM medium containing cytosine beta -D-arabinofuranoside 40 [mu] g / ml (AraC, Sigma). These cells and the supernatant were collected to prepare P0-d3 samples, respectively. The pellets of P0-d3 were suspended in Opti-MEM medium (10 ⁷ cells / ml). Repeating the freeze and thaw three times and lipofection reagent DOSPER (Boehringer mannheim) and mixed with ^{(10 6 cells / 25 ㎕ DOSPER} ) was allowed to stand at room temperature for 15 minutes, transfected to F expressing LLC-MK2 / F7 cell line (10 ⁶ cells / well in 24-well plate) and cultured in serum-free MEM medium (containing 40 / / ml AraC, 7.5 / / m trypsin). On the third and seventh days after the culture, the supernatant was recovered to obtain P1-d3 and P1-d7 samples, respectively.
[279] &Lt; Envelope plasmid + F-expressing cell >
[280] Transfection was carried out by carrying out the same operation as above except that the plasmid was supplemented with 4 ㎍ / dish of envelope plasmid pGEM / FHN. After 3 hours of incubation, the cells were washed twice with MEM medium containing no serum and cultured in MEM medium containing 40 / / ml of cytosine 棺 -D-arabinofuranoside (AraC, Sigma) and 7.5 / / ml of trypsin For 48 hours. The culture supernatant was removed and 5 ml of a 100 mM Petri dish F-expressing LLC-MK2 / F7 cell suspension suspended in MEM medium (containing 40 μg / ml AraC, 7.5 μg / m trypsin) . After 48 hours of culture, these cells and the supernatant were collected to give P0-d4 samples, respectively. The pellets of P0-d4 were suspended in Opti-MEM medium ^{(2 × 10 7 cells / ml} ), repeated three times with freeze-thaw and intermediate to F expressing LLC-MK2 / F7 cell line ^{(2 × 10 6 cells / well} in 24 well plate and cultured in serum-free MEM medium (containing 40 [mu] g / ml AraC, 7.5 [mu] g / m trypsin). On the third and seventh days after the culture, the supernatant was recovered to obtain P1-d3 and P1-d7 samples, respectively. For the sake of comparison, experiments were carried out in exactly the same manner as the above-mentioned conventional method, except that only the envelope plasmid was added without carrying out the middle layer.
[281] &Lt; Measurement of CIU by counting GFP-expressing cells (GFP-CIU) >
[282] LLC-MK2 cells were plated on a 12-well plate at 2 × 10 ⁵ cells / well and cultured for 24 hours. The cells were washed once with MEM medium containing no serum, and the samples (P0-d3 or P0- P1-d3 and P1-d7) were appropriately diluted so that positive cells could be between 10 and 100 in 10 cm ² , and infected with 100 μl / well. After 15 minutes, 1 ml / well of MEM medium containing no serum was added. After further culturing for 24 hours, the cells were observed under a fluorescence microscope to count GFP-expressing cells.
[283] &Lt; Measurement of CIU (Cell-Infected Unit) >
[284] LLC-MK2 cells were plated on a 12-well plate at 2 × 10 ⁵ cells / dish, cultured for 24 hours, washed once with MEM medium containing no serum, and then the sample (containing the viral vector SeV / ΔF -GFP) was infected with 100 [mu] l / well. After 15 minutes, 1 ml / well of serum-free MEM medium was added, and the cells were further cultured for 24 hours. After incubation, the cells were washed three times with PBS (-), the cells were dried (left at room temperature for about 10 minutes to 15 minutes), and acetone was immediately added to 1 ml / well to fix the cells and dried again Left at room temperature for about 10 to 15 minutes). 300 μl / well of the anti-SeV polyclonal antibody (DN-1) prepared from rabbit diluted 100-fold with PBS (-) was incubated at 37 ° C for 45 minutes, washed three times with PBS (-), 300 μl / well of anti-rabbit IgG (H + L) fluorescent secondary antibody (AlexaTM568: manufactured by Molecular Probes) diluted 200 times with PBS (-) was added and incubated at 37 ° C for 45 minutes. After washing three times with PBS (-), fluorescence-emitting cells were observed under a fluorescence microscope (Emission: 560 nm, Absorption: 645 nm filter: manufactured by Leica) (FIG.
[285] As a control, the sample (SeV / F-GFP) was infected with 100 占 퐇 / well and 15 minutes later, 1 ml / well of MEM without serum was added and cultured for another 24 hours. GFP-expressing cells were observed under fluorescent microscope (Emission: 360 nm, Absorption: 470 nm filter: Leica).
[286] [Example 13] Examination of PLWUV (Psoralen and Long-Wave UV Light) treatment conditions of optimal vaccinia virus (vTF7-3) for improving reconstitution efficiency of deletion-form Sendai virus vector
[287] LLC-MK2 cells were plated on a 100 mm Petri dish at 5 × 10 ⁶ cells / dish, cultured for 24 hours, washed once with MEM-free medium, and incubated with 0.3 to 3 μg / ml of psoralen and long wavelength Recombinant vaccinia virus (vTF7-3) (Fuerst, TR et al., Proc. Natl. Acad. Sci. USA 83, which expresses T7 RNA polymerase treated for 2 to 20 minutes with ultraviolet light (365 nm) (Moi = 2 to 3, preferably moi = 2 is used) at room temperature for 1 hour at 8122-8126 (1986). Cells were washed twice with serum-free MEM medium The plasmids pSeV18 ⁺ /ΔF-GFP, pGEM / NP, pGEM / P and pGEM / L (Kato, A. et al., Genes cells 1 and 569-579 (1 μg DNA / 5 μl of SuperFect, QIAGEN) was placed in Opti-MEM medium (GIBCO) at a ratio of 2 μg and 4 μg / dish and allowed to stand at room temperature for 15 minutes. The DNA-SuperFect mixture, placed in 3 ml of Opti-MEM medium containing FBS, After incubation for 3 hours, the cells were washed twice with MEM medium containing no serum and cultured in MEM medium containing 40 / / ml of cytosine β-D-arabinofuranoside (AraC, Sigma) Cells of about 1/20 field of view on a 100 mm Petri dish were observed under a fluorescence microscope to count GFP-expressing cells. In order to examine the inactivation of vaccinia virus (vTF7-3) (Yoshiyuki Nagai et al., Virus experiment protocols, p291-296, 1995).
[288] Furthermore, the recovery time after the transfection was noted on the third day, and the psoralen and UV irradiation time were examined. The efficiency of reconstitution of Sendai virus was examined using vaccinia virus (vTF7-3) subjected to each PLWUV treatment. Reconstruction was carried out by changing the method of Kato et al. (See above) in the following order. The LLC-MK2 cells in microplates in 6well ⁵ × 10 5 cells / well sprayed in, and incubated overnight (1 × 10 ⁶ assumes that proliferate as cells / well), 2 × 10 ⁶ to titer converted before PLWUV treatment (vTF7-3) was diluted so that the pfu / 100 [mu] l was obtained, and the cells after PBS washing were infected. Plasmid, pGEM / NP, pGEM / P and pGEM / L, and an additional SeV cDNA (pSeV18 ⁺ b (+)) (Hasan, MK et al.) Were added to 50 μl of Opti-MEM medium (GIBCO) , 10 μl of SuperFect (QIAGEN) was added to 1, 0.5, 1, and 4 μg of each of them, and the mixture was allowed to stand at room temperature for 15 minutes. Then, 1 ml of Opti-MEM (Containing 40 [mu] g / ml of AraC) was added to the cells, and the cells were overlaid. After transfection, cells were collected on the third day, centrifuged, and suspended in PBS of 100 쨉 l / well. 100 μl of the cell solution diluted with 10, 100, and 1000 times of this suspension was taken into each of three dilutions in the developing egg on the 10th day after the fixation (1 × 10 ⁵ , 1 × 10 ⁴ , and 1 × 10 ³ cells Intake). Three days later, the urine was collected from the eggs and examined for the presence of virus reconstitution by HA test. The efficiency of the reconstitution was determined by counting 1 point of eggs with HA activity, 10 points at 10 ⁴ , and 100 points at 10 ³ among 1 x 10 ⁵ cells-fed eggs.
[289] <Result>
[290] The results of Examples 12 and 13 are shown in Figs. 40 to 43 and Table 2. It was confirmed that the recombination efficiency of SeV / DELTA F-GFP was enhanced by the combination of the envelope expression plasmid and the intercellular layer. Significant improvement was recognized in d3 to d4 (from the third day to the fourth day) of P0 (before transfer) (Fig. 41). In Table 2, the cells on day 3 after transfection were inoculated into eggs. This condition was set as the optimum condition (Table 2) since 20 minutes treatment with 0.3 ㎍ / ml psoralen concentration showed the highest reconstruction efficiency (the third day).
[291] Table 2 Effect of PLWUV treatment of Vaccinia virus on Sendai virus reconstitution
[292]
[293] [Example 14] Construction of LacZ-bearing F-deleted Sendai virus vector without GFP
[294] <Construction of F-deleted SeV vector cDNA containing LacZ gene>
[295] To construct a cDNA (pSeV (+18: LacZ) /ΔF) carrying the LacZ gene at the Not I cleavage site upstream of the NP gene of pSeV18 ⁺ / ΔF described in Example 1, the LacZ gene Was amplified. (5'-GCGCGGCCGCCGTACGGTGGCAACCATGTCGTTTACTTTGACCAA-3 '/ SEQ ID NO: 17 (SEQ ID NO: 17)) was prepared by adapting the LacZ gene to a multiple of 6 (Hausmann, S et al., RNA 2, 1033-1045 (5'-GCGCGGCCGCGATGAACTTTCACCCTAAGTTTTTCTTACTACGGCGTACGCTATTACTTCTGACACCAGACCAACTGGTA-3 '/ SEQ ID NO: 1) to which a transcription termination signal (E) of SeV, an intervening sequence (I) and a transcription initiation signal (S) 18), PCR reaction was carried out using plasmid pCMV-beta (manufactured by Clontech) as a template. The reaction conditions were as follows: pCMV-50 ng, 200 μM dNTP (manufactured by Pharmacia Biotechnology), 100 pM primer, and 4 U of Vent polymerase (NEW ENGLAND BIOLABS) Lt; 0 &gt; C for 1 minute, and 72 &lt; 0 &gt; C for 2 minutes. The reaction product was subjected to electrophoresis by agarose gel electrophoresis, and a fragment of 3.2 kb was excised, purified and then digested with NotI and ligated with pSeV18 ⁺ / DELTA F NotI digested fragment to obtain pSeV (+18: LacZ) / F was obtained.
[296] &Lt; Conventional method &
[297] LLC-MK2 cells were plated on a 100 mm Petri dish at 5 × 10 ⁶ cells / dish, cultured for 24 hours, washed once with serum-free MEM, and incubated with 3 ㎍ / ml psoralen and long wavelength ultraviolet light (365 (vTF7-3) (Fuerst, TR et al., Proc. Natl. Acad. Sci. USA 83, 8122-8126 (1986)) expressing T7 RNA polymerase, ) (Moi = 2 to 3, preferably moi = 2 is used). After washing the cells twice with serum-free MEM, LacZ-mounted F deletion , PGEM / NP, pGEM / P and pGEM / L (Kato, A. et al., Genes Cells 1, 569-579 (1996)) 1 μg of DNA / 5 μl of SuperFect, QIAGEN (1 μg DNA / 5 μl) was added to each well of the Opti-MEM (GIBCO) ), Allowed to stand at room temperature for 15 minutes, and finally mixed with 3% FBS After incubation for 3 hours, the cells were washed twice with serum-free MEM and incubated with 40 [mu] g of cytosine [beta] -D-arabinofuranoside The culture supernatant was removed, and serum-free MEM medium (containing 40 / / ml AraC, 7.5 / / m trypsin) was added to the culture medium. The cells and the supernatant were recovered after 48 hours of incubation to give P0-d3 samples, respectively. P0-d3 samples were collected from each well of a 100-mm Petri dish suspended in PBS-MK2 / -d3 was suspended in Opti-MEM medium (2 x 10 ⁷ cells / ml), frozen and thawed three times and mixed with lipofection reagent DOSPER (Boehringer mannheim) (10 ⁶ cells / 25 μl DOSPER) after standing for 15 minutes, to F expressing LLC-MK2 / transfection ^{(10 6 cells / well in 24} -well-plate) to F7 cell line, that does not contain serum MEM It incubated at paper (including 40 ㎍ / ml AraC, 7.5 ㎍ / m trypsin). On the 7th day after the culture, the supernatant was collected to obtain a P1-d7 sample. Further, the supernatant was infected with LLC-MK2 / F7 cells expressing F-expressing LLC-MK2 / F7 cells in a 12-well plate for 1 hour at 37 ° C, washed once with MEM medium, 7.5 [mu] g / m trypsin). On the 7th day after the culture, the supernatant was collected to obtain a P2-d7 sample. Further, the supernatant was transferred to F-expressing LLC-MK2 / F7 cell line sprayed on a 6-well plate for 1 hour at 37 ° C, washed once with MEM medium, and then cultured in MEM medium containing no serum (7.5 ㎍ / ). On the 7th day after the culture, the supernatant was collected to obtain a P3-d7 sample. Further, the supernatant was infected with LLC-MK2 / F7 cells expressing the F-expressing LLC-MK2 / F7 cells, which had been plated on a 10 cm plate, for 1 hour at 37 ° C and then washed once with MEM medium. Thereafter, MEM medium containing 40 ㎍ / ml AraC, / m trypsin). On the 7th day after the culture, the supernatant was collected to obtain a P4-d7 sample.
[298] &Lt; Measurement of CIU by counting LacZ-expressing cells (LacZ-CIU) >
[299] LLC-MK2 cells were plated on a ⁶ -well plate at 2.5 × 10 ⁶ cells / well, cultured for 24 hours, washed once with MEM medium containing no serum, and diluted 1/10 with P3- , And after infection at 37 ° C for 1 hour, the cells were washed once with MEM medium, and 1.5 ml of MEM medium containing 10% serum was added. After culturing at 37 ° C for 3 days, the cells were stained with a β-Gal staining kit (Invitrogen). Results of three experiments are shown in Fig. As a result of counting the number of LacZ-stained positive cells, it was found that a virus of 1 x 10 ⁶ CIU / ml was obtained in each case in the P3-d7 sample.
[300] [Example 15] Control of gene expression amount using polar effect in Sendai virus
[301] &Lt; Construction of SeV genome cDNA >
[302] A new Not I site was inserted into the cDNA of the Sendai virus (SeV) whole-length genome, pSeV (+) (Kato, A. et al., Genes to Cells 1: 569-579, 1996) Initiation signal. As the introduction method, a fragment (2645 bp) obtained by digesting pSeV (+) with Sph I / Sal I, a fragment digested with Cla I (3246 bp) and Cla I / Eco RI The fragment (5146 bp) was separated by agarose electrophoresis, and the corresponding band was cut out and recovered and purified by QIAEX II Gel Extraction System (QIAGEN). Sph I / Sal a fragment digested with I is LITMUS38 (NEW ENGLAND BIOLABS, Ltd.), a fragment of Cla I / a fragment digested with Eco RI digested with Cla I, and ligated to pBluescriptII KS + (STRATAGENE Co.), was subcloned. Subsequently, the Quickchange Site-Directed Mutagenesis kit (manufactured by STRATAGENE) was used for the introduction of the Not I site. The primer used for each introduction was a sense strand between NP-P: 5'-ccaccgaccacacccagcggccgcgacagccacggctccgcgacagccacggcttcgg-3 '(SEQ ID NO: 19), antisense chain: 5'-ccgaagccgtggctgtcgcggccgctgggtgtggtcggtgg-3' Chain: 5'-gggataaagtcccttgcggccgcttggttgcaaaactctcccc-3 '(SEQ ID NO: 21), antisense chain: 5'-ctatagatatctgccattgcggccgcttaggtgaaatttc-3' 3) (SEQ ID NO: 25), antisense chain: 5'-ccatgatctgtgcttgtttgaggcggccgctaaagtaccgcgcgcca-3 '(SEQ ID NO: 24) and antisense chain: 5'-gggagagttttgcaaccaagcggccgcaagggactttatccc- 3 '(SEQ ID NO: 26), 5'-cccagggtgaatgggaagcggccgctaggtcatggatgggcagg-3' (SEQ ID NO: 26), and the sense strand between HN-L: 5'-cctgcccatccatgacctagcggccgcttcccattcaccctggg- : 28) were synthesized and used.
[303] Between NPP as a template the Sal I / Sph I fragment, PM between, MF between the Cla I fragment, FHN between, HNL between the Cla I / Eco to above the RI fragments, respectively using the one subcloned Quickchange Site-Directed Mutagenesis kit In accordance with the protocol of Fig. The introduced product was digested with an enzyme subcloned again, recovered and purified in the same manner, and assembled into the original Sendai genome cDNA. As a result, five kinds (pSeV (+) NPP, pSeV (+) PM, pSeV (+) MF, pSeV (+) FHN and pSeV (+), HNL) Sendai virus genome cDNA was constructed.
[304] Human secreted type alkaline phosphatase (SEAP) was subcloned as a reporter gene to examine gene expression level by PCR. A primer is added to Asc I restriction enzyme site 5 'primer: 5'-gcggcgcgccatgctgctgctgctgctgctgctgggcctg-3' (SEQ ID NO: 29), 3 'primer: 5'-gcggcgcgcccttatcatgtctgctcgaagcggccggccg-3': synthesized (SEQ ID NO: 30), PCR . PSEAP-Basic (manufactured by CLONTECH) was used as the template, and Pfu tourbo DNA polymerase (manufactured by STRATAGENE) was used as the enzyme. After PCR, the product was digested with Asc I and purified and recovered by electrophoresis. A synthetic double-stranded DNA (sense strand: 5'-gcggccgcgtttaaacggcgcgccatttaaatccgtagtaagaaaaacttagggtgaaagttcatcgcggccgc-3) containing a multicloning site ( Pme I- Asc I- Swa I) and a termination signal-intervening sequence-initiation signal was inserted into the Not I site of pBluescriptII KS + as a subcloning plasmid (SEQ ID NO: 31) and an antisense chain: 5'-gcggccgcgatgaactttcaccctaagtttttcttactacggatttaaatggcgcgccgtttaaacgcggccgc-3 '(SEQ ID NO: 32). The PCR product purified and recovered in the Asc I site of the plasmid was ligated and cloned. This was digested with Not I, and the SEAP gene fragment was recovered and purified by electrophoresis, and inserted into the Not I sites of the 5 types of Sendai virus genome cDNA and pSeV18 +, respectively, by ligation. SEP, pSeV (+) NP / SEAP, pSeV (+) PM / SEAP, pSeV (+) MF / SEAP, pSeV (+) FHN / SEAP, pSeV (+) HNL / SEAP and pSeV18 SEAP was made.
[305] <Virus Rebuilding>
[306] LLC-MK2 cells were plated at 2 × 10 ⁶ cells / dish in a 100-mm chalet and cultured for 24 hours. After that, recombinant vaccinia virus (PLWUV-VacT7) expressing T7 polymerase 2 at mo1 = 2, at room temperature, at a temperature of room temperature, for example, Fuerst, TR et al., Proc. Natl. Acad. Sci. USA 83: 8122-8126,1986, Kato, A. et al., Genes Cells 1: 569-579, Time infected. After the cells were washed, each Sendai virus cDNA, pGEM / NP, pGEM / P and pGEM / L inserted with SEAP were diluted with OptiMEM (GIBOCO BRL) at a ratio of 12 ㎍, 4 ㎍, 2 ㎍ and 4 ㎍ / 110 μl of SuperFect transfection reagent (manufactured by QIAGEN) was added and mixed. After allowing to stand at room temperature for 15 minutes, 3 ml of OptiMEM containing 3% FBS was added, and the cells were added to the cells and cultured for 3 to 5 hours. After incubation, the cells were washed twice with serum-free MEM and incubated for 72 hours with MEM containing cytosine beta-D-arabinofuranoside (AraC). These cells were recovered, and the pellet was suspended in 1 ml of PBS, and the freeze-thawing was repeated three times. These eggs were inoculated in an egg incubated for 10 days at 100 ㎕, and incubated at 35 캜 for 3 days, and the urine was collected. In order to remove Vaccinia virus, the recovered vaginal fluid was further diluted to 10 &lt; ^-5 &gt; to 10 &lt;&quot; ^{7 &} gt ;, re-inoculated into eggs, recovered in the same manner, dispensed and stocked at -80 deg. SEVPM / SEAP, SeVMF / SEAP, SeVFHN / SEAP, SeVHNL / SEAP and SeV18 / SEAP, respectively.
[307] &Lt; Measurement of titer by plaque assay >
[308] CV-1 cells were plated on a 6-well plate at 5 × 10 ⁵ cells / well, and cultured for 24 hours. After washing with PBS, recombinant SeV diluted to 10 ^-3 , 10 ^-4 , 10 ^-5 , 10 ^-6 , 10 ^-7 with BSA / PBS (1% BSA in PBS) was incubated for 1 hour, 3 ml / well of BSA / MEM / agarose (a mixture of 2% agarose in the same amount as that in 0.2% BSA + 2x MEM) was overlaid and cultured at 37 ° C and 0.5% for 6 days. After the incubation, 3 ml of ethanol / acetic acid (ethanol: acetic acid = 1: 5) was added and left for 3 hours to remove with agarose. After washing three times with PBS, the cells were incubated with a 100-fold diluted rabbit anti-Sendai virus antibody at room temperature for 1 hour. After washing three times with PBS, 200-fold diluted Alexa Flour ( ^TM) labeled goat anti-rabbit Ig (G + H) (Molecular Probe) was added and incubated at room temperature for 1 hour. After washing three times with PBS, a fluorescent image was inserted with a lumino-image analyzer LAS1000 (FUJIFILM), and the plaque was measured. The results are shown in Fig. Table 3 shows the results of the titer obtained therefrom.
[309] The results of the titer of each recombinant Sendai virus measured from the results of Table 3 plaque assay
[310]
[311] &Lt; Comparison of reporter gene expression >
[312] LLC-MK2 cells were plated on a 6-well plate at 1 to 5 × 10 ⁵ cells per well and cultured for 24 hours. Each viral vector was infected with moi = 2. After 24 hours, 100 μl of culture supernatant was collected, I did the Sei. The assay was performed with the Reporter Assay Kit -SEAP- (Toyobo) and measured with a luminometer imagerizer LAS1000 (FUJIFILM). The measured values were expressed as relative values with SeV18 + / SEAP value being 100. As a result, SEAP activity was detected even when the SEAP gene was inserted at any position shown in FIG. SEAP activity was found to be lowered, that is, the expression level was lowered, as it was located downstream of the genome. In addition, when the SEAP gene was inserted between the NP gene and the P gene, the intermediate expression level of the vector in which the SEAP gene was inserted upstream of the NP gene and the vector in which the SEAP gene was inserted between the P gene and the M gene was detected.
[313] [Example 16] Improvement of deletion SeV amplification efficiency by double deletion F-HN cell middle layer method
[314] In the currently used reconstitution method of SeV virus, since the recombinant vaccine (vTF7-3) expressing T7 RNA polymerase is used, the infected cells are partially killed by cytotoxicity of vaccinia, and reconstruction is performed Although it is possible to amplify the virus in some of the cells that have been performed, it is desirable to allow efficient and continuous amplification in more cells. However, it has been known that, in the case of paramyxoviruses, the F and HN proteins of the homologous virus coexist on the cell surface to cause cell fusion, resulting in the formation of syncytium (Lamb and Kolakofsky, 1996, Fields virology, p. As a result, the passage of FHN coexpressing cells was difficult. Therefore, it was thought that the recovery efficiency of the deletion virus can be improved by superposing helper cells newly expressing deletion proteins (F and HN) in these reconstructed cells. The efficiency of recovery of FHN null virus virus was greatly improved by reviewing the stratification of FHN expression induction time with other cells.
[315] LLC-MK2 cells (1 x 10 ⁷ / dish) that had been 100% confluent in a 10 cm cell culture dish were treated with PLWUV-treated vaccinia at room temperature with moi = 2 for 1 hour after infection, d2 EGFP loaded FHN The resulting cDNAs (pSeV18 ⁺ / FHN-d2GFP (Example 8), pGEM / NP, pGEM / P, pGEM / L and pGEM / FHN were applied to 12 ㎍ / 10 cm dish, 4 ㎍ / 10 cm dish, (Final volume, 3 ml / 10 cm dish), and using the gene introduction reagent SuperFect (QIAGEN), the above-mentioned F deletion MK2 cells were transfected into LLC-MK2 cells in the same manner as the reconstitution of viruses. After 3 hours of transfection, the cells were washed three times with serum-free medium, and the cells detached with low speed centrifugation (1000 rpm / 2 min) Serum MEM medium containing cytosine β-D-arabinofuranoside (AraC) (40 μg / ml, SIGMA) and trypsin (7.5 μg / ml, GIBCO), and the cells were added to the cells overnight. FHN co-expressing cells, which were 100% confluent in a 10 cm chalet prepared separately, were induced to express MOI = 10 with adenovirus AxCANCre. Cells at 4 hours, 6 hours, 8 hours, The cells were washed once with PBS (-), the cells were removed by cell dissociation solution (SIGMA), and the cells were collected using a low speed centrifuge (1000 rpm / 2 min) Mu] g / ml, GIBCO), and the cells were added to the reconstituted cells (P0) of the FHN pellet-bearing virus and cultured overnight. Cells were observed under a fluorescence microscope on the second day after the cell layer, and the spread of the virus was confirmed by the expression of GFP in the cells. The results are shown in Fig. Compared with the conventional case (left), which does not have the cell layer, the GFP-expressing cells were significantly recognized in the layered cell side when the cells were overlapped (right). These cells were collected and suspended in Opti-MEM medium (Gibcol) at 10 ⁷ cells / ml to prepare a lyse that was frozen and thawed three times. Expression induction was performed and 10 ⁶ cells / 100 The cells were cultured in a serum-free MEM medium containing AraC (40 μg / ml, SIGMA) and trypsin (7.5 μg / ml, GIBCO) for 2 days in a 37 ° C. 5% CO ₂ incubator Were measured by CIU-GFP (Table 4). As a result, the amplification effect of the virus was not observed at 4 hours after induction of FHN expression, and the amplification effect by the cell layer after induction 6 hours was remarkably recognized. In particular, the virus released into the P1 cell supernatant increased about 10 times as compared to the cell layer without cell layer after 6 hours.
[316] Table 4 Double deletion &amp; Delta SeV amplification by F-HN cell layer method
[317]
[318] [Example 17] Confirmation that pseudotype type Sendai virus has F-deleted genome
[319] It was examined by Western analysis of infected cell extract protein that the virus propagated by VSV-G gene expression was F deletion type. As a result, a protein derived from Sendai virus was detected, but F protein was not detected, and it was confirmed to be F-deleted (Fig. 50).
[320] [Example 18] Influence of pseudotyped Sendai virus having genome deficient in F and HN genes by infectious effect by anti-VSV antibody
[321] Regarding whether the pseudotype Sendai virus carrying the genome deficient in F and HN genes obtained using the VSV-G expression strain has the VSV-G protein in the envelope, the anti-VSV antibody is used to neutralize whether infectivity is affected Activity. The viral solution and the antibody were mixed and allowed to stand at room temperature for 30 minutes. Thereafter, LLCG-L1 cells not inducing VSV-G were infected and the gene-transferring ability on the fourth day was examined for the presence or absence of GFP-expressing cells. As a result, pseudo-type Sendai virus (VSV-G on the way) having a genome deficient in F and HN genes was confirmed to have complete inhibition of infectivity in anti-VSV antibody, but Sendai virus (F, HN in the middle) (Fig. 51). From this, it was clear that the virus obtained in this Example is a pseudo-type Sendai virus having a VSV-G protein in its outer skin, and its infectivity is specifically suppressed by the antibody.
[322] [Example 19] Purification using density gradient ultracentrifugation of pseudo-type Sendai virus having a genome with deletion of F gene and F and HN genes
[323] Sucrose density gradient centrifugation was performed using the culture supernatant of the virus-infected cells to fractionally purify the pseudo-type Sendai virus having the genome in which the F gene and the F and HN genes were deleted. The virus solution was layered on a sucrose solution having a gradient of 20 to 60%, and the SW41 rotor (Beckman) was subjected to 29000 rpm for 15-16 hours. After ultracentrifugation, a hole was made in the bottom of the tube and fractionated by 300 [mu] l into the fraction collector. For each fraction, Western analysis was performed to confirm that the genotype of the F gene or the F and HN genes was deleted, and that the gene was a pseudo-type Sendai virus having a VSV-G protein in its outer envelope. Western analysis was performed by the method described above. As a result, in the F-deleted pseudotyped Sendai virus, the protein derived from Sendai virus, the HN protein and the VSV-G protein were detected in the fractions, but the F protein was not detected. Therefore, the F-deleted pseudo-type Sendai virus . On the other hand, in the F and HN deletion-type pseudotype Sendai virus, the protein derived from Sendai virus, VSV-G protein was detected in the fractions, but F and HN proteins were not detected, It was confirmed that the virus was Sendai virus (Fig. 52).
[324] [Example 20] Avoidance of erythrocyte aggregation reaction by pseudotype Sendai virus having a genome in which F gene and F and HN genes were deleted
[325] LLC-MK2 cells were infected with pseudo-type Sendai virus having a genome deficient in F or HN gene, or Sendai virus having an original envelope, and 1% new erythrocyte suspension was added on day 3, After the incubation, the surface of infected cells expressing GFP was observed. As a result, viruses having a genome deficient in F gene (SeV / DELTA F (VSV-G) pseudo-SeV / DELTA F and VSV-G) Pseudotype Sendai virus, together with Sendai virus having an original envelope, It was confirmed that an aggregation reaction was taking place on the surface of infected cells. On the other hand, it became apparent that no aggregation occurred on the infected cells at all in the pseudo-type Sendai virus (SeV / F-HN (VSV-G)) having genomes in which the F and HN genes were deleted (Fig. 53).
[326] [Example 21] Infection specificity of cultured cells with VSV-G pseudotyped Sendai virus having genome deficient in F gene
[327] The infection efficiency of VSV-G pseudotyped Sendai virus having the genome in which the F gene into the cultured cells was deleted was measured by using flow cytometry for the amount of GFP expressed on living cells on the third day after infection of the cells. LLC-MK2 cells exhibiting almost the same infection efficiency were compared as a control group in pseudo-type Sendai virus having genome deficient in F gene and Sendai virus having original mantle. As a result, although infection efficiency in human ovarian cancer cell HRA is almost the same as that of LLC-MK2 cells, in Jurkat cell of T cell line, infection of VSV-G pseudotype Sendai virus having a genome deficient in F gene It was observed that the efficiency was doubled (Fig. 54).
[328] [Example 22] Construction of F-deleted Sendai virus vector carrying NGF expression
[329] <Reconstruction of NGF / SeV / ΔF>
[330] Reconstitution of NGF / SeV / DELTA F was carried out according to the above-mentioned &quot; envelope plasmid + F-expressing cell double-layer method &quot;. The measurement of the titer was performed according to the method using the anti-SeV polyclonal antibody.
[331] <Confirmation of viral genome of NGF / SeV / ΔF (RT-PCR)>
[332] To identify the NGF / SeV / F viral genome (Figure 55), the culture supernatant recovered from LLC-MK2 / F7 cells was centrifuged and RNA extraction was performed according to the protocol with QIAamp Viral RNA mini kit (QIAGEN) I did. This RNA by ^{SUPERSCRIPT TM ONE-STEP TM RT-} PCR SYSTEM (GIBCO BRL) was carried out for the template synthesis and PCR of RT-PCR. As a control, an additional SeV cDNA (pSeV18 ⁺ b (+)) (Hasan, MK et al., J. General Virology 78: 2813-2820, 1997) was used. PCR primers were performed using NGF-N and NGF-C. For NGF-N, forward: ACTTGCGGCCGCCAAAGTTCAGTAATGTCCATGTTGTTCTACACTCTG (SEQ ID NO: 33) and for NGF-C reverse: ATCCGCGGCCGCGATGAACTTTCACCCTAAGTTTTTCTTACTACGGTCAGCCTCTTCTTGTAGCCTTCCTGC (SEQ ID NO: 34). As a result, when NGF-N and NGF-C were used as primers, a band specific to NGF was detected in the NGF / SeV / ΔF under the RT condition. No band was detected in the control (Fig. 55 bottom).
[333] [Example 23] Quantification of NGF protein expressed after cell infection of F deficient SeV carrying NGF gene and measurement of in vitro activity
[334] Infection and expression of NGF protein were performed using LLC-MK2 / F or LLC-MK2 cells grown with nearly confluent in 10 cm diameter or 6 cm diameter plates. NGF / SeV and GFP / SeV were infected with moi0.01 in LLC-MK2 cells and treated with 7.5 ㎍ / mL trypsin (GIBCO), NGF / SeV / △ F, NGF / SeV / And cultured in MEM medium containing no serum for 3 days. After 3 days, almost 100% of the cells were infected, and then exchanged with MEM medium containing neither trypsin nor serum, and further cultured for 3 days. Each culture supernatant was collected, centrifuged at 48,000 x g for 60 minutes, and the amount of NGF protein and in vitro activity were measured for the supernatant. In this embodiment, LLC-MK2 / F cells are infected with F-deficient SeV (NGF / SeV / F, NGF / SeV / F-GFP) Or 3), that is, infecting cells as close as 100% from the beginning, it is natural that an experiment showing the same result can be performed even in F-non-expressing cells.
[335] Quantification of NGF protein was performed using the ELISA Kit NGF Emax Immuno Assay System (Promega). The protocol followed the instructions in the attached document. The presence of NGF protein was confirmed to be 32.4 ㎍ / mL, 37.4 ㎍ / mL and 10.5 ㎍ / mL in the culture supernatants of NGF / SeV / ΔF, NGF / SeV / ΔF-GFP and NGF / SeV infected cells. Infection with NGF / SeV / ΔF and NGF / SeV / ΔF-GFP In the cell culture supernatant, there was a high concentration of NGF protein and the amount of NGF / SeV infected cells It was confirmed that a sufficient amount of NGF was expressed.
[336] In vitro activity measurement of NGF protein was performed by using survival activity as a marker in the primary neuronal cell culture system of the root ganglion, a sensory nerve of chicken (Nerve Growth Factors (Wiley, New York), pp. 95-109 (1989)). The posterior ganglia were removed from 10-day-old chicken embryos and dispersed in 0.25% Trypsin (GIBCO) for 20 min at 37 ° C. (Gibco), 100 units / mL streptomycin (Gibco), 250 ng / mL amphotericin B (Gibco), 20 μM 2-deoxyuridine (Nakarai) and 20 μM 5-fluorodeoxyuridine , 2 mM L-glutamine (Sigma) and 5% serum were used to initiate culturing at about 5000 cell density per well on a 96-well plate. Plates were prepared by first coating 96-well plates (Iwaki) with polylysine and then coating again with laminin (Sigma). At the start of the culture, NGF protein as the control group or the culture supernatant after the SeV infection prepared earlier was added. After 3 days, cells were observed under a microscope and Alamer blue (CosmoBio) was added to measure the fluorescence intensity of 590 nm excited at 530 nm as an indicator of reduction activity by mitochondria. . The fluorescence intensity showing the same degree of viability was observed in the addition of the infected cell culture supernatant (1/1000 dilution) of the control (without NGF addition) and the SeV / addition type-GFP (GFP / SeV), but NGF / SeV / The infectious cell culture supernatant of SeV / [Delta] F-GFP and NGF / SeV was added (1/1000 dilution) to show remarkable increase in fluorescence intensity. The value was comparable to the addition of the amount of NGF protein determined by ELISA. The same was visually observed under a microscope and the increase in viable count and prominent neurite elongation were observed by adding infected cell culture supernatants of NGF / SeV / DELTA F, NGF / SeV / DELTA F-GFP and NGF / (Fig. 57). That is, it was confirmed that NGF expressed by infection with NGF-loaded F-deficient SeV was expressed as an active form.
[337] [Example 24] Detailed analysis of F-expressing cells
[338] 1) moi and induction time of Adeno-Cre
[339] The expression of F protein was induced by infection with LLC-MK2 / F using moi of other Adeno-Cre, and the amount of protein and cell morphology were examined.
[340] The expression level of moi = 10 was slightly higher than that of moi = 1 (FIG. 58). However, the expression levels at 6 hours, 12 hours, 24 hours, and 48 hours after induction were examined, F protein expression was high.
[341] In addition, although morphological changes of cells were observed over time by infecting cells with moi = 1, 3, 10, 30, and 100, no significant difference was observed between cells until moi = 10, Injury was observed (Fig. 59).
[342] 2) Number of passages
[343] The expression of F protein was induced in LLC-MK2 / F using Adeno-Cre, and the amount of cell F and cell morphology were examined under microscope for up to 7 mice. On the other hand, the presence of F protein in the cytoplasm was examined using a laser microscope up to 20 years after F protein expression was induced.
[344] In the observation with a laser microscope, LLC-MK2 / F cells inducing the expression of F protein were introduced into the chamber glass and incubated overnight. After the culture medium was removed, the cells were washed once with PBS, and then treated with 3.7% Formalin- Fixed for a minute. Cells were washed once with PBS and then treated with 0.1% Triton X100-PBS for 5 minutes to obtain anti-F protein monoclonal antibody (γ-236) (100-fold dilution) and FITC-labeled goat anti-rabbit IgG antibody 200 times). Cells were finally washed with PBS and observed with a laser microscope.
[345] As a result, there was no difference in the expression amount of F protein in the senescent cells until the 7th generation (Fig. 60). There was no significant difference in morphological and infectivity and productivity of SeV. On the other hand, when the presence of F protein in the cells was examined by immune antibody method until the 20th generation, the localization tendency of the F protein was observed in the cells of the abnormal cells until the 15th generation (Fig. 61 ).
[346] From the above results, it is judged that cells up to the 15th passage after passage are preferable for the production of F-deficient SeV.
[347] [Example 25] Correlation between GFP-CIU and anti-SeV-CIU
[348] The correlation between the measurement results of the CIU (cell-infected unit) by the two methods was examined. LLC-MK2 cells were plated on a 12-well plate at 2 × 10 ⁵ cells / dish, cultured for 24 hours, washed once with MEM-free medium, and then SeV / ΔF-GFP was added to 100 μl / well Infected. After 15 minutes, MEM medium containing no serum was added to 1 ml / well and further cultured for 24 hours. After incubation, the cells were washed three times with PBS (-), the cells were dried (left at room temperature for about 10 minutes to 15 minutes), and acetone was immediately added to 1 ml / well to fix the cells and dried again Leave at room temperature for about 10 to 15 minutes). 300 μl / well of the SeV polyclonal antibody (DN-1) prepared from the rabbit diluted 100-fold with PBS (-) was added and incubated at 37 ° C for 45 minutes, washed three times with PBS (-), 300 [mu] l / well of an anti-rabbit IgG (H + D) fluorescent secondary antibody (Alex ^TM 568: manufactured by Molecular Probes) diluted 200 times with 200 times dilution was added and incubated at 37 ° C for 45 minutes. After washing three times with PBS (-), fluorescence-emitting cells were observed under a fluorescence microscope (Emission: 560 nm, Absorption: 645 nm filter: manufactured by Leica).
[349] As a control, SeV / F-GFP was infected at 100 占 퐇 / well. After 15 minutes, MEM without serum was added at 1 ml / well, and the cells were further cultured for 24 hours and then subjected to fluorescence microscopy (Emission: 360 nm, Absorption: 470 nm filter: manufactured by Leica).
[350] The fluorescence intensity of both was quantified and the relationship was evaluated, showing a good correlation (Fig. 62).
[351] [Example 26] Construction of multicloning site
[352] The multicloning site was added to the SeV vector. The following two methods.
[353] 1) A new restriction enzyme site containing a restriction enzyme site destroying several restriction sites of genome cDNA of Sendai virus (SeV) and cDNA of pSeV18 ⁺ was inserted between the start signal of each gene and the ATG translation initiation signal .
[354] 2) The multi-cloning site sequence and the transcription initiation signal-intervening sequence-termination signal are added to the already constructed SeV vector cDNA and inserted into the NotI site.
[355] 1), a fragment (2644 bp) obtained by digesting pSeV18 ⁺ with Eag I, a fragment digested with Cla I (3246 bp), a fragment digested with ClaI / Eco RI (5146 bp) and Eco RI (5010 bp) were separated by agarose electrophoresis, and the corresponding bands were cut out and recovered and purified by QIAEX II Gel Extraction System (QIAGEN). The fragments digested with Eag I were ligated to pBluescriptII KS + (manufactured by STRATAGENE), and the fragments digested with ClaI / Eco RI and Eco RI were ligated to pBluescript II KS + (manufactured by STRATAGENE) Cloned. A Quickchange Site-Directed Mutagenesis kit (manufactured by STRATAGENE) was used for destroying and introducing the restriction enzyme site.
[356] 3 (SEQ ID NO: 36), 5'-ctgatcgattatcttgggtggacggtgttgagacttctcc-3 '(SEQ ID NO: 36), Nhe I: (sense strand) 5'-ggagaagtctcaacaccgtccacccaagataatcgatcag- 3 '(SEQ ID NO: 38), Xho I (sense strand) 5'-caatgaactctctagagaggctggagtcactaaagagttacctgg-3' (SEQ ID NO: 37), (antisense chain) 5'-gccttagaccgacagcaagctcaactgaacacatatac- (SEQ ID NO: 39), (antisense chain) 5'-ccaggtaactctttagtgactccagcctctctagagagttcattg-3 '(SEQ ID NO: 40) , (antisense chain) 5'-cggtggggttgggtgtggcctcgagtgagccgatcggtggatgaactttcac-3 '(SEQ ID NO: 42), between the PM :( sense chain) 5'-cttagggtgaaagaaatttcagctagcacggcgcaatggcagatatc-3' (SEQ ID NO: 43), (antisense chain) 5'-gatatctgccattgcgccgtgctagctgaaatttctttcaccctaag-3 (SEQ ID NO: 44), between MF :( 3 '(SEQ ID NO: 46), F-HN Between 5'-ggtcgcgcggtactttagtcgacacctcaaacaagcacagatcatgg-3' (SEQ ID NO: 45), (antisense chain) 5'-ggggagagttttccaaccaagcgcgcacaagggactttatccctaag- (SEQ ID NO: 49), (antisense chain) 5'-ccatgatctgtgcttgtttgaggtgtcgactaaagtaccgcgcgacc-3 '(SEQ ID NO: 48), between HN-L: (sense chain) 5'-cccagggtgaatgggaagggccggccaggtcatggatgggcaggagtcc-3' Antisense chain) 5'-ggactcctgcccatccatgacctggccggcccttcccattcaccctggg-3 '(SEQ ID NO: 50) were each synthesized and used in the reaction. After introduction, each fragment was recovered and purified in the same manner as described above, and cDNA was assembled.
[357] 2), 5'-ggccgcttaattaacggtttaaacgcgcgccaacagtgttgataagaaaaacttagggtgaaagttcatcac-3 '(SEQ ID NO: 51), (antisense chain) 5'-ggccgtgatgaactttcaccctaagtttttcttatcaacactgttggcgcgcgtttaaaccgttaattaagc-3' (SEQ ID NO: 52) Annealed at 85 캜 for 2 minutes, at 65 캜 for 15 minutes, at 37 캜 for 15 minutes, and at room temperature for 15 minutes, and inserted into SeV cDNA. Or a multicloning site such as pUC18 or pBluescriptII is subcloned by PCR with a primer containing a termination signal sequence-initiation signal, and this is inserted into SeV cDNA. Virus reconstitution in the resulting cDNA is performed as described above.
[1] The present invention relates to an envelope gene-deleted paramyxovirus vector.
[358] According to the present invention, a paramyxovirus vector deficient in the envelope gene was provided. The present invention is the first to establish a practically usable new envelope gene-deleted vector system based on a negative strand RNA virus. The success of the F gene deletion using helper cells and the recovery of infectious defective viral particles from the FHN gene deletion genome cDNA paved the way for the research and development of novel gene therapy vectors taking advantage of the excellent features of Sendai virus. The transduced Sendai virus vector of the present invention has the ability to transiently express foreign genes with extremely high transfection efficiency for macrophage cells. Furthermore, it is a highly safe vector that completely eliminates the virus propagation since it is continuously expressed in infected cells and does not release secondary infectious viral particles.

权利要求:
Claims (13)
[1" claim-type="Currently amended] (a) a negative strand single strand RNA derived from a paramyxovirus that has been modified so as not to express at least one envelope protein of a paramyxovirus and (b) a complex of a protein that binds to said negative strand single strand RNA Paramecable beef and virus vector.
[2" claim-type="Currently amended] The vector according to claim 1, wherein the negative strand single strand RNA is modified to express NP protein, P protein and L protein and not F protein and / or HN protein.
[3" claim-type="Currently amended] 3. The vector according to claim 1 or 2, wherein the vector comprises at least one of the envelope proteins modified so as not to express in the negative strand single stranded RNA.
[4" claim-type="Currently amended] 4. The vector according to any one of claims 1 to 3, comprising a VSV-G protein.
[5" claim-type="Currently amended] 5. The vector according to any one of claims 1 to 4, wherein the negative strand single strand RNA is derived from Sendai virus.
[6" claim-type="Currently amended] 6. The vector according to any one of claims 1 to 5, wherein the negative strand single stranded RNA further codes for a foreign gene.
[7" claim-type="Currently amended] 7. A negative strand single-stranded RNA contained in the vector of any one of claims 1 to 6 or a DNA encoding the complementary strand thereof.
[8" claim-type="Currently amended] 7. A method for producing a vector according to any one of claims 1 to 6,
(a) introducing a negative strand single strand RNA derived from a paramyxovirus modified to not express at least one envelope protein of a paramyxovirus and a vector DNA encoding the complementary strand into a cell expressing the envelope protein A step of expressing, and
(b) culturing said cells, and recovering viral particles from the culture supernatant.
[9" claim-type="Currently amended] 7. A method for producing a vector according to any one of claims 1 to 6,
(a) expressing a complex comprising a negative strand single strand RNA derived from a paramyxovirus modified to not express at least one envelope protein of a paramyxovirus and a protein binding to said negative strand single strand RNA, Into cells,
(b) culturing said cells, and recovering viral particles from the culture supernatant.
[10" claim-type="Currently amended] 10. The method according to claim 8 or 9, wherein the culturing of the cells in the step (b) is a co-culture with cells expressing the envelope protein.
[11" claim-type="Currently amended] The method according to claim 8 or 9, wherein in culturing the cells in the step (b), cells expressing the envelope protein are overlaid and cultured.
[12" claim-type="Currently amended] 12. The method according to any one of claims 8 to 11, wherein at least one of the envelope proteins expressing the cells is identical to at least one of the envelope proteins modified so as not to be expressed in the negative strand RNA.
[13" claim-type="Currently amended] 13. The method according to any one of claims 8 to 12, wherein at least one of the envelope proteins expressing the cells is a VSV-G protein.

类似技术:

---

公开号 | 公开日 | 专利标题

---

US20190032059A1|2019-01-31|Gene Vector

---

US9023603B2|2015-05-05|Recombinant influenza viruses for vaccines and gene therapy

---

Finke et al.2005|Replication strategies of rabies virus

---

US7332169B2|2008-02-19|Newcastle disease virus infectious clones, vaccines and new diagnostic assays

---

Collins et al.1995|Production of infectious human respiratory syncytial virus from cloned cDNA confirms an essential role for the transcription elongation factor from the 5'proximal open reading frame of the M2 mRNA in gene expression and provides a capability for vaccine development

---

Panda et al.2004|Role of fusion protein cleavage site in the virulence of Newcastle disease virus

---

EP1194580B2|2010-08-25|In vitro reconstitution of segmented negative-strand rna viruses

---

Mebatsion et al.1996|Highly stable expression of a foreign gene from rabies virus vectors

---

JP4558203B2|2010-10-06|Recombinant Newcastle disease virus RNA expression system and vaccine

---

He et al.1997|Recovery of infectious SV5 from cloned DNA and expression of a foreign gene

---

Kato et al.1996|Initiation of Sendai virus multiplication from transfected cDNA or RNA with negative or positive sense

---

Kurotani et al.1998|Sendai virus C proteins are categorically nonessential gene products but silencing their expression severely impairs viral replication and pathogenesis

---

ES2373405T3|2012-02-03|Recombinant flu viruses for vaccines and gene therapy.

---

KR100754091B1|2007-08-31|--strand RNA virus vector having autonomously replicating activity

---

US7510706B2|2009-03-31|Pseudotype retroviral vectors containing membrane proteins having hemagglutinin activity

---

Nagai1999|Paramyxovirus replication and pathogenesis. Reverse genetics transforms understanding

---

Garcin et al.1995|A highly recombinogenic system for the recovery of infectious Sendai paramyxovirus from cDNA: generation of a novel copy‐back nondefective interfering virus.

---

Desmaris et al.2001|Production and neurotropism of lentivirus vectors pseudotyped with lyssavirus envelope glycoproteins

---

US20050266566A1|2005-12-01|Recombinant sendai virus

---

Roberts et al.1998|Recovery of negative-strand RNA viruses from plasmid DNAs: a positive approach revitalizes a negative field

---

CA2484538C|2014-03-25|Vectors with modified protease-dependent tropism

---

US8217019B2|2012-07-10|AIDS virus vaccines using Sendai virus vector

---

Nagai et al.1999|Paramyxovirus reverse genetics is coming of age

---

Pfaller et al.2015|Reverse genetics of Mononegavirales: How they work, new vaccines, and new cancer therapeutics

---

KR100852078B1|2008-08-13|Paramyxovirus vector for gene transfer to the cardiovascular system

同族专利:

---

公开号 | 公开日

---

JP3602058B2|2004-12-15|

---

KR20070058607A|2007-06-08|

---

KR100739938B1|2007-07-16|

---

AU4614600A|2000-12-05|

---

EP1186667B1|2007-07-18|

---

AT367445T|2007-08-15|

---

DE60035589T2|2008-04-17|

---

DK1186667T3|2007-10-22|

---

DE60035589D1|2007-08-30|

---

HK1044352A1|2007-12-14|

---

CN1355851A|2002-06-26|

---

WO2000070070A1|2000-11-23|

---

CA2368948A1|2000-11-23|

---

CA2368948C|2013-12-24|

---

JP2004329222A|2004-11-25|

---

ES2288473T3|2008-01-16|

---

EP1186667A4|2004-06-30|

---

CN1330767C|2007-08-08|

---

EP1186667A1|2002-03-13|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

法律状态:
1999-05-18|Priority to JP20073999

---

1999-05-18|Priority to JPJP-P-1999-00200739

---

2000-05-18|Application filed by 나카토미 히로타카, 가부시키가이샤 디나벡크 겐큐쇼

---

2002-02-25|Publication of KR20020014786A

---

2007-07-16|Application granted

---

2007-07-16|Publication of KR100739938B1

优先权:

---

申请号 | 申请日 | 专利标题

---

JP20073999|1999-05-18|

---

JPJP-P-1999-00200739|1999-05-18|