• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    The present invention relates to a supplemental enzyme derived from Corynebacterium glutamicum that supplements oxaloacetate consumed during lysine and glutamic acid production in industrial fermentation. Specifically, the present invention provides an isolated nucleic acid molecule encoding a pyruvate carboxylase protein. Also provided are pyruvate carboxylase polypeptides.
    公开号:KR20010112232A
    申请号:KR1020017007962
    申请日:1998-12-23
    公开日:2001-12-20
    发明作者:신스키앤소니제이.；리자드필립에이.；윌리스로라비.
    申请人:자밀라 제트. 허벡；메사추세츠 인스티튜트 오브 테크놀로지；
    IPC主号:
    专利说明:

    Pyruvate carboxylase derived from Corynebacterium glutamicum {PYRUVATE CARBOXYLASE FROM CORYNEBACTERIUM GLUTAMICUM}
    [2] Pyruvate carboxylase is an important analytic enzyme that supplements oxaloacetate, which is required for biosynthesis during growth, or for the production of lysine and glutamic acid in the fermentation industry.
    [3] The two-step reaction mechanism where pyruvate carboxylase is used as the reaction catalyst is as follows:
    [4] (One)
    [5] MgATP + HCO 3- + ENZ - Biotin-(Mg 2+ Acetyl-CoA) → MgADP + Pi + ENZ-Biotin-CO 2
    [6] (2)
    [7] ENZ-Biotin-CO - 2 + Pyruvate ------ → ENZ-Biotin + Oxaloacetate
    [8] In reaction (1), the ATP-dependent biotin carboxylase domain carboxylates a biotin complement molecule group linked to the specific lysine residue of the biotin-carboxyl-carrier protein (BCCP) domain. Acetyl-CoA (acetyl-coenzyme A) activates reaction (1) by increasing the rate of bicarbonate-dependent ATP degradation. In reaction (2), the BCCP domain donates CO 2 to pyruvate in a reaction in which the transcarboxylase domain acts as a catalyst. Attwood, PV, Int. J. Biochem. Cell. Biol. 27: 231-249 (1995).
    [9] Pyruvate carboxylase genes are described in Rhizobium etli (Dunn, MF et al., J. Bactreiol. 178: such as Kondo, H., Gene 191:: 5960-5970 (1996)], a brush Russ (Bacillus stearothermophilus) [referred to as a Bacillus stearate 47-50 (1997)], Bacillus subtilis (Bacillus subtillus) (Gene Bank Accession number Z97025), Mycobacterium tuberculosis (Ginbank accession number Z83018) and Methanobacterium thermoautotrophicum ( Mukobacterium thermoautotrophicum ), see Mukhopadhyay, B., J. Biol. Chem. 273: 5155-5166 (1988), the sequence was also determined. Pyruvate carboxylase activity is reported by Brevibacterium lactofermentum (Tosaka, O. et al., Agric. Biol. Chem. 43: 1513-1519 (1979)] and Corynebacterium Glutamicum (Peters-Wendisch, PG et al., Microbiology 143: 1095-1103 (1997)).
    [10] As can be seen from previous studies, the yield and productivity of aspartate amino acids depend critically on the carbon influx through the supplemental route. Vallino, J. J., & Stephanopoulos, G., Biotechnol. Bioeng. 41: 633-646 (1993)]. Based on the balance of metabolites, it can be seen that the rate of lysine production is later than or equal to the rate of oxaloacetate synthesis by the replenishment pathway.
    [1] The present invention relates to Corynebacterium Glutamicum pyruvate carboxylase protein and polynucleotides encoding the protein.
    [23] FIG. 1 shows the nucleotide sequence (SEQ ID NO: 1) and the deduced amino acid sequence (SEQ ID NO: 2) of the complete pyruvate carboxylase protein determined by sequencing of the DNA clone contained in ATCC Accession No. _______. The protein has a sequence consisting of about 1140 amino acid residues and an estimated molecular weight of about 123.6 kDa.
    [24] Detailed description of the invention
    [25] The present invention provides an isolated nucleic acid molecule comprising a pulleynucleotide encoding a pyruvate carboxylase protein having the amino acid sequence shown in FIG. 1 (SEQ ID NO: 2) determined by sequencing of the cloned cosmid. The pyruvate carboxylase protein of the invention is M. a. It shares sequence homology with M. tuberculosis and human pyruvate carboxylase proteins. The nucleotide sequence (SEQ ID NO: 1) shown in FIG. 1 was deposited at _______ in the United States Bacterial Culture Collection (ATCC), Manassas University Boulevard 10801, Virginia 20110-2209, USA, and was assigned the accession number _______. Obtained by sequencing cosmid III F10 encoding a bait carboxylase polypeptide.
    [26] Nucleic acid molecule
    [27] Unless stated otherwise, all nucleotide sequences determined by sequencing of DNA molecules herein are determined using an automated DNA sequencing device (eg, ABI Prism 377), and polypeptides encoded by the DNA molecules determined herein. All amino acid sequences of were predicted by translation of the DNA sequence determined as described above. Thus, any DNA sequence determined by such automated sequencing methods may contain some errors as any nucleotide sequence determined herein is known in the art. The nucleotide sequence determined by automated sequencing is generally at least about 90%, more typically at least about 95% to at least about 99.9% identical to the actual nucleotide sequence of the sequenced DNA molecule. The actual sequence can be determined more accurately by other methods, including manual DNA sequencing methods known in the art. In addition, as is known in the art, a single insertion or deletion in a nucleotide sequence determined compared to the actual sequence causes lattice shift in translation of the nucleotide sequence such that the expected amino acid sequence encoded by the determined nucleotide sequence is It will be completely different from the amino acid sequence actually encoded by the DNA molecule sequenced from the deletion point.
    [28] Unless stated otherwise, each "nucleotide sequence" used herein is shown as a sequence consisting of deoxyribonucleotides (abbreviations A, G, C and T). However, the "nucleotide sequence" of a nucleic acid molecule or polynucleotide means a sequence consisting of deoxyribonucleotides in the case of a DNA molecule or polynucleotide, and ribonucleotides (A, G, C and U in the case of RNA molecules or polynucleotides). Means a corresponding sequence, wherein each thymidine deoxynucleotide (T) in the specified deoxynucleotide sequence is replaced with a ribonucleotide uridine (U). For example, an RNA molecule having a sequence of SEQ ID NO: 1 described using deoxyribonucleotide abbreviations replaces each deoxynucleotide A, G, or C of SEQ ID NO: 1 with a corresponding ribonucleotide A, G, or C Each deoxynucleotide T is intended to represent an RNA molecule having a sequence replaced with ribonucleotide U.
    [29] Using the information provided herein, for example the nucleotide sequence of FIG. 1, the nucleic acid molecules of the present invention encoding pyruvate carboxylase polleptides are standard cloning methods such as methods for DNA cloning using mRNA as starting material. And the screening process. Pyruvate carboxylase protein (SEQ ID NO: 2) shown in FIG. About 63% identical to pyruvate carboxylase protein in M. tuberculosis and 44% identical to human pyruvate carboxylase protein. As will be appreciated by those skilled in the art, due to the error in the sequence determination described above and the variability of the cleavage site for the leader sequence in different known proteins, the substantial pyruvate carboxylase polypeptide encoded by the deposited cosmid may be about 1140 amino acids. But may optionally include amino acids in the range 1133 to 1147.
    [30] As noted above, the nucleic acid molecules of the present invention may be cDNA and genomic DNA obtained or synthesized in RNA form, for example mRNA or DNA form, for example by cloning. The DNA may be double stranded or single stranded. Single-stranded DNA or RNA may be a coding strand known as a sense strand, or may be a non-coding strand known as an antisense strand.
    [31] As used herein, the term “isolated” nucleic acid molecule (s) means a nucleic acid molecule, DNA or RNA, and is isolated from its natural environment. For example, recombinant DNA molecules contained in a vector are nucleic acid molecules isolated for the purposes of the present invention. Still other examples of isolated DNA molecules include recombinant DNA molecules maintained in heterologous host cells or purified (partially or substantially) DNA molecules in solution. Isolated RNA molecules include RNA transcripts of the DNA molecules of the invention in vivo or in vitro. Isolated nucleic acid molecules according to the present invention further comprise a synthesized molecule.
    [32] An isolated nucleic acid molecule of the present invention comprises a DNA molecule comprising an open reading frame (ORF) having an initiation codon at positions 199 to 201 of the nucleotide sequence shown in FIG. 1 (SEQ ID NO: 1); A DNA molecule comprising a coding sequence for the pyruvate carboxylase protein shown in FIG. 1 and SEQ ID NO: 2; And DNA molecules encoding sequences of pyruvate carboxylase proteins of the invention due to degeneracy of the genetic code, including sequences substantially different from the above DNA molecules. Of course, genetic code is known in the art. Thus, generating degenerate variants as described above is common to those skilled in the art.
    [33] In another aspect, the present invention provides an isolated nucleic acid molecule encoding a pyruvate carboxylase polypeptide having an amino acid sequence encoded by a cosmid clone deposited with ATCC Accession No. ______. Preferably, the nucleic acid molecule encodes a polypeptide encoded by the deposited clone. The present invention is also complementary to an isolated nucleic acid molecule having the nucleotide sequence shown in FIG. 1 (SEQ ID NO: 1) or the nucleotide sequence of pyruvate carboxylase DNA contained in the above deposited clone, or one of the sequences. Provided are nucleic acid molecules that retain the sequence.
    [34] In another aspect, the present invention includes polynucleotides that hybridize to a portion of a polynucleotide within a cosmid clone contained in the nucleic acid molecule of the present invention as described above, eg under ATCC Accession No. _______, under stringent hybridization conditions. Provided are isolated nucleic acid molecules. The "strict hybridization conditions" are 50% formamide, 5x SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5x Denhardt's solution, 10% dextran sulfate, and denaturation, Incubating overnight at 42 ° C. in a solution containing 20 μg / ml of sheared salmon sperm DNA and washing the filter in 0.1 × SSC at about 65 ° C. Polynucleotides that hybridize to “parts” of polynucleotides hybridize to at least 15 nucleotides (nt), more preferably at least about 20 nucleotides, and even more preferably from about 30 to 70 nucleotides of the reference polynucleotide. It means a polynucleotide (DNA or RNA). These are useful as diagnostic probes and primers.
    [35] Of course, a polynucleotide that hybridizes to a larger portion of the reference polynucleotide (eg, deposited cosmid clone), for example a portion that is 50 to 750 nucleotides in length or a full-length reference polynucleotide, is Useful as probes according to the invention, these are polynucleotides corresponding to most (but not all) of the nucleotide sequence of deposited DNA or the nucleotide sequence (SEQ ID NO: 1) as shown in FIG. For example, a portion of a polynucleotide that is "a nucleotide of length 20 or more" may comprise at least 20 or more derived from a reference polynucleotide (e.g., deposited DNA or nucleotide sequence as shown in Figure 1 (SEQ ID NO: 1)). By contiguous nucleotides. As noted above, such moieties are diagnostically useful as primers for amplification of target sequences by probes or polymerase chain reaction (PCR) according to conventional DNA hybridization techniques. See Sambrook, J., Fritsch, EF. And Maniatis, T., in Molecular Cloning, A Laboratory Manual (2nd Edition), Cold Spring Harbor Laboratories (1989); Incorporated herein by reference in its entirety.
    [36] Since the pyruvate carboxylase cosmid clone has been deposited and its determined nucleotide sequence is shown in Figure 1 (SEQ ID NO: 1), generating a polynucleotide that hybridizes to a portion of the pyruvate carboxylase DNA molecule It is common to those skilled in the art. For example, DNA fragments of various sizes, which are polynucleotides that hybridize to portions of pyruvate carboxylase DNA molecules using restriction endonuclease cleavage or ultrasonic shearing of pyruvate carboxylase cosmid clones, are readily available. Can be generated. In addition, polynucleotides hybridized according to the present invention can also be synthesized by known techniques.
    [37] As already described, nucleic acid molecules of the present invention encoding pyruvate carboxylase protein polypeptides include nucleic acid sequences encoding amino acid sequences of the polypeptides themselves; Coding sequences for said polypeptides and further sequences, eg, pre- or pro- or prepro-protein sequences; Intron and non-coding 5 'and 3' sequences, such as transcription, mRNA processing (e.g., splicing) together with the coding sequence of said polypeptide, with or without said additional coding sequence ) And transcribed untranslated sequences that play a role in polyadenylation signals (eg, ribosomal binding and mRNA stability); Additional coding sequences that encode additional amino acids, such as amino acids that provide additional functions, include, but are not limited to. Thus, the sequence encoding the polypeptide can be fused to a marker sequence, eg, a sequence encoding a peptide that facilitates purification of the fused polypeptide. In certain embodiments according to this aspect of the invention, the marker amino acid sequence is a hexa-histidine peptide, such as a tag provided to a pQE vector (Qiagen, Inc.) and the like, and many kinds are commercially available. See, eg, Gentz et al., Proc. Natl. Acad. Sci., USA 86: 821-824 (1989), hexa-histidine is provided for convenient purification of the fusion protein. The "HA" tag is another peptide useful for purification corresponding to epitopes derived from influenza hemagglutinin protein (Wilson et al., Cell 37: 767 (1984)).
    [38] The invention also relates to variants of the nucleic acid molecules of the invention, which variants encode portions, analogs or derivatives of pyruvate carboxylase proteins. Variants may also occur naturally, such as natural allelic variants. "Allele variant" means one of several alternative forms of a gene that occupies a given locus on an chromosome of an organism (Lewin, Genes II). Non-naturally occurring variants can be prepared using known mutagenesis techniques.
    [39] Such variants include those produced by nucleotide substitutions, deletions or additions. The substitution, deletion or addition may involve one or more nucleotides. The variant may be modified in a coding region or a non-coding region or both. Alterations in the coding region can result in conservative or non-conservative amino acid substitutions, deletions or additions. Especially preferred of these are silent substitutions, additions and deletions that do not alter the properties or activity of the pyruvate carboxylase protein or portions thereof. Also particularly preferred in this respect are conservative substitutions. A nucleic acid molecule encoding a pyruvate carboxylase protein having the amino acid sequence shown in FIG. 1 (SEQ ID NO: 2) is strongly preferred.
    [40] In addition, pyruvate carboxylase is seed. Mutant or mutant strains that are expressed 2 to 20 times or more than those expressed in C. Glutamicum and feedback inhibiting mutant strains are preferred.
    [41] Another embodiment of the invention
    [42] (a) a nucleotide sequence encoding a pyruvate carboxylase polypeptide having the complete amino acid sequence of SEQ ID NO: 2;
    [43] (b) a nucleic acid sequence encoding a pyruvate carboxylase polypeptide having a complete amino acid sequence encoded by a cosmid clone contained in ATCC Accession No. ________; or
    [44] (c) a nucleic acid sequence that is at least 90%, more preferably at least 95%, at least 97%, at least 98%, or at least 99% identical to the nucleotide sequence complementary to any of the nucleotide sequences of (a) or (b) above; It relates to an isolated nucleic acid molecule comprising a holding polynucleotide.
    [45] A reference nucleotide sequence encoding a pyruvate carboxylase polypeptide and a polynucleotide having, for example, at least 95% "identical" nucleotide sequence, means that the nucleotide sequence of the polynucleotide is identical to the reference sequence, provided that The polynucleotide sequence is meant to include less than five point mutations for each 100 nucleotides of the reference nucleotide sequence encoding the pyruvate carboxylase polypeptide. In other words, to obtain a polynucleotide having a nucleotide sequence that is at least 95% identical to a reference nucleotide sequence, up to 5% of the nucleotides of the reference sequence are deleted or substituted with another nucleotide, or the total nucleotides in the reference sequence. It means that up to 5% of nucleotides can be inserted into the reference sequence. These mutations in the reference sequence may be at any position between the 5 'or 3' end position of the reference nucleotide sequence or between these end positions individually interposed between nucleotides in the reference sequence or at least one adjacent crowd anywhere in the reference sequence. Can happen.
    [46] As a practical matter, any particular nucleic acid molecule is at least 90%, at least 95%, at least 97%, at least 98% or at least 99% with the nucleotide sequence shown in FIG. 1 or the nucleotide sequence of the deposited cosmid clone, for example. Whether they are the same is typically determined using known computer programs such as Bestfit program, Wisconsin sequencing package, version 8, for Unix, Wisconsin 53711 Madison Science Drive 575, Genetics Computer Group, University Research Park. You can decide. Bestfit uses Smith and Waterman's local homology algorithms (Advances in Applied Mathematics 2: 482-489 (1981)) to find the optimal homology segments between the two sequences. When using Bestfit or any other sequence alignment program to confirm whether a particular sequence is 95% identical to a reference sequence, for example, according to the present invention, the variables as well as the percent identity of the reference nucleotide sequence Calculated over the entire length and defined to allow up to 5% homology differences in the total number of nucleotides in the reference sequence.
    [47] The present application relates to the nucleic acid sequence shown in FIG. 1 (SEQ ID NO: 1) or to the nucleic acid sequence of deposited DNA, whether or not encoding a polypeptide having pyruvate carboxylase activity, at least 90%, at least 95%, 97 At least 98% or at least 99% identical nucleic acid molecules. This means that even if a particular nucleic acid sequence molecule does not encode a polypeptide having pyruvate carboxylase activity, the skilled person will, for example, use it as a hybridization probe or polymerase chain reaction (PCR) primer or the like. It is because how to use a nucleic acid molecule is known.
    [48] However, at least 90%, at least 95%, at least 97%, 98 with the nucleic acid sequence shown in FIG. 1 (SEQ ID NO: 1) or the nucleic acid sequence of deposited DNA that encodes a polypeptide that actually possesses pyruvate carboxylase protein activity. Preference is given to nucleic acid molecules having sequences of at least% or at least 99% identical sequences. The term "polypeptide retaining pyruvate carboxylase activity" refers to a polypeptide that exhibits similar activity that does not need to be identical to that of the pyruvate carboxylase protein of the invention, as determined by certain biological assays.
    [49] Of course, due to the degeneracy of the genetic code, one of skill in the art would be at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% with the nucleic acid sequence shown in FIG. 1 (SEQ ID NO: 1) or the nucleic acid sequence of deposited DNA. It will immediately be appreciated that multiple nucleic acid molecules bearing the same sequence will encode polypeptides "having pyruvate carboxylase activity." Indeed, all degenerate variants of these nucleotide sequences will be apparent to those skilled in the art without performing the comparative analysis described above. It will also be appreciated that for these nucleic acid molecules that do not degenerate variants, only a reasonable number of nucleic acid molecules will encode polypeptides having pyruvate carboxylase protein activity. This is because those skilled in the art are fully known amino acid substitutions (eg, substitution of first aliphatic amino acids by second aliphatic amino acids) which have little or no significant effect on protein function.
    [50] For example, guidance on how to generate phenotypically silent amino acid substitutions can be found in Bowie, JU et al., "Deciphering the Message in Protein Sequences: Tolerance to Amino Acid Substitutions," Science 247: 1306-. 1310 (1990), where the author proposes two main methods for studying the acceptability of amino acid sequences for changes. The first method is dependent on evolutionary process, where mutations are accepted or excluded by natural selection. The second method uses a selection or selection method to identify sequences that maintain genetic manipulation and functionality to introduce amino acid changes at specific positions of the cloned genes. As the authors note, what can be confirmed from these studies is that the protein is surprisingly tolerant of amino acid substitutions. The authors also point out which amino acid changes are tolerated at specific positions of the protein. For example, most inherent amino acid residues require nonpolar side chains, while few of the features of surface side chains are generally conserved. Other such morphologically silent substitutions are described in Bowie, J. U. et al., Supra; Which is incorporated herein by reference.
    [51] Vector and Host Cells
    [52] The invention also relates to a vector comprising the isolated DNA molecule of the invention, a host cell genetically engineered with said recombinant vector, and a method for producing a pyruvate carboxylase polypeptide or part thereof by such a recombinant technique.
    [53] Recombinant constructs can be introduced into host cells using known techniques such as infection, transduction, transfection, transfection, conjugation, electroporation and transformation. The vector can be, for example, a phage, plasmid, viral vector or retroviral vector.
    [54] The polynucleotide can be linked in a vector containing a selectable marker for propagation in host cells. Generally, plasmid vectors are introduced as precipitates, for example calcium phosphate precipitates, or as complexes with charged lipids. If the vector is a virus, it is packaged in vitro using a suitable packaging cell line and then transduced into host cells.
    [55] Preferred vectors are vectors comprising cis-functional regulatory regions for a given polynucleotide. Suitable trans-acting factors may be supplied by the host upon introduction into the host, by a supplemental vector, or by the vector itself.
    [56] In a particularly preferred embodiment of this aspect, the vector is provided for expressing specificity which may be inducible and / or cell type specificity. Particularly preferred among these vectors are those which can be induced by easy to manipulate environmental factors such as temperature or nutrient additives.
    [57] Expression vectors useful in the present invention include chromosomal derived vectors, episomal derived vectors and virus derived vectors such as bacterial plasmid derived vectors, bacteriophages, yeast episomes, yeast chromosomal elements, baculoviruses, papova viruses And vector derived from viral derived vectors such as vaccinia virus, adenovirus, chicken pox virus, Pseudorabies virus and retrovirus and combinations thereof, such as cosmid and phagemid.
    [58] The DNA insert is a suitable promoter, eg phage lambda PL Promoter, Lee. collielac,trpAndtacIt should be operably linked to a promoter, an SV 40 early and late promoter and a promoter of retroviral LTR. Other suitable promoters are known to those skilled in the art. The expression construct will further contain ribosomal binding sites for translation initiation and termination sites and translation within the transcribed region. The coding portion of the mature transcript expressed by the construct will comprise a translation initiation codon (AUG or GUG) at the initial position of the polypeptide to be translated, and will include a termination codon located nearly at the end of the polypeptide to be translated.
    [59] As noted, the expression vector will preferably contain one or more selectable markers. These markers include dihydrofolate reductase or neomycin resistance for eukaryotic cell culture. Cultivation in coli and other bacteria includes tetracycline, ampicillin, chloramphenicol or kanamycin resistance. Representative examples of suitable hosts include E. coli. E. coli , C. Glue Tommy Com (C. glutamicum), Streptomyces (Streptomyces) and Salmonella typhimurium (Salmonella typhimurium) cells; Strain cells, such as yeast cells. Suitable culture media and conditions for such host cells are known in the art.
    [60] Suitable vectors for use in bacteria in the vectors include pA2, pQE70, pQE60 and pQE-9 (all commercially available from Qiagen); pBS vector, phagescript vector, bluescript vector, pNH8A, pNH16a, pNH18A, pNH46A (all commercially available from stratazine); And ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (all sold by Pharmacia). Preferred vectors that can be used in eukaryotic cells include pWLNEO, pSV2CAT, pOG44, pXT1 and pSG (all commercially available from stratazine); And pSVK3, pBPV, pMSG and pSVL (all sold by Pharmacia). Other suitable vectors will be apparent to those skilled in the art.
    [61] Known bacterial promoters useful for use in the present invention include E. coli. Collie lac I and lac Z promoters, T3 and T7 promoters, gpt promoters, lambda P R and P L promoters and trp promoters. Suitable eukaryotic promoters include CMV direct early promoter, HSV thymidine kinase promoter, early and late SV 40 promoters, promoters of retroviral LTRs such as the Raus sacoma virus (RSV) and metallothionein promoters, eg For example, a mouse metallothionein-I promoter can be mentioned.
    [62] Introduction of the construct into host cells can be performed by calcium phosphate transfection, DEAE-dextran mediated transfection, cationic lipid-mediated transfection, electroporation, transduction, infection or other methods. These methods are described in a number of standard laboratory guidelines, such as Davis et al., "Basic Methods in Molecular Biology" (1986).
    [63] Transcription by higher eukaryotes of DNA encoding a polypeptide of the invention can be increased by inserting an enhancer sequence into the vector. Enhancers are cis-acting elements of DNA, usually comprised of about 10 to 300 bp, which act to increase the transcriptional activity of the promoter in a given host cell type. Examples of enhancers include the SV 40 enhancer (located behind the replication origin at bp 100 to 270), the cytomegalovirus early promoter enhancer, the polyoma enhancer located behind the replication origin and the adenovirus enhancer.
    [64] In order to secrete translated proteins into the lumen of the endoplasmic reticulum, surrounding cytoplasmic space or intracellular environment, suitable secretion signals can be incorporated into the expressed polypeptide. Such a signal may be endogenous to the polypeptide or may be a heterologous signal.
    [65] The polypeptide may be expressed in a modified form, for example in the form of a fusion protein, and may comprise additional heterologous functional regions as well as secretory signals. Thus, for example, a region consisting of additional amino acids, especially charged amino acids, may be added to the N-terminus of the polypeptide to improve stability and persistence in the host cell during purification or subsequent processing or storage. In addition, a peptide moiety can be added to the polypeptide to facilitate purification.
    [66] The pyruvate carboxylase protein can be prepared by known techniques such as ammonium sulfate or ethanol precipitation, acid extraction, cation or anion exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxyl Apatate chromatography and lectin chromatography can be used to recover and purify from recombinant cell culture. Purification using high performance liquid chromatography (HPLC) is the most preferred method.
    [67] Polypeptides of the present invention are naturally purified products, products produced by chemical synthesis processes and products produced by recombinant techniques from prokaryotic or eukaryotic host cells such as bacteria, yeast, higher plants, insects and mammalian cells. It includes. Depending on the host used in the recombinant preparation, the polypeptides of the present invention may be glycosylated or unglycosylated. In addition, the polypeptides of the invention may in some cases include initially modified methionine residues as a result of host-mediated processing.
    [68] Pyruvate carboxylase polypeptides and peptides
    [69] The invention also provides a peptide or polypeptide comprising an amino acid sequence encoded by deposited DNA or an amino acid sequence shown in FIG. 1 (SEQ ID NO: 2), or a portion of said polypeptide. The terms "peptide" and "oligopeptide" are synonymous (typically recognized as such), and each term is interchangeable herein where necessary to denote at least a chain of amino acids bound by peptide bonds. The term "polypeptide" is used for a chain containing 10 or more amino acid residues. All oligopeptide and polypeptide structures or sequences are described herein from left to right, with the direction from the amino terminus to the carboxy terminus.
    [70] As is already recognized in the art, some amino acid sequences of the pyruvate carboxylase polypeptides of the invention can be altered without significantly affecting the structure or function of the protein. Given these changes in the sequence, it should be noted that there are important sites that determine the activity of the protein. In general, if residues that perform similar functions are used, it is possible to replace residues that form tertiary structures. In other cases, if alterations occur in non-critical regions of the protein, the shape of the residue will not be important at all.
    [71] Accordingly, the present invention includes modifications of pyruvate carboxylase polypeptides that include substantial activity or include regions of pyruvate carboxylase proteins, such as the protein portions described below. Such mutants include deletions, insertions, inversions, repeats and form substitutions (e.g., substitution of one hydrophilic residue with another hydrophilic residue, but, by convention, the substitution of strong hydrophilic residues with strong hydrophobic residues is prohibited). have. Small changes or such "neutral" amino acid substitutions generally have little effect on activity.
    [72] Conservative substitutions commonly identified include replacement of one residue with another among the aliphatic amino acids Ala, Val, Leu and Ile; Interchange of hydroxyl residues Ser and Thr, exchange of acidic residues Asp and Glu, substitution of amide residues Asn and Gln, exchange of basic residues Lys and Arg and replacement between aromatic residues Phe, Tyr.
    [73] As already pointed out in detail, guidance on which amino acid changes will be phenotypically silent (ie, which amino acid changes will not adversely affect function) is described in Bowie, JU et al., "Deciphering the Message in Protein Sequences: Tolerance to Amino Acid Substitutions, "Science 247: 1306-1310 (1990)."
    [74] The polypeptides of the present invention are provided in isolated form, more preferably in substantially purified form. Pyruvate carboxylase polypeptides produced by recombinant techniques can be substantially purified by the one-step method described in Smith and Johnson, Gene 67: 31-40 (1988).
    [75] Polypeptides of the invention are polypeptides encoded by deposited DNA, polypeptides of SEQ ID NO: 2 and at least 90% similarity, more preferably at least 95% similar, and even more preferably at least 97%, 98% to said sequence Polypeptides having at least or at least 99% similarity. Further, the polypeptide of the present invention is at least 70%, more preferably at least 90% or at least 95%, even more preferably at least 97%, at least 98% of the polypeptide encoded by the deposited DNA, the polypeptide of SEQ ID NO: 2. Or a portion of said polypeptide comprising at least 99% identical polypeptides and having at least 30 amino acids and more preferably at least 50 amino acids.
    [76] The "% similarity" of the two polypeptides determines the Bestfit program (Wisconsin Sequencing Package, Version 8, for Unix, Wisconsin 53711 Madison Science Drive 575, Genetics Computer Group, University Research Park) and similarity determination. Mean similarity value determined by comparing the amino acid sequences of the two polypeptides using the default settings for. Bestfit uses Smith and Waterman's local homology algorithms (Advances in Applied Mathematics 2: 482-489 (1981)) to find the optimal homology segments between the two sequences.
    [77] A polypeptide having a reference amino acid sequence of a pyruvate carboxylase polypeptide, eg, at least 95% "identical" amino acid sequence, means that the amino acid sequence of the polypeptide is identical to the reference sequence, It is excluded that it may include up to 5 amino acid changes per 100 amino acids of the reference amino acid sequence of the pyruvate carboxylase polypeptide. In other words, to obtain a polypeptide having an amino acid sequence that is at least 95% identical to a reference amino acid sequence, up to 5% of the amino acid residues in the reference sequence are deleted or substituted with another amino acid, or in the entire sequence in the reference sequence. It means that up to 5% amino acids can be inserted into the reference sequence. These alterations of the reference sequence may occur at any position between the amino or carboxy end positions of the reference amino acid sequence or between the amino acids in the reference sequence or between these end positions individually interspersed in one or more adjacent crowd random positions in the reference sequence. have.
    [78] As a practical matter, any particular polypeptide is at least 90%, at least 95%, at least 97%, for example, with the amino acid sequence shown in Figure 1 (SEQ ID NO: 2) or the amino acid sequence encoded by the deposited cosmid clone, Whether more than 98% or more than 99% equal is known, such as the Bestfit program (Wisconsin Sequencing Package, Version 8, for Unix, 53711 Madison Science Drive 575, University of Wisconsin, Genetics Computer Group, University Research Park). Determination can usually be made using a computer program. When using the best fit or any other sequence alignment program to confirm whether a particular sequence is 95% identical to a reference sequence, for example, according to the present invention, the variables as well as the percent identity of the reference amino acid sequence Calculated over the entire length and determined to allow up to 5% homology differences in the total number of amino acids in the reference sequence.
    [79] Genetic tools for manipulating Corynebacterium
    [80] To cause the genetic changes needed for metabolic engineering in Corynebacterium, researchers need to identify and clone genes involved in the target pathway. In addition, researchers need a way to modify these genes to affect the regulation or expression levels of the enzymes they encode, reintroduce the modified genes into Corynebacterium, and monitor their effects on amino acid biosynthesis. We also need a way to do it. Thus, metabolic engineers may find Corynebacterium and other readily engineered hosts, such as E. coli. Both collies must have an array of plasmids that can replicate within them. There is also a need for a well-characterized transcriptional promoter capable of, for example, collecting selectable markers encoding antibiotic resistance, capable of modulating modified genes, and an efficient transformation or conjugation system to insert the plasmid into a target Corynebacterium strain.
    [81] Plasmid
    [82] Several different plasmids were isolated for development, developed and gene expressed in Corynebacterium (Sonnen, H. et al., Gene 107: 69-74 (1991)). Many of these are seeds. C. glutamicum , seed. C. callunae and seeds. It is a small (3-5 kbp) hidden plasmid, identified from C. lactofermentum . These belong to four compatible groups exemplified by the plasmids pCC1, pBL1, pHM1519 and pGA1. Corynebacterium and Lee. Shuttle vectors, which are plasmids that can replicate in both collies, are known. Developed from these hidden plasmids by incorporating antibiotic resistance markers with urea derived from collie plasmids (especially ColE1 origin of replication derived from pBR322 or pUC18). A fifth class of plasmids very useful for engineering Corynebacterium is based on pNG2, a plasmid originally isolated from Corynebacterium diphtheriae . Serwold-Davis, TM et al., Proc. Natl. Acad. Sci. USA 84: 4964-4968 (1987). Such plasmids and derivatives thereof include a number of Corynebacterium species and E. coli. Efficiently replicates in collies. Since the only origin of replication in pNG2 (elements consisting only of 1.8 kbp) functions in both Gram positive and Gram negative hosts, there is no need to add additional ColE1 type elements to the plasmid. As a result, pNG2 derivatives (eg pEP2) are much smaller in size than other Corynebacterium shuttle vectors and thus can be easily manipulated.
    [83] Selectivity marker
    [84] Several genes that confer antibiotic resistance have been shown to be useful for plasmid selection and other recombinant DNA work in Corynebacteria. These include kanamycin resistance determinants derived from Tn903, hygromycin resistance markers isolated from Streptomyces hygroscopicus , tetracycline resistance genes derived from Streptococcus faecalis , bleomycins derived from Tn5 Resistance genes and chloramphenicol resistance markers derived from Streptomyces acrimycini . multiple teeth, such as pBR322. The beta-lactamase gene used in the collie plasmid does not confer ampicillin resistance in Corynebacterium.
    [85] Transformation system.
    [86] Several methods have been devised for introducing foreign DNA into Corynebacterium. The early methods generally used were based on protocols that have been successful for other Gram-positive species, including the incubation of spheroplasts in the presence of DNA and polyethyleneglycol. Yoshihama, M. et al., J. Bacteriol. 162: 591-597 (1985). This method is useful, but is often inefficient by yielding up to 10 5 transformants per mg of DNA. Electroporation of Corynebacterium spheroplasts has been identified as a more effective and reliable transformation method. Spheroplasts are produced by growing cells in a rich medium containing glycine and / or low concentrations of cell wall biosynthesis inhibitors such as isicotinic acid hydrazide (isoniazid), ampicillin, penicillin G, or Tween-80. The spheroplasts are then washed with low salt buffer containing glycerol, concentrated, mixed with DNA and then electroporated. The efficiency of this method is reported to be about 10 7 transformants per μg of plasmid DNA.
    [87] A third method for transferring DNA into corynebacteria is by transformation by conjugation (transconjugation). The advantage of this method is that E. co. Orgy of the Collie strain. this. In Collie, RP4 is derived from host strains. Other water soluble strains of Collie or other species encode several functions that mediate the conjunctive transfer of plasmids. These " tra functions" mediate cilia formation and plasmid transfer. In addition, RP4 possesses a cis-acting element recognized by the transfer device, ori T, the transition origin, which transfers the plasmid into the recipient strain through the cilia. From this system, Simon et al. (Bio / Technology 1: 784-791 (1985)) describe E. coli. A useful transfection means has been developed that can transfer plasmids from collie to Corynebacterium. These are derived from RP4 in a strain called S17-1. Reposition tra function into the Coli chromosome. Plasmids carrying RP4 ori T can migrate very efficiently from S17-1 to other receptors. This method has been found to be useful for introducing replication plasmids into Corynebacterium, but has been found to be much more useful for causing gene disruption. This is done by introducing a selectable marker into the clone of the Corynebacterium gene that is the target of disruption. Subsequently, this construct retains RP4 ori T but lacks an origin to support replication in Corynebacterium. Link into coli plasmid. S17-1 carrying this plasmid is then incubated with the receiving strain and the mixture is transferred into selective medium. Since the introduced plasmids are not able to replicate in Corynebacteria, the transfectants expressing selective markers appear to undergo cross recombination in genomic DNA.
    [88] Restriction-defective strain
    [89] Irrespective of the transformation system used, Corynebacterium is E. coli. There is a clear precedent in the literature that collie-derived DNA can be recognized as foreign and can be degraded. This ability contributes to the Corynebacterium restriction system and alteration system. To overcome this system, some transformation and transfection protocols require simple heating of the receiving strain before transformation. The heat treatment inactivates the enzyme that plays a role in the restriction system, thereby making it possible to establish the DNA introduced before the enzyme is recovered. Another way to improve DNA delivery efficiency is to isolate Corynebacterium mutants lacking a restriction system. These strains have almost the same efficiency as plasmids that grow in Corynebacterium. Plasmids that grow in the collie will be incorporated. In another method used to bypass the restriction system in Corynebacterium, Leblon and its co-workers (Les, O. et al., Gene 107: 61-68 (1991)) describe the "integlon" for gene disruption. (integron) "system. Integrins are DNA molecules that have the same restriction / altering properties as the DNA of the target host, have DNA homologous to a portion of the host genome (ie, the region of the disrupting genome), and cannot replicate in the host cell. . Genes cloned from Corynebacterium are inhibited by selective markers in plasmids that proliferate primarily in any Corynebacterium strain. This construct is then cleaved from the Corynebacterium plasmid and self-linked to form non-replicating cyclic molecules. This "integron" is then introduced into the restriction host by electroporation. The alteration of the DNA allows interon to circumvent the host restriction system, and recombination into the host genome allows expression of selectable markers.
    [90] Promoter
    [91] Reliable transcriptional promoters are required for efficient expression of foreign genes in Corynebacterium. In certain experiments, it may be necessary to have a regulated promoter capable of inducing activity under certain culture conditions. Promoter, such as Corynebacterium, the fda, thrC and hom promoter derived from a gene has been identified as being useful for heterologous gene expression. this. Inducible promoters of collie, such as P lac and P trc , are induced by isopropylthiogalactopyranoside (IPTG) in the presence of lac repressor ( lac I); P trp reacts with indole acrylic acid when trp refresher ( trp R) is present; Lambda P L is inhibited in the presence of temperature sensitive lambda repressor (cI857), all of which are used to regulate gene expression in Corynebacterium.
    [92] Gene identification
    [93] Attempts have been made to identify relevant genes from Corynebacterium, using all other genetic means in place. this. In Collie, some of the sources used to isolate genes were derived from E. g. Genetic maps of the Coli chromosome and more recently complete physical and sequence maps of the chromosome. To date, the most successful methods for identifying and recovering genes from Corynebacterium have been described. Corynebacterium genomic DNA is used to supplement the known nutritional requirements of Collie. In this experiment, a library of plasmids containing fragments of the Corynebacterium genome was identified as E. coli lacking certain enzymes or functions. It is introduced into the Collie strain. Transformants that no longer show nutritional constituents (eg, homoserine deficiency) appear to carry a complement gene derived from Corynebacterium. This method induces the isolation of a number of Corynebacterium genes, including genes derived from pathways responsible for biosynthesis, intermediate metabolism and other cellular processes of aspartate derived and aromatic amino acids. One limitation of the method is that not all genes derived from Corynebacterium are such. Is expressed in the collie host. Thus, although any gene may appear in the plasmid library, E. coli. It is not possible to compensate for a Collie mutation and therefore may not be recovered during selection. Overcoming this limitation is to identify fewer genes using a similar method that directly compensates for mutations in other Corynebacterium strains using plasmid libraries derived from wild type Corynebacterium. Although this method can avoid taking into account insufficient gene expression in a trophogenic host, its usefulness is limited by poor plasmid-transformation efficiency in the nutrient. Still other genes have been identified by hybridization using nucleic acid probes based on homologous genes derived from other species, and by direct amplification of genes using polymerase chain reactions and degenerate oligonucleotide primers.
    [94] Potential element
    [95] Potential elements are a very powerful tool in gene identification because they link mutagenesis and gene recovery. Unlike classical mutagenesis techniques that generate point mutations or small deletions within a gene, when potential elements are inserted into the gene, they "tag" the altered gene for easy identification by causing large disruption. do. Many potential elements have been found to translocate in Corynebacterium. Seed. Plasmids pTP10 and C. of C. xerosis . The transposon found in plasmid pNG2 of C. diphtheriae was seed. It has been shown to translocate in glutamicum and confer resistance to erythromycin. Mr. Mitsubishi Chemical Company of Japan. A series of artificial transposons were developed from insertion sequence IS31831 found in G. glutamicum (Vertes, AA et al., Mol. Gen. Genet. 245: 397-405 (1994). After inserting a selectable marker between the inversion repeats of the IS31831, these researchers used the resulting transposons. Seed by electroporation on a collie plasmid (cannot replicate in Corynebacterium). It could be introduced into C. glutamicum . They confirmed that a selectable marker was inserted into the genome of the target cell at a frequency of about 4 × 10 4 mutant / μg DNA. The use of these transposons to produce Corynebacterium trophs has led to the isolation of several genes that play a role in amino acid biosynthesis and other functions in Corynebacteria.
    [96] Transgenic phage
    [97] Transgenic phages have been used in locus mapping and other systems for gene isolation. In 1976, researchers at the Ajinomoto Company in Japan investigated 150 glutamic acid-producing coryneform bacteria, either uncharacterized or unidentified, to identify phages that could be useful for transduction. Mornose, H. et al., J. Gen. Appl. Microbiol. Rev. 16: 243-252 (1995). Only three of the 24 different phage isolates recovered from the screening can transduce the trp marker from the trp + donor to the trp − receptor at any suitable frequency (although the efficiency is less than 10 −7 ). there was. The researchers were able to slightly improve transduction efficiency by including 4 mM cyclic adenosine monophosphate (cAMP) or 1.2 M magnesium chloride. Several other researchers have tried to develop reliable transduction methods by separating corynephages from sources such as contaminated industrial fermentation, soil and animal manure. While many phages have been isolated and characterized, few have been associated with transduction, and there is still an opportunity to develop reliable, efficient transduction systems that can be combined with bacteria that generally produce glutamic acid. .
    [11] The present invention includes a polynucleotide encoding a pyruvate carboxylase polypeptide having the amino acid sequence of FIG. 1 (SEQ ID NO: 2) or an amino acid sequence encoded by a cosmid clone deposited in a bacterial host with ATCC Accession No. ______. To provide an isolated nucleic acid molecule. The nucleotide sequence obtained by sequencing the sequence shown in FIG. 1 (SEQ ID NO: 1), namely the deposited pyruvate carboxylase cosmid clone, is an open reading encoding a polypeptide consisting of 1140 amino acid residues having an inferred molecular weight of about 123.6 kDa. It contains a frame. The 1140 amino acid sequence of the expected pyruvate carboxylase protein is shown in FIG. 1 and SEQ ID NO: 2.
    [12] Thus, one aspect of the present invention
    [13] (a) a nucleotide sequence encoding a pyruvate carboxylase polypeptide having the complete amino acid sequence of SEQ ID NO: 2;
    [14] (b) a nucleotide sequence encoding a pyruvate carboxylase polypeptide having a complete amino acid sequence encoded by a cosmid clone contained in ATCC Accession No. _______; And
    [15] (c) a nucleotide sequence complementary to any of the nucleotide sequences of (a) or (b) above
    [16] It is to provide an isolated nucleic acid molecule comprising a polynucleotide having a nucleotide sequence selected from the group consisting of.
    [17] Another embodiment of the invention is at least 90%, more preferably at least 95%, at least 97%, at least 98% or at least 99% identical nucleotides to any of the nucleotide sequences of (a), (b) or (c) above An isolated nucleic acid comprising a polynucleotide having a sequence or a polynucleotide hybridized under stringent hybridization conditions to a polynucleotide having a nucleotide sequence identical to the nucleotide sequence of (a), (b) or (c) above It includes molecules. The polynucleotide is not hybridized to a polynucleotide having a nucleotide sequence consisting of only A residues or only T residues under severe hybridization conditions.
    [18] In addition, the present invention provides a recombinant vector comprising the isolated nucleic acid molecule of the present invention and a host cell containing the recombinant vector, and a pyruvate carboxylase polypeptide using a method and a recombinant technique for producing such a vector and the host cell. A method of using these to prepare peptides.
    [19] In addition, the present invention
    [20] (a) an amino acid sequence of a pyruvate carboxylase polypeptide having the amino acid sequence shown in FIG. 1 (SEQ ID NO: 2); And
    [21] (b) the amino acid sequence of the pyruvate carboxylase polypeptide having the complete amino acid sequence encoded by the cosmid clone contained in ATCC Accession No. _______
    [22] An isolated pyruvate carboxylase polypeptide having an amino acid sequence selected from the group consisting of: is provided. Further, the polypeptide of the present invention is a polypeptide having an amino acid sequence of at least 90%, more preferably at least 95% similar to the amino acid sequence described in (a) or (b) above and at least 70%, more preferably Preferably polypeptides having an amino acid sequence of at least 90%, even more preferably 95%, 97%, 98% or 99% identical.
    [98] The following method and detailed experimental contents are described by reference in this Example.
    [99] Bacterial Strains and Plasmids
    [100] Seed. Glue Tommy Com (C. glutamicum) 21253 - using (hom, lysine over-producing state) was prepared with the chromosomal DNA. this. Coli DH5α ( hsdR − , recA − ) [Hanahan, D., J. Mol. Biol. 166: 557-580 (1983)] were used for transformation. The polymerase chain reaction (PCR) product was cloned using plasmid pCR2.1TOPO (Invitrogen). The plasmid pRR850 was constructed in this study and included a 850-bp PCR fragment cloned in the pCR2.1 TOPO plasmid.
    [101] Medium and culture conditions
    [102] this. Coli strains were grown in Luria-Bertani (LB) medium at 37 ° C. (Sambrook, J. et al., Molecular cloning: a laboratory manual (2nd edition), Cold Spring Harbor Laboratories, Cold Spring Harbor, New York (1989) ]. Seed. C. glutamicum was grown in LB medium at 30 ° C. Ampicillin was used at the indicated locations at the following concentrations: 100 μg / ml (plate culture) and 50 μg / ml (liquid culture).
    [103] DNA manipulation
    [104] Genomic DNA is described in Tomioka, N. et al., Mol. Gen. Genet. 184: 359-363 (1981). C. glutamicum was isolated. PCR fragments were cloned into pCR2.1 TOPO vectors according to the manufacturer's instructions. Cosmid and plasmid DNA were prepared on a Qiaprep spin column and DNA was extracted from agarose gel using a Qiax kit (Qiagen). To prepare large scale high purity cosmid DNA for sequencing, Promega Wizard Kid (Promega) was used. Using standard techniques. Coli was transformed and agarose gel electrophoresis was performed (Sambrook, J., Fritsch, EF and Maniatis, T., in Molecular Cloning, A Laboratory Manual (2nd edition), Cold Spring Harbor Laboratories, Cold Spring Harbor, New York (1989)]. Restriction enzymes were purchased from Schöllinger Mannheim or New England Biolabs.
    [105] Cosmid Library
    [106] The cosmid library used is Mr. C. glutamicum DNA was constructed by cloning into a supercos vector (stratazine).
    [107] Polymerase Chain Reaction (PCR)
    [108] PCR was performed using the Boehringer Mannheim PCR core kit according to the manufacturer's instructions. When PCR was performed on Corynebacterium chromosomal DNA, about 1 μg of DNA was used for each reaction. The forward primer used for the PCR reaction was 5 'GTCTTCATCGAGATGAATCCGCG 3' and the reverse primer used for the PCR reaction was 5 'CGCAGCGCCACATCGTAAGTCGC 3'.
    [109] Dot-Blot Analysis
    [110] Dot blots containing DNA derived from the cosmids identified in this study and probes as positive controls were prepared using the S & S (Schlecher und Schul) minifold apparatus. Seed. A 850-bp fragment encoding a portion of the C. glutamicum pyruvate carboxylase gene was used as a probe. The probe was labeled with deoxygenin-11dUTP (Möllinger Mannheim) in a randomly primed DNA-labeled reaction as described by the manufacturer. Hybridization, washing and calorie detection of the dot-blot were performed using the Zöllinger Mannheim's Genius system according to the protocol in the user guide for filter hybridization. Initial hybridization with 291 cosmid was performed overnight at 65 ° C. and washing was performed at the hybridization temperature. In 17 cosmids used in the second screening, hybridization was performed at 65 ° C., but only for 8 hours and the exposure time to the film was reduced.
    [111] Detection of Biotin-Containing Proteins by Western Blotting
    [112] Seed. Cell extracts of C. glutamicum are described in Jetten, MSM, & Sinskey, AJ, FEMS Microbiol. Lett. 111: 183-188 (1993). Proteins in the cell extracts were separated in sodium dodecyl sulfate (SDS) /7.5% polyacrylamide gel in Biorad minigel apparatus and electroblotted onto nitro-cellulose using Biorad mini transblot apparatus. Towbin, H. et al., Proc. Natl. Acad. Sci. USA 76: 4350-4354 (1979). Biotinylated proteins were obtained from avidin-conjugated alkaline phosphatase and 5-bromo-4-chloro-3-indoylphosphate-p-toludine salt / nitroblue tetrazolium purchased from Biorad. Detected using chloride.
    [113] DNA sequencing
    [114] Automated DNA sequencing was performed with an MIT biopolymer facility using an ABI Prism 377 DNA sequencing machine.
    [115] Sequence analysis
    [116] The DNA sequence was reversed, supplemented and interpreted using program DNA Strider version 1.0 (Institut de Lecherche Fondamentale France) to identify open reading frames within the sequence. The BLAST program of the National Center for Biotechnology Information (NCBI) [Altschul, S.F. Et al., J. Mol. Biol. 215: 403-410 (1990)] for comparing protein and DNA sequences. Protein homology studies were performed using MACAW software (NCBI). PCR primers were constructed using Primer Premier software from Biosoft International. The molecular weight and pi of the estimated amino acid sequence were predicted using the compute pI / MW tool on an ExPasy molecular biology server (University of Geneva).
    [117] Example 1
    [118] Western blotting to detect biotinylated enzymes
    [119] Since pyruvate carboxylic acid is known to contain biotin, it has been found that Western blotting is used. The production of biotinylated protein was detected by glutamicum ( C. glutamicum ). Two biotinylated proteins were detected in extracts prepared from cells grown in LB medium (data not shown), consistent with previous reports. On the other hand, a band located at about 80 kDa was identified as the biotin-carboxyl-carrier domain (BCCP) of acetyl-CoA carboxylase. See Jager, W et al., Arch. Microbiol. 166: 76-82 (1996). The second band, located at 120 kDa, was thought to be the pyruvate carboxylase enzyme, because these proteins are in the range of 113 to 130 kDa. Attwood, PV, Int. J. Biochem. Cell. Biol. 27: 231-249 (1995).
    [120] Example 2
    [121] PCR and cloning
    [122] Seed. C. glutamicum pyruvate carboxylase genes were cloned based on homology of the highly conserved regions of already cloned genes. The pyruvate carboxylase genes from 13 organisms were examined and regions (Table 1) adjacent to the primers and pyruvate-binding motifs corresponding to ATP-binding sub motifs conserved in pyruvate carboxylase were devised. If the amino acids differ, the primer is M. a. It was designed based on M. tuberculosis because of M. tuberculosis . Mr. tuberculosis. This is because it is closely related to C. glutamicum . 850-bp fragment is seed. PCR was amplified from G. glutamicum genomic DNA and cloned into pCR2.1 TOPO vector of invitrogen to construct plasmid pRR850. In addition, primers were designed based on conserved biotin binding sites and pyruvate-binding sites (not shown).
    [123] Example 3
    [124] Seed. Glutamicum ( C. glutamicum Isolation of Cosmid Containing Pyruvate Carboxylase Gene
    [125] Seed. Seed using a 850-bp fragment containing a portion of the C. glutamicum pyruvate carboxylase gene. C. glutamicum genomic library was probed. In the first stage of selection, only 17 of the 291 cosmids in the dot blot were positive. The second stage of selection was performed on these 17 cosmids using the same probe, but under more stringent hybridization conditions. As a result, four cosmids showed a positive signal. To confirm whether these cosmids actually contain the pyruvate carboxylase gene, four positive cosmids were used as templates and PCR using the same primers to prepare the probes was performed. The 850-bp fragments were all amplified from four positive cosmids and named IIIF10, IIE9, IIIG7 and IIIB7, respectively.
    [126] Pyruvate carboxylase sequences from 13 organisms (obtained from Genebank) were arranged using MACAW software. Two highly conserved regions were selected and oligonucleotide primers were constructed based on the Mycobacterium tuberculosis DNA sequence corresponding to these regions. Forward primers were constructed based on the DNA sequence corresponding to conserved region A, and reverse primers were constructed based on the DNA sequence corresponding to conserved region B. organismPreserved Area AConserved Area B Caenorhabdtis elegansYFIEVNARATFDVSM Aedes aegyptiYFIEVNARATFDVAL Mycobacterium tuberculosisYFIEMNPRATYDVAL Bacillus stearothermophilusYFIEVNPRATFDVAY Pichia pastorisYFIEINPRATFDVSM Mus musculusYFIEVNSRATFDVAM Rattus norvegicusYFIEVNSRATFDVAM Saccharomyces cerevisiae 1YFIEINPRATFDVAM Saccharomyces cerevisiae 2YFIEINPRATFDVAM Rhizabium etliYFIEVNPRATFDVSM Homo sapiencsYFIEVNSRATFDVAM Schizosaccharomyces pombeYFIEINPRATFDVSM
    [127] Example 4
    [128] Sequencing method
    [129] The 850-bp insert of plasmid pRR850 was sequenced using M13 forward primer and M13 reverse primer. Based on these sequences, primers Begrev1 and Endfor1 were constructed and used to determine the outer sequence from the beginning and the end of the 850-bp of the pyruvate carboxylase gene. Cosmid IIIF10 was used as the sequencing template. Sequencing was continued by constructing a new primer (Table 2) and "walking" across the gene.
    [130] Example 5
    [131] Sequence analysis
    [132] The sequence of 3637 bp of cosmid IIIF10 was determined. A 3420-bp open reading frame was identified, which was thought to encode a protein of 1140 amino acids. The estimated protein is M. M. tuberculosis 63% identical to human pyruvate carboxylase and 44% identical to human pyruvate carboxylase. The glutamicum gene pc was named based on this homology. The estimated protein had a pI of 5.4, a molecular weight of 123.6 kDa and was similar to a subunit of molecular weight 120 kDa identified in SDS / polyacrylamide gel electrophoresis. Upstream of the starting methionine, the common sequence ribosomal binding site AAGGAA was shown. M. Based on homology to the M. tuberculosis sequence, the expected translational start site was the GTG codon, identical to that found in other bacterial sequences (Stryer, L., Biochemistry (3rd edition), Freeman, NY (1988); Keilhauer, C. et al., J. Bacteriol. 175: 5595-5603 (1993). The DNA sequence was submitted to Genebank and assigned accession number AF038548.
    [133] Seed. The amino-terminal fragment of C. glutamicum pyruvate carboxylase contained hexapeptide GGGGRG, which conforms to the GGGG (R / K) G sequence found in all biotin-binding proteins and is ATP- It is thought to be a binding site [Fry, DC et al., Proc. Natl. Acad. Sci. USA 83: 907-911 (1986); Post, LE et al., J. Biol. Chem. 265: 7742-7747 (1990). The second region proposed to be involved in ATP binding was present in biotin-dependent carboxylase and described as carbamylphosphate synthetase [Lim, F. et al., J. Biol. Chem. 263: 11493-11497 (1988). It was conserved in the G. glutamicum sequence. Also, expected seeds. G. glutamicum pyruvate carboxylase protein contains the putative pyruvate-binding motif FLFEDPWDR, which is conserved within the transcarboxylase domains of mycobacterium, rizobium and human pyruvate carboxylase. See Dunn, MF et al., J. Bacteriol. 178: 5960-5970 (1996). As evidenced by tryptophan fluorescence studies using transcarboxylase, the Trp residues present in the motif are involved in pyruvate binding (Kumer, GK et al., Biochemistry 27: 5978-5983 (1988)). The carboxy-terminal fragment of the enzyme contains the putative biotin-binding site, AMKM, which is the same as found in the biotin-carboxyl-carrier protein (BCCP) domains of other pyruvate carboxylase and other biotin-dependent enzymes. Do.
    [134] DNA sequence of a primer used to obtain the sequence of the pyruvate carboxylase gene in cosmid IIIF10. Primer NamePrimer Sequence (5'-3 ') Begrev1TTCACCAGGTCCACCTGG Endfor1CGTCGCAAAGCTGACTCC Begrev2GATGCTTCTGTTGCTAATTTGC Endfor2GGCCATTAAGGATATGGCTG Begrev3GCGGTGGAATGATCCCCGA Endfor3ACCGCACTGGGCCTTGCG Endfor4TCGCCGCTTCGGCAACAC
    [135] As can be seen from the previous studies, phosphoeno / pyruvate carboxylase ( ppc ) was found to be C. a. It is not the main supplementary enzyme for C. glutamicum . The reason is that its absence does not affect lysine production. Gubler, M. et al., Appl. Microbiol. Biotechnol. 40: 857-863 (1994); Peters-Wendisch, PG et al., Microbiol. Lett. 112: 269-274 (1993). In addition, 13 C-labeled experiments and NMR and GC-MS analysis [Park, SM et al., Applied Microbiol. Biotechnol. 47: 430-440 (1997b); Peters-Wendisch, PG et al., Arch. Microbiol. 165: 387-396 (1996)] or enzyme analysis using cell-free extracts (Tosaka, O., Agric. Biol. Chem. 43: 1513-1519 (1979)] and permeable cells (Peters-Wendisch, PG et al., Microbiol. 143: 1095-1103 (1997)] confirmed the presence of pyruvate-carboxylase. Very low pyruvate carboxylation activity was found in the cell-free extracts, but this activity was not isolated from very high ATP background. The activity measured is highly probable to be attributed to reversible glycolytic enzymes such as oxaloacetate carboxylase and malic acid enzymes. Seed. The presence of pyruvate carboxylase in C. glutamicum has little chance that the synthesizing enzyme can meet the supplemental needs of the strain.
    [136] Seed. The deduced amino acid sequence of the C. glutamicum pyruvate carboxylase gene is quite similar to the pyruvate carboxylase sequence from various groups of organisms. The amino acid sequence contains a biotin carboxylase domain in its N-terminal region, a BCCP domain in its C-terminal region, and a transcarboxylase domain having a binding site specific for pyruvate in its central region It contains. Seed. C. glutamicum pyruvate carboxylase protein is expressed in M. glutamicum . Strong homology to M. tuberculosis and human pyruvate carboxylase. Wexler, ID et al., Biochem. Biophys. Acta 1227: 46-52 (1994)].
    [137] Seed. There is a method for confirming that C. glutamicum contains one or more enzymes to perform the supplementary action of regenerating oxaloacetate. Pseudomonas citronellolis , Pseudomonas fluorscens , Azotobacter vinelandii and Thiobacillus novellus contain both ppc and pyruvate carboxylase. : O'Brien, RW et al., J. Biol. Chem. 252: 1257-1263 (1977); Scrutton, MC and Taylor, BL, Arch. Biochem. Biophys. 164: 641-654 (1974); Milrad de Forchetti, SR & Cazullo, JJ, J. Gen. Microbiol. 93: 75-81 (1976); Charles, AM & Willer, DW, Can. J. Microbiol. 30: 532-539 (1984). Zea mays contains three isozymes of ppc [Toh, H. et al., Plant Cell Environ. 17: 31-43 (1994)], Saccharomyces cerevisae contains two isozymes of pyruvate carboxylase [Brewster, NK et al., Arch. Biochem. Biophys. 311: 62-71 (1994)], each of which is differentially controlled. Seed. According to this finding of the presence of the pyruvate carboxylase gene in C. glutamicum , it is possible to interconvert phosphoenolpyruvate (PEP), oxaloacetate and pyruvate in the strain. The number of enzymes increased to six. The presence of these six enzymes in an organism has not been previously reported. blood. Citronellolis is a set of five enzymes capable of interconverting oxaloacetate, PEP and pyruvate, namely pyruvate kinase, PEP synthetase, PEP carboxylase, oxaloacetate dicar Carboxylase and pyruvate carboxylase. See O'Brien, RW et al., J. Biol. Chem. 252: 1257-1263 (1997). Azotobacter contains all of these enzymes except for PEP synthetase. See, Scrutton, MC & Taylor, BL, Arch. Biochem. Biophys. 164: 641-654 (1974).
    [138] Seed. The presence of six metabolically related enzymes in C. glutamicum means that the regulation of these enzymes through effectors is important. Biochemical and genetic studies, along with other downstream activities of all six enzymes, can identify the exact procedure needed to maximize the production of primary metabolites by the commercially important organisms.
    [139] Example 6
    [140] Composition of Pyruvate Carboxylase Mutant
    [141] The entire reading frame from nucleotide 180 to nucleotide 3630 of pyruvate carboxylase DNA was amplified using PCR. The oligonucleotide primers used in the PCR were constructed to remove Sal I sites in the coding sequence by silent mutations and to introduce EcoRV and SalI sites upstream and downstream of the open reading frame, respectively. The PCR product was digested with Eco RV and Sal I and cloned into vector pBluescript. The resulting plasmid was pPC BlueScript. In order to obtain plasmid-based disruption of pyc , a central portion of the pyc gene was deleted and a derivative of pPC BlueScript was substituted with the tsr gene, which encodes resistance to antibiotic thiostrepton. RP4 mob elements were then inserted into the plasmid to generate pAL240. The plasmid can be transferred into Corynebacterium by conjugation, but cannot replicate in Corynebacterium because it only retains the ColE1 origin of replication. pAL240 is transformed by transfection. Mr. from Collie S17-1. Transfer to glutamicum ( C. glutamicum ) and transconjugates were selected on media containing thiostrepton and nalidixic acid.
    [142] To identify drug resistance phenotypes of each of the conjugates, the conjugates were tested for their ability to grow on different carbon sources. pAL240 is Mr. Since they cannot replicate in C. glutamicum , only surviving cells retain the genome where recombination has been performed by the plasmid. Some candidates were identified with the appropriate phenotype set; They were resistant to thiostrepton and nalidixic acid, grew well on minimal plates containing lucose or acetate as the only carbon source, and grew little or no on minimum plates containing lactate as the only carbon source. Southern hybridization and PCR based assays were used to determine whether there was only one copy of the pyruvate carboxylase gene in the genome and whether it was disrupted by a thiostrepton resistance marker. Lysine production and production of biotinylated proteins by the strains were investigated, and the Δ pyc strain was used as a negative control in the activity assay, and as a host strain in the supplementation test.
    [143] 7 to implementation
    [144] Development of Overexpressed Strains
    [145] To test the hypothesis that increased levels of pyruvate carboxylase increase the production of lysine, it is necessary to construct a strain in which the expression of the pyruvate carboxylase gene is under the control of an inducible promoter.
    [146] Seed vector pAPE12 with NG2 origin of replication and multiple cloning sites downstream of IPTG-regulated trc promoter. It was used as an expression vector in C. glutamicum . The pAPE12 derivative was constructed to contain the pyruvate carboxylase gene downstream of Ptrc. The pyc gene was cleaved from pPC Bluescript using Sal I and Xba I, and linked into pAPE12 digested with the same enzyme to form pLW305. The pyruvate carboxylase gene present in pPC BlueScript (hereinafter pLW305) carries a wild type GTG initiation codon, and the Sal I restriction site, located near the 5 'end of the wild type gene, is amplified during the pyruvate carboxylase gene. It was removed by the introduction of a silent mutation of one base.
    [147] pLW305 and pAPE12 have been transferred to electroporation into some other Corynebacterium genetic backgrounds.
    [148] Because the pyruvate carboxylase gene in pLW305 has a GTG start codon and some intervening DNA between the trc promoter and the start codon, it constituted a flawless pyruvate carboxylase overexpression plasmid pKL1. The 5 'end of the gene was amplified from pLW305 using an oligonucleotide primer that introduced a BspLU11-I restriction site that was compatible with Nco I, while altering the GTG start codon to ATG. Subsequently, the PCR product was BspLU11-I and Afe I and cut into, and then part of the pLW305 decomposition and with NcoI, was ligated into a 7.5 kb backbone obtained by the complete decomposition with Afe I. Two separate ligations and transformants produced putative pXL1 clones.
    [149] Example 8
    [150] Fermentation result
    [151] Pyruvate carboxylase activity levels, said gene is its natural seed. When expressed from the G. glutamicum promoter, it was confirmed that it greatly changes depending on the carbon source used. Therefore, production of pyruvate carboxylase in strains grown from these carbon sources was investigated.
    [152] Strains NRRL B-11474, NRRL B-11474 (pLW305) and NRRL B-11474Δ pyc # 35 were incubated in flasks on minimal medium for NRRL B-11474 with glucose or lactate with two different carbon sources. Results for growth and amino acid production are shown in Table 3 below.
    [153] GlucoseLactate Biomass (g / l)Lysine (g / l)Ylys / glc (g / g)Biomass (g / l)Lysine (g / l)Ylys / glc (g / g) NRRL B-114746.7 ± 0.25.0 ± 0.70.2131.70.12 NRRL B-11474 (pLW305)7.3 ± 0.25.3 ± 0.20.2242.50.15 △ pyc # 351.100000
    [154] NRRL B-11474 and pLW305 showed the same pattern in glucose. All of these strains produced the same amount of biomass and lysine. The strains also showed similar lysine yields with lactate. NRRL B-11474 (pLW305) consumed all lactate (17 g / l) in the medium, whereas wild type NRRL B-11474 consumed less than 40% lactate during the same period. The NRRL B-11474 was calculated to consume lactate at a rate of 0.37 g lactate / hour, whereas the NRRL B-11474 (pLW305) strain consumed the substrate at a rate of 0.65 g lactate / hour.
    [155] The NRRL B-11474Δ pyc did not grow in lactate, consistent with the expected phenotype. Its growth in glucose was very low and the strain did not produce lysine. Kinetic studies were performed to characterize these strains.
    [156] Example 9
    [157] Visualization of Biotinylated Proteins
    [158] Pyruvate carboxylase contains biotin. Thus, it is possible to detect the accumulation of the enzyme by monitoring the appearance of biotinylated specificity products in the cell.
    [159] Example 10
    [160] Electrophoretic gel
    [161] To detect biotinylated proteins in electrophoretic gels, streptavidin (commercially available) bound to alkaline phosphatase was used. Teeth with pAPE12 or pLW305. Crude protein lysate was isolated from induced and non-derived cultures of Coli DH5α or NRRL B-11474 and protein separated in two pairs of 7.5% polyacrylamide modified electrophoretic gels. One of each pair of gels was stained with Coomaji Brilliant Blue to visualize all proteins and allow the same level of protein to be loaded into each lane. The other gel was treated with streptavidin-alkaline phosphatase reagent that binds to the biotinylated protein. The location of these proteins can then be visualized by providing alkaline phosphatase with 5-bromo-4-chloro-3-indolyl phosphate (BCIP), a calorimetric substrate. As already reported, two main biotinylated proteins were detected. Larger molecular weight species (about 120 kDa) were identified as pyruvate carboxylase and lower molecular weight species (about 60 kDa) were biotinylated subunits of acetyl-CoA carboxylase.
    [162] All documents cited above are hereby incorporated by reference.
    [163] While the invention has been described in some detail for clarity and understanding, it will be apparent to those skilled in the art and various modifications are possible without departing from the true scope of the invention and the scope of the appended claims.
    权利要求:
    Claims (17)
    [1" claim-type="Currently amended] (a) a nucleotide sequence encoding a pyruvate carboxylase polypeptide having the amino acid sequence of SEQ ID NO: 2;
    (b) a nucleotide sequence encoding a pyruvate carboxylase polypeptide having a complete amino acid sequence encoded by a cosmid clone contained in ATCC Accession No. ________; And
    (c) a nucleotide sequence complementary to any of the nucleotide sequences of (a) or (b) above
    An isolated nucleic acid molecule comprising a polynucleotide having a nucleotide sequence that is at least 95% identical to a sequence selected from the group consisting of:
    [2" claim-type="Currently amended] The nucleic acid molecule of claim 1, wherein said polynucleotide carries the complete nucleotide sequence of SEQ ID NO: 1.
    [3" claim-type="Currently amended] The nucleic acid molecule of claim 1, wherein said polynucleotide has a nucleotide sequence of SEQ ID NO: 1 encoding a pyruvate carboxylase polypeptide having an amino acid sequence of SEQ ID NO: 2. 8.
    [4" claim-type="Currently amended] The nucleic acid molecule of claim 1, wherein said polynucleotide carries a nucleotide sequence encoding a pyruvate carboxylase polypeptide having a complete amino acid sequence encoded by a cosmid clone contained in ATCC Accession No. _______.
    [5" claim-type="Currently amended] An isolated nucleic acid molecule comprising a polynucleotide that hybridizes to a polynucleotide having the same nucleotide sequence as that of (a), (b) or (c) of claim 1 under stringent hybridization conditions, wherein An isolated nucleic acid molecule that does not hybridize to a polynucleotide having a nucleotide sequence consisting of only A residues or only T residues under stringent hybridization conditions.
    [6" claim-type="Currently amended] The isolated nucleic acid molecule of claim 1, wherein the polynucleotide is DNA.
    [7" claim-type="Currently amended] The isolated nucleic acid molecule of claim 1, wherein the polynucleotide is RNA.
    [8" claim-type="Currently amended] A method for producing a recombinant vector comprising inserting the isolated nucleic acid molecule of claim 1 into a vector.
    [9" claim-type="Currently amended] Recombinant vector prepared by the method of claim 8.
    [10" claim-type="Currently amended] A method of making a recombinant host cell comprising introducing the recombinant vector of claim 9 into a host cell.
    [11" claim-type="Currently amended] A recombinant host cell prepared by the method of claim 10.
    [12" claim-type="Currently amended] Culturing the recombinant host cell of claim 11 under conditions in which the pyruvate carboxylase polypeptide is expressed; And
    Recovering the polypeptide
    Recombinant method for producing a pyruvate carboxylase polypeptide comprising a.
    [13" claim-type="Currently amended] 13. The method of claim 12, wherein said pyruvate carboxylase is expressed 2-20 times more than its expression in Corynebacterium glutamicum .
    [14" claim-type="Currently amended] (a) the amino acid sequence of a pyruvate carboxylase polypeptide having the complete amino acid sequence of SEQ ID NO: 2;
    (b) amino acid sequence of a pyruvate carboxylase polypeptide having a complete amino acid sequence encoded by a cosmid clone contained in ATCC Accession No. _______
    An isolated pyruvate carboxylase polypeptide having an amino acid sequence of at least 95% identical to a sequence selected from the group consisting of:
    [15" claim-type="Currently amended] Expressing the nucleotide sequence of claim 1; And
    Recovering the amino acid
    Amino acid manufacturing method comprising a.
    [16" claim-type="Currently amended] The method of claim 15, wherein said amino acid is lysine.
    [17" claim-type="Currently amended] 16. The method of claim 15, wherein said pyruvate carboxylase is expressed 2-20 times more than its expression in Corynebacterium glutamicum .
    类似技术:
    公开号 | 公开日 | 专利标题
    US8124388B2|2012-02-28|Production of 3-hydroxypropionic acid using beta-alanine/pyruvate aminotransferase
    Ivey et al.1993|Cloning and characterization of a putative Ca2+/H+ antiporter gene from Escherichia coli upon functional complementation of Na+/H+ antiporter-deficient strains by the overexpressed gene.
    JP5486029B2|2014-05-07|Increased lysine production by gene amplification
    Keilhauer et al.1993|Isoleucine synthesis in Corynebacterium glutamicum: molecular analysis of the ilvB-ilvN-ilvC operon.
    DE69534592T2|2006-08-10|Process for the preparation of l-lysine
    DE102004001674B4|2019-01-24|Process for the preparation of L-lysine using methanol-utilizing bacteria
    KR100815415B1|2008-03-20|Nucleotide sequences which code for the pck gene
    JP4451393B2|2010-04-14|Coryneform bacterium transformant and method for producing dicarboxylic acid using the same
    CN1323171C|2007-06-27|Method or microbial production of amino acids of aspartate and/or glutamate family and agents which can be used in said method
    AU718147B2|2000-04-06|Transaminases and aminotransferases
    Peters-Wendisch et al.1998|Pyruvate carboxylase from Corynebacterium glutamicum: characterization, expression and inactivation of the pyc gene
    EP1510570B1|2014-07-23|Method for producing L-histidine using bacteria of enterobacteriaceae family
    Bott et al.1995|Regulation of anaerobic citrate metabolism in Klebsiella pneumoniae
    EP2041276B1|2012-02-29|Method for producing l-amino acids by means of mutants of the glta gene coding for citrate synthase
    KR20130117753A|2013-10-28|Recombinant host cells comprising phosphoketolases
    Sindelar et al.2007|Improving lysine production by Corynebacterium glutamicum through DNA microarray-based identification of novel target genes
    KR101070110B1|2011-10-05|Aldehyde dehydrogenase gene
    DE19831609B4|2009-11-12|Process for the preparation of amino acids of the aspartate and / or glutamate family and agents which can be used in the process
    US5814473A|1998-09-29|Transaminases and aminotransferases
    JP3967812B2|2007-08-29|Production method of organic acid by pyruvate carboxylase genetically modified cells
    JPWO2007046389A1|2009-04-23|Method for producing succinic acid
    US20030148474A1|2003-08-07|New mutant glutamine synthetase and method for producing amino acids
    US6680190B2|2004-01-20|Gene encoding phosphoglucoisomerase
    ES2197076T5|2009-05-20|Procedure for microbial production of l-valine.
    EP2354235B1|2014-11-19|Method for the fermentative production of L-amino acids involving the use of coryneform bacteria
    同族专利:
    公开号 | 公开日
    CN1336958A|2002-02-20|
    JP2003503006A|2003-01-28|
    WO2000039305A1|2000-07-06|
    AU2203399A|2000-07-31|
    CA2356446A1|2000-07-06|
    BR9816106A|2001-09-11|
    MXPA01006290A|2002-04-17|
    EP1147198A1|2001-10-24|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    法律状态:
    1998-12-23|Application filed by 자밀라 제트. 허벡, 메사추세츠 인스티튜트 오브 테크놀로지
    1998-12-23|Priority to PCT/US1998/027301
    2001-12-20|Publication of KR20010112232A
    优先权:
    申请号 | 申请日 | 专利标题
    PCT/US1998/027301|WO2000039305A1|1998-12-23|1998-12-23|PYRUVATE CARBOXYLASE FROM $i|
    [返回顶部]