• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    Composition for the treatment of the side effects of radiotherapy and/or chemotherapy. The present invention is directed to the use of a composition for the treatment and/or prevention of the side effects of radiotherapy and/or chemotherapy, preferably as a post-treatment protective composition, that is, the effect occurs once the cells have been radiated (restores phenotype and gap junctions and reduces senescence). Therefore, said composition comprises two chemical compounds that can protect and treat tissues that have been affected or are at risk of being affected by the side effects of chemotherapy and/or radiotherapy. The present invention is also directed to a kit comprising the composition of the present invention for the treatment and/or prevention of the side effects of radiotherapy and/or chemotherapy. (Machine-translation by Google Translate, not legally binding)
    公开号:ES2789898A1
    申请号:ES201930367
    申请日:2019-04-25
    公开日:2020-10-26
    发明作者:Santos María Dolores Mayan；Nebril Benigno Acea；Eirin Marta Varela；Candela Mateos Marina Rodriguez；Carballa Carlota Czestokowa Diaz；Capdevila Eduardo Fonseca；Calvo Luis Carlos Barrio；Lopez Adela Escudero
    申请人:Fund Profesor Novoa Santos；Fundacion para la Investigacion Biomedica del Hospital Universitario Ramon Y Cajal；Universidade da Coruna；Servizo Galego de Saude SERGAS；
    IPC主号:
    专利说明:

    [0001] Composition for the treatment of side effects of radiotherapy and / or
    [0002] Technical field
    [0003] The present invention is in the field of biomedicine. In particular, it provides a composition for the treatment and / or prevention of the side effects of radiotherapy and / or chemotherapy in an animal or individual. The present invention also provides a kit for the treatment and / or prevention of the side effects of radiotherapy and / or chemotherapy in an animal or individual.
    [0005] Prior state of the art
    [0006] Oleuropein is a chemical compound that can be extracted from the pulp of green olives and olive leaves of the Olea europaea variety . Oleuropein is the main phenolic component of the pulp of green olives and can also be found in extra virgin olive oil, which gives it its bitter taste.
    [0008] Oleuropein has been shown to be an active compound that has antioxidant, anti-inflammatory, antiatherogenic, anticancer, antimicrobial, and antiviral properties (Omar, 2010, Sci Pharm 78 (2): 133-54). Oleuropein has also been shown to be used to treat rough or aged skin scars or skin (US 8,591,961) and to improve skin healing after a skin incision (Mehraein, et al., 2014, Cell J. 16 ( 1): 25-30).
    [0010] Breast cancer affects approximately 12% of women in the world (McGuire et al., 2015, Cancers 7 (2): 908-29). Common methods of treating breast cancer include radiation therapy and chemotherapy. Radiation therapy and chemotherapy can damage the skin, causing, for example, fibrosis, inflammation, and radiation dermatitis. Therefore, there is a need to provide compositions capable of preventing, curing and / or alleviating the side effects of radiotherapy and / or chemotherapy.
    [0012] The authors of the present invention have developed a composition for use in treatment (preferably as a post-treatment protective composition, since the effect occurs once the cells have been radiated - it restores phenotype and intercellular communication through gap junctions and reduces senescence. -) or the prevention of side effects caused by radiotherapy and / or chemotherapy and a kit comprising said composition for the same use. Specifically, the present invention restores the dermal fibroblast phenotype, reduces the degree of cellular senescence and inhibits the synthesis of the post-treatment SASP ( senescence-associated secretory phenotype) component to promote tissue regeneration and prevent fibrosis and other degenerative effects.
    [0013] Description of the figures
    [0014] Figure 1 . Increased levels of connexin43 (Cx43) in dermal fibroblasts from breast cancer patients undergoing chemotherapy or radiotherapy. A. Immunofluorescence for the detection of Cx43 (in red), showing an increase in Cx43 in dermal fibroblasts isolated from the skin of patients with different subtypes of breast cancer and who have been treated with radiotherapy or chemotherapy compared to fibroblasts from patients with benign disease (not subjected to treatment) (healthy control, 4). Cell nuclei stained with DAPI appear in blue. Samples 1 (back skin) and 2 (skin in the breast area) correspond to fibroblasts isolated from two areas of skin from the same patient with Her2 + breast cancer. Sample 1 had not undergone radiotherapy, and the patient had been treated with chemotherapy and anti-Her2 antibodies one year before obtaining the skin sample. Sample 2 underwent radiotherapy before obtaining it. Sample 3 corresponds to the skin of a patient with luminal B Her2- breast cancer who underwent neoadjuvant chemotherapy six weeks before taking the sample. Sample 4 comes from a patient with benign disease and not undergoing any treatment. B. Treatment with different concentrations of oleuropein (0.1 pM, 1 pM and 10 pM for 2 hours) of fibroblasts isolated from a donor with Her2 + breast cancer reduced the levels of Cx43 detected in fibroblasts isolated from skin samples that have have undergone radiation therapy (left) or chemotherapy (right). To carry out these tests, the same number of cells was used and tubulin or GAPDH were used as loading control in western blots. In all cases, oleuropein reduced Cx43 levels by 50 to 68% both in dermal fibroblasts isolated from donor samples subjected to different treatments (radiotherapy and chemotherapy), as well as in donor fibroblasts without any treatment, confirming its use to improve cell healing in both pathological situations that trigger an increase in Cx43 (such as ulcers in patients with diabetes), and in non-pathological situations (the decrease in Cx43 accelerates regeneration time and improves skin scarring) (Ghatnekar et al., 2009; Laird and Lampe, 2018; Ongstad et al., 2013).
    [0016] Figure 2 . Loss of intercellular communication capacity through gap junctions (UCs) or gap junctions in dermal fibroblasts of patients undergoing chemotherapy or radiotherapy. Cell coupling or dye coupling assay in which the transfer of 5,6-carboxyfluorescein (green) between fibroblasts in contact through UCs is studied. Fibroblasts isolated from patients with different subtypes of breast cancer and who have been treated with chemotherapy and / or radiotherapy were used in comparison with fibroblasts from patients with benign pathology (not subjected to treatment) (healthy control). Both chemotherapy and radiotherapy, despite increasing Cx43 levels in dermal fibroblasts, result in a lower percentage of cell coupling with respect to the activity of UCs in fibroblasts from healthy donors. The graph represents the percentage of fibroblasts carboxyfluorescein.
    [0018] Figure 3 . Oleuropein restores intercellular communication through UCs and improves cell phenotype. Treatment of dermal fibroblasts with 1 ^ M oleuropein for 4 h resulted in a change in cell morphology accompanied by a greater coupling through UCs, analyzed using the dye coupling technique . The asterisk (*) indicates the cell into which the 5,6-carboxyfluorescein fluorophore has been injected (green). The percentage of cells coupled by UCs is represented in graph C.
    [0020] Figure 4 . Dermal fibroblasts isolated from skin subjected to radiotherapy and / or chemotherapy show high levels of cellular senescence. A. In the work published by Campisi et al. (Demaria et al., 2014), the cells that activate cell senescence during the regeneration process in skin were identified. These authors demonstrated that fibroblasts and endothelial cells, but not keratinocytes, undergo cellular senescence (Demaria et al., 2014) and accumulation of senescent cells or defects in their elimination triggers fibrosis (Mosteiro et al., 2016; Munoz-Espin and Serrano, 2014). Chemotherapy and radiation therapy increase cellular senescence compared to fibroblasts isolated from healthy donor skin. To determine the level of cellular senescence, the X-Gal blue signal was quantified using the B-galactosidase assay. The graph shows the ratio of senescent cells with elevated blue signal versus total cells (Radio; radiotherapy. Chemo; chemotherapy). B. Treatment with 10 ^ M oleuropein for 72 hours after radiation exposure reduced the percentage of senescence in dermal fibroblasts (from healthy donor skin) undergoing experimental 55 Grays radiotherapy for approximately 30 minutes, According to the specifications of the linear accelerator model. The graph represents the ratio of senescent cells (high blue signal) versus total cells. C. Treatment of dermal fibroblasts exposed to radiation (55 Grays, 30 minutes) with 10 ^ M oleuropein for 48 hours reduced the levels of the senescence factor p53 to levels similar to the treatment with the senolytic dasatinib 0.2 ^ M combined with oleuropein 10 ^ M. To induce cellular senescence, the fibroblasts were treated with bleomycin at 50 µg / ^ L. The immunoblot against the p53 protein is shown, using tubulin and the Ponceau red stain ( Ponceau S Acid Red) as loading controls .
    [0022] Figure 5 . Post-radiotherapy modulatory effect of oleuropein and BIRB796 on cellular senescence and senescence-associated secretory phenotype ( SASP). A. Treatment with 10 ^ M oleuropein for 72 hours of fibroblasts isolated from healthy skin and subjected to experimental radiotherapy (55 Grays) was able to reduce the accumulation of senescent cells. Its combination with the SASP inhibitor BIRB796 (2.5 ^ M, 72 hours) did not modify the effect of oleuropein, detecting a similar reduction in the percentage of senescent cells. The levels of cellular senescence have been quantified as an X-Gal blue signal (B-galactosidase assay). The graph shows the ratio of senescent cells with elevated blue signal versus total cells. B, C. The triggers in fibrosis, by synthesizing and releasing enzymes involved in the remodeling of the matrix, an inflammatory component and factors such as IL-6 that participate in the reprogramming of neighboring cells (Mosteiro et al., 2016; Mosteiro et al., 2018) . Treatment for 72 hours of fibroblasts isolated from healthy skin and subjected to experimental radiotherapy of 55 Grays with BIRB796 (2.5 ^ M) protects from the synthesis of components of SASP such as MMP-3, involved in healing by degrading different types of collagens and fibronectin (B). Treatment with oleuropein would decrease the levels of cellular senescence (accumulation of senescent cells), and its combination with BIRB796 would reduce the SASP component, thus interfering with excess remodeling of the extracellular matrix (degradation of collagen III, IV, IX and X and other skin components). Increasingly, the presence of BIRB796 decreases the synthesis of the inflammatory component (IL-1B and IL-6) in the presence or absence of oleuropein (C), reducing inflammation in damaged tissue in the presence of senescent cells. The mRNA levels of MMP-3, IL-6 and IL-1p were normalized against the control gene HPRT1 and plotted in comparison to a control of healthy non-radiated fibroblasts. It should be noted that BIRB796 is a new generation inhibitor of p38 MAPK, a molecule involved in the senescence process in fibroblasts, and that, thanks to its efficacy and toxicological profile, it has managed to reach clinical trials in phases II and III in inflammatory diseases such such as rheumatoid arthritis (identifier at clinicaltrials.gov NCT02214888, Boehringer Ingelheim), Crohn's, ulcerative colitis and psoriasis (identifier NCT02209753, Boehringer Ingelheim). (Chiacchiera et al., 2012; Force et al., 2004; He et al., 2013; Ma et al., 2014; Mosteiro et al., 2018; Thalheimer et al., 2014; Zhang et al., 2014) .
    [0024] Figure 6 . The oleuropein-BIRB796 combination treatment favors the migration of the dermal fibroblast in a wound closure or scratch test. Scratch test in dermal fibroblasts originally from healthy skin and experimentally irradiated to 55 Grays, to which 10 ^ M oleuropein treatments, BIRB7962.5 ^ M or a combination of both were applied for 24-48 hours. The state of the assay is shown 24 hours after the scratch is carried out, as well as the quantification of the total cells present in the original scratch space (delimited by the dotted lines) after this time band for each of the conditions. The wound closure test is a direct and inexpensive method for the study of cell migration in vitro. It is based on the fact that, when making an artificial wound (called scratch) in a monolayer of confluent cells, the cells of the newly created borders move towards the opening to close the scratch until new cellular contacts are established. In general terms, a scratch is performed on a cell monolayer, pictures are taken at the beginning and at regular intervals during the migration of cells, and compared to determine the rate of cell migration.
    [0025] The present invention is directed to the use of a composition for the treatment and / or prevention of the side effects of radiotherapy and / or chemotherapy, preferably as a post-treatment protective composition, that is, the effect occurs once the cells have been radiated (restores phenotype and gap junctions and reduces senescence). Therefore, said composition comprises two chemical compounds that can protect and treat tissues that have been affected or are at risk of being affected by the side effects of chemotherapy and / or radiotherapy. The present invention is also directed to a kit comprising the composition of the present invention for the treatment and / or prevention of the side effects of radiotherapy and / or chemotherapy.
    [0027] Detailed description of the invention
    [0028] Definitions
    [0029] If not specifically mentioned to the contrary, the term " comprises " is used, in the context of this application, to indicate that the list of components may include optional aspects mentioned or not mentioned. The term " comprises " may also include the concept " consists of".
    [0031] The terms " treatment " or " therapy ", as used in the present description, refer to a set of hygienic, pharmacological, surgical and / or physical means whose purpose is the cure or alleviation of diseases and / or symptoms. . The terms " treatment " or " therapy " encompass both prophylactic and curative methods, as both are aimed at maintaining or restoring health. Regardless of the origin of the ailment, disease or disability, its relief, by the administration of the appropriate remedy, is understood as therapy or therapeutic use in the context of the present invention.
    [0033] The term " prevention ", as used in the present description, refers to a set of hygienic, pharmacological, surgical and / or physical means whose purpose is to prevent diseases and / or symptoms from developing in an animal or individual. The term " prevention " encompasses prophylactic methods, as it is aimed at maintaining health.
    [0035] The term " radiotherapy ", as used in the present description, refers to a form of treatment based on the use of ionizing radiation. Such ionizing radiation comprises X-rays or radioactivity, which includes gamma rays and alpha particles.
    [0037] The term " chemotherapy ", as used in the present description, refers to a form of treatment based on the administration of chemical substances for the treatment of a disease, in particular cancer. The term " chemotherapy " also refers to a form of treatment based on or you are at risk for cancer.
    [0039] In the present invention, radiotherapy and / or chemotherapy can be part of a neoadjuvant therapy.
    [0041] The term " antibody " as used herein refers to immunoglobulin molecules and immunologically active fragments of immunoglobulin molecules, that is, molecules that contain an antigen-binding site that specifically binds (immunoreacts). Examples of immunologically active fragments include F (ab) and F (ab ') 2 fragments that can be generated by treating the antibody with an enzyme such as pepsin. Antibodies can be polyclonal (typically include different antibodies directed against different determinants or epitopes) or monoclonal (directed against a single determinant on the antigen).
    [0043] The monoclonal antibody can be biochemically altered, by genetic manipulation, or it can be synthetic, the antibody possibly lacking in whole or in parts, of fragments or portions that are not necessary for the recognition of the antigen and being replaced by others that confer to the antibody additional advantageous properties.
    [0045] The antibody can also be recombinant, chimeric, humanized, synthetic, or a combination of any of the above. A "recombinant antibody or polypeptide " (rAC) is an antibody that has been produced in a host cell that has been transformed or transfected with the nucleic acid encoding the polypeptide or antigen, or produces the polypeptide or antigen as a result of recombination. homologous.
    [0047] The term "therapeutic antibodies " as used in the present description, refers to a drug for the treatment of cancer which, without limitation, comprises: trastuzumab, rituximab, gemtuzumab ozogamicin, alemtuzumab, ibritumomab tiuxetan, tositumomab-I-131, cetuximab, bevacizumab, panitumumab, ofatumumab, ipilimumab, brentuximab vedotin, pertuzumab, adotrastuzumab emtansine and / or obinutuzumab.
    [0049] The term "drugs" as used in the present description, refers to a drug for the treatment of diseases, such as cancer, and, without limitation, comprises: abiraterone, altretamine, anhydrovinblastine, auristatin, bexarotene, bicalutamide, BMS 184476, 2,3,4,5, 6-pentafluoro-N- (3-fluoro-4-methoxyphenol) benzene sulfonamide, bleomycin, N, N-dimethyl-L-valyl-L-valyl-N-methyl-L -valyl-L-proly- 1- Lproline-t-butylamide, cachectin, cemadotin, chlorambucil, cyclophosphamide, 3 ', 4'-didehydro-4'-deoxy-8'-Norvin-caleukoblastine, docetaxol, doxetaxel, carboplatin, carmustine , cisplatin, cryptophycin, citarbine, dacarbazine (DTIC), dactinomycin, daunorubicin, decitabine and hydroxyureataxanes, ifosfamide, liarozole, lonidamine, lomustine (CCNU), MDV3100, mechlorethamine, melphalan, mivobulin isethionate, rhizoxin, sertenef, streptozocin, mitomycin, methotrexate, taxanes, nilutamide10, paenclustine98, fossapriston, procarbaxin98 stramustine, tamoxifen, tasonermin, taxol, tretinoin, vinblastine, vincristine, vindesine sulfate, and / or vinflunine.
    [0051] The term " neoadjuvant therapy " as used herein, refers to a treatment that is administered as a first step to shrink the tumor prior to the main treatment, which generally consists of surgery. Examples of adjuvant therapy are chemotherapy, radiation therapy, and hormone therapy.
    [0053] The terms " side effect " or " adverse drug reaction ", as used in this description, refer to any response to a drug that is harmful and unintended, and that occurs at doses that are normally applied in the animal or individual for the prophylaxis, diagnosis or treatment of diseases and / or symptoms.
    [0055] The terms "individual", " patient " or " subject " are used interchangeably in the present description, and are not intended to be limiting in any respect, the "individual", " patient " or " subject " may be of any age, sex and physical condition. The term " animal ", as used in the present description, refers to any organism that is eukaryotic, heterotrophic, and multicellular that is not human.
    [0057] The term "therapeutically effective amount " refers to an amount of chemical or chemical compound in the composition that has a therapeutic effect and is capable of alleviating or curing the side effects of radiation therapy and / or chemotherapy.
    [0059] Active component
    [0060] In a first aspect, the present invention provides a composition (hereinafter composition of the invention) for use in a method of treatment and / or prevention against the side effects of radiotherapy and / or chemotherapy, preferably as a post protective composition. treatment. In a preferred embodiment, the composition comprises a chemical compound according to formula (I):
    [0063] where
    [0065] R1-R2 are, independently, -OH, -NH2, or -SH; preferably R1 and R2 are -OH;
    [0067] R3 and R5 are independently hydrogen, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, aryl, -OH, C1-C6 alkoxy, halogen, NO 2 , NH 3, or COOCH 3 ; preferably R3 is COOCH 3 and R5 is hydrogen;
    [0069] X1-X3 are, independently, oxygen, sulfur, -CH 2, or carboxy; preferably X1, X2 and X3 are oxygen; Y
    [0071] R4 is hydrogen, C1-C6 alkoxy, glucose, pD-glucopyranose, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, aryl, -OH, halogen, NO 2 , NH 3 , carbohydrate, amino acid, nucleotide, lipid, or its enantiomer; preferably R4 is glucose, or its enantiomer.
    [0073] In an alternative aspect to the first aspect, the present invention provides a composition for use in a method of treatment and / or prevention against the side effects of radiotherapy and / or chemotherapy, preferably as a protective composition post-treatment with radiotherapy and / or chemotherapy, where said composition comprises a chemical compound according to formula (II) (BIRB compound 796),
    [0076] or an analog to the compound of formula II comprising the following chemical structure:
    [0081] where in order not to unnecessarily increase the number of pages in this document, we make explicit reference to the definition given for each of the radicals Ar1, X, Ar2, L and Q shown in the formula above, to what is exposed in the column 6, line 48, to column 10, line 33, of patent application US6319921B1. Additionally, as concrete examples of BIRB 796 analogues, we incorporate by explicit reference the expressly mentioned compounds from column 10, line 55, to column 17, first line, of patent application US6319921B1.
    [0083] Additionally, the present invention also includes analogues of BIRB 796 such as those shown in US6319921B1, a document that we fully incorporate by reference.
    [0085] The term "active component " as used in the present invention, refers to a chemical compound according to formula (I) and / or (II) and / or an analog of the compound of formula II as described above. It is noted that preferably and permeating any aspect or embodiment of the present invention, said active component (I) can be combined with BIRB 796 (Doramapimod) or an analog lift simultaneously or sequentially or in any order.
    [0087] In this way, the active component of the composition of the present invention is selected from a chemical compound according to formula (I) or (II) or an analog of the compound of formula II, or any combination thereof.
    [0089] In a preferred embodiment, the composition comprises a plant extract containing a therapeutically effective amount of the chemical compound according to formula (I) optionally in combination with a compound of formula (II) and / or an analog of the compound of formula II. The extract can comprise any extract obtained by extracting ethanol, acetone, inorganic and organic acid or base and / or aqueous solution from any plant tissue where a therapeutically effective amount of the chemical compound according to formula (I) can be extracted. In a preferred embodiment, the composition comprises an extract derived from Olea europaea, Ligustrum obtusifolium, Fraxinus excelsior, F. angustifolia, F. chinensis, Syringa josikaea, S. vulgaris, Philyrea latifolia, Ligustrum ovalifolium, L. vulgare, or any other genus belonging to the family Oleaceae.
    [0091] In another preferred embodiment, the chemical compound according to formula (I) is oleuropein. Oleuropein is a chemical compound according to formula (III):
    [0096] The composition of the present invention is used in a method for treating and / or preventing the side effects of radiotherapy and / or chemotherapy on the skin of an individual or animal. For example, but not limited to, the composition is used in a method of treating side effects resulting from radiation therapy and / or chemotherapy treatment, preferably skin side effects such as fibrosis, inflammation, radiation dermatitis, skin fragility, skin erosions. skin folds, loss of nails, or dry skin caused (s) by radiation therapy and / or chemotherapy.
    [0098] In a preferred embodiment, the individual or animal suffers from or is at risk of developing cancer. In a preferred embodiment, the cancer is selected from a group comprising: prostate, breast, ovarian, endometrial, cervix, lymphoid cancer, brain, head and neck cancer, leukemia, cancer of the intestinal, kidney, multiple myeloma, non-small cell lung cancer, pancreatic cancer, glioblastoma, melanoma, colon cancer, lymphomas and / or neuroendocrine tumors. Preferably, the cancer or tumor is breast, brain, head and neck cancer and lymphomas. Even more preferably, the cancer or tumor is breast cancer.
    [0100] Additives
    [0101] In a preferred embodiment, the composition further comprises one or more additives, such as a carrier solvent, a preservative, a surfactant, a gelatinizing agent, and / or a pH buffer.
    [0103] A "carrier solvent " refers to the component of the composition in which the active component is dissolved. The carrier solvent of the present invention can include, but is not limited to, petrolatum, water, lanolin, polyethylene glycol, alcohols, and / or vegetable oils.
    [0105] A " preservative " refers to a substance that stops or minimizes spoilage caused by the presence of different types of microorganisms. The preservative of the present invention may include, but is not limited to, methyl paraben, propyl paraben, benzyl alcohol, potassium sorbate, ethylhexylglycerin, phenoxyethanol, EDTA, grapefruit seed extract, tea tree oil, sodium benzoate, and / or dehydroacetic acid.
    [0107] A " surfactant " refers to a substance that influences through surface tension at the interface between two phases. The surfactant of the present invention may include, but is not limited to, sodium lauryl sulfate, ammonium lauryl sulfate, disodium lauryl sulfosuccinate, cocamphocarboxyglycinate, cocoaminopropyl betaine, and / or alpha olefin sulfonate.
    [0109] A "gelatinizing agent " refers to a substance that can gel the liquid in which it is dissolved. The gelatinizing agent of the present invention may include, but is not limited to, agar-agar, alginine, carrageenan, collagen, cornstarch, gelatin, guar gum, locust bean gum, pectinapectin, and / or xanthan gum.
    [0111] The pH buffer can include, but is not limited to, citric acid, lactic acid, sodium lactate, sodium acetate, sodium phosphate, sodium citrate, sodium borate, and / or sodium gluconate.
    [0113] In a preferred embodiment, the composition may further comprise phospholipids, amino acids, vitamins and / or peptides. Phospholipids, amino acids, vitamins and / or peptides can help protect, hydrate and / or regenerate the skin.
    [0114] In a preferred embodiment, the composition is administered by a topical delivery system. The composition of the present invention can be a gel, cream or ointment. Said composition can be administered to the area affected by the side effects of radiotherapy and / or chemotherapy. Said composition can also be administered preventively on the area at risk of being affected by the side effects of radiotherapy and / or chemotherapy. For example, but not limited to, the composition can be applied to the skin affected or at risk of being affected by the side effects of radiotherapy and / or chemotherapy, and can be rubbed gently for a few minutes so that the skin can absorb the component. active.
    [0116] In a preferred embodiment, the composition is administered immediately after a session of radiotherapy and / or chemotherapy or within one or two days after the session. In another preferred embodiment, the composition is used to treat the side effects of radiotherapy and / or chemotherapy after 1-4 weeks of radiotherapy and / or chemotherapy treatment and in another even more preferred embodiment, the composition is used to decrease the scars that arose from the side effects of radiation therapy and / or chemotherapy.
    [0118] The composition of the present invention can be administered one or more times. A dose of the composition may comprise 0.5-1000 mg of the active component. Preferably a dose comprises 0.5-100mg, 0.5-50mg, 0.5-25mg, 0.5-10mg, 0.5-2.5mg, 1.0-2.5mg or 1.5 - 2.5 mg of active component. In a preferred embodiment, the composition contains a therapeutically effective amount of the active component of the present invention.
    [0120] Kit
    [0121] In a second aspect, the present invention provides a kit for use after the treatment and / or prevention of the side effects of radiotherapy and / or chemotherapy in an animal or individual, wherein said kit comprises the composition of the present invention, as described above. It is noted that said kit could be configured as a kit of parts ("kit of parts") containing in separate containers a composition that comprises the compound of formula (I) as active principle, and a composition that comprises the compound of formula (II ) and / or an analog of the compound of formula II.
    [0123] In a preferred embodiment, the kit composition comprises a plant extract containing a therapeutically effective amount of the chemical compound according to formula (I) and optionally a compound of formula (II) and / or an analog of the compound of formula II. The extract can comprise any extract obtained by extracting ethanol, acetone, inorganic and organic acid or base and / or aqueous solution from any plant tissue where a therapeutically effective amount of the chemical compound according to formula (I) can be extracted. In a preferred embodiment the Another preferred embodiment, the chemical compound according to formula (I) is oleuropein (formula III).
    [0125] The kit of the present invention is used in a method for treating and / or preventing the side effects of radiotherapy and / or chemotherapy on the skin of an individual or animal. For example, but not limited to, the kit is used in a method of treating and / or preventing side effects arising from radiation therapy and / or chemotherapy treatment, preferably skin side effects such as fibrosis, inflammation, radiation dermatitis, skin fragility , skin fold erosions, nail loss, or dry skin caused (s) by radiation therapy and / or chemotherapy.
    [0127] Examples
    [0129] Isolation of primary fibroblasts, cell culture and treatments
    [0130] Skin tissue biopsies were obtained from female patients from the Complejo Hospitalario Universitario de A Coruña - Xerencia Xestión Integrada A Coruña (CHUAC-XXIAC) from operations to remove benign pathology (fibroadenoma, untreated healthy skin samples) and oncological interventions ( skin samples subjected to radiotherapy and chemotherapy). Signed informed consent was obtained from each of the patients (2015/029, C.0003333, 2016/077). For the isolation of primary fibroblasts from these samples, hypodermic fat was removed with the aid of a scalpel, and the epidermis were segmented into approximately 1x1 cm fragments (explants). A 100 cm2 adherent Petri dish was scratched with a scalpel as a grid, and each of the explants was placed at the resulting intersections with the epidermis facing up and the dermis in contact with the plate. After a few minutes of incubation in the cell culture oven at 37 ° C to promote adhesion, Dulbecco's Modified Eagle Medium (DMEM, Invitrogen Life Technologies) supplemented with 20% fetal bovine serum and 1% penicillin / streptomycin ( 100 U / mL penicillin, 100 pg / mL streptomycin; Gibco, Invitrogen Corporation) and were left in the cell culture oven at 37 ° C, 5% CO2 and humidity saturation with periodic medium changes until fibroblasts were observed. primary. Once 70% confluence was reached, the explants were discarded and the cells were transferred to another culture plate, expanding them regularly in DMEM medium containing 10% fetal bovine serum and 1% penicillin / streptomycin. The experiments used healthy primary dermal fibroblasts from skin subjected to radiotherapy and chemotherapy in intermediate culture passages (passages 5 to 10). They underwent treatments with various molecules in order to observe their effect on connexin43 (Cx43) and the process of cellular senescence: oleuropein (Extrasynthese), the senolytic agent dasatinib (Bristol-Myers Squibb Pharma EEIG), the inducing agent of senescence bleomycin (Almirall ®) and the SASP inhibitor BIRB796 (MedChemExpress). The working concentrations of these compounds were determined by bibliographic review and cell viability tests (MTT).
    [0131] To simulate the effects of radiotherapy on healthy dermal fibroblasts, experimental radiotherapy trials were carried out where the cells were exposed to 55 Grays in the Varian TrueBeam linear electron accelerator (Radiotherapy Service of the Oncology Center of Galicia). For this, the cells were transported in hermetic cell culture supports with 1 cm of culture medium thick to ensure uniform radiation, which was renewed 5 hours after radiation.
    [0133] Immunofluorescence .
    [0134] Primary cultured dermal fibroblasts were fixed with 2% paraformaldehyde in PBS. After washing with PBS, they were incubated with a 0.1M glycine solution for 10 minutes at room temperature. The membranes were permeabilized with a 0.2% Triton X-100 solution in PBS, for 10 minutes at room temperature. To block nonspecific binding sites in the preparation, cells were incubated for 30 minutes with a solution of 1% bovine serum albumin in PBS supplemented with 0.1% Tween-20 (PBS-T). Subsequently, the cells were incubated with the rabbit anti-Cx43 primary antibody (C6219, Sigma-Aldrich) for 1 hour at room temperature. After washing the excess primary antibody with PBS-T, the fluorescein isothiocyanate (FITC) labeled goat anti-rabbit secondary antibody (F2765, Invitrogen) was incubated for 1 hour, at room temperature and in the dark. Excess secondary antibody was removed with PBS-T and nuclei were stained with 4 ', 6-diamino-2-phenylindole (DAPI) for 4 minutes at room temperature and darkness. Finally, excess DAPI was washed off and the preparations were mounted with glycergel for later analysis under the microscope.
    [0136] Western Blot.
    [0137] Fibroblast cell lysis was carried out in a cold buffer on ice (150 mM NaCl; 50 mM Tris-HCl, 5 mM EDTA, 0.5% NP-40, 0.1% SDS, 0.5% Sarkosyl). Equal amounts of proteins were separated on a denaturing 10% acrylamide / bis-acrylamide gel with SDS and transferred to a polyvinylidene membrane in a Trans-Blot® SD Semi-Dry Transfer Cell. After blocking nonspecific membrane junctions by incubation for 1 hour at room temperature with a 5% milk solution in a TBS-T buffer (20 mM Tris, 150 mM NaCl, 0.05% Tween-20), the membranes they were incubated with the corresponding primary antibody for 16 hours at 4 ° C, in rotation. The excess antibody was removed by successive washes with TBS-T buffer, after which it was incubated with the secondary antibody labeled with horseradish peroxidase (HRP) for 1 hour at room temperature, in rotation. After removing excess secondary antibody by washing with TBS-T, the signal was visualized by chemiluminescence in an Amersham Imager 600 developing chamber. Mouse anti-tubulin (T9026, Sigma-Aldrich), rabbit anti-Cx43 primary antibodies were used (C6219, Sigma-Aldrich), mouse anti-p53 (sc-126, Santa Cruz Biotechnology) and mouse anti-GAPDH (6C5, Thermo Fisher Scientific), and the secondary sheep anti-mouse (NA-931, Sigma-Aldrich) and goat anti rabbit (A6154, Sigma-Aldrich).
    [0138] Cell coupling through Dye coupling.
    [0139] Fibroblasts were cultured to a confluence of approximately 70%. A 5,6-carboxyfluorescein solution was injected into a cell and the transfer of this fluorophore to adjacent cells was evaluated.
    [0141] Hematoxylin staining for phenotypic determination
    [0142] To study the phenotype of the various cell types, fibroblasts were grown on glass coverslips previously treated with poly-D-Lysine hydrobromide (Sigma) to guarantee adherence, until reaching 80% confluence. They were then fixed with 4% paraformaldehyde and washed with phosphate buffered saline (PBS). Gill III hematoxylin staining was performed for 5 minutes. Dehydration was carried out by passages in increasing concentrations of alcohol (80 ° - 90 ° - 100 °) and finally in xylene. They were mounted on slides and viewed and photographed on an Olympus BX61 microscope.
    [0144] P-galactosidase senescence assay
    [0145] The degree of senescence and P-galactosidase activity of the samples were determined by the analysis of the X-Gal blue staining, using the Senescence Cells Histochemical Staining Kit (Sigma). The protocol specified by the manufacturer was followed. Briefly, cells were cultured in glass coverslips previously treated with poly-D-Lysine hydrobromide, fixed and incubated overnight in the staining solution in an oven at 37 ° C in the absence of CO2. Finally they were assembled and observed and photographed on an Olympus BX61 microscope. X-Gal positive cells were counted, differentiating between moderate staining and high staining, and their ratio was calculated against total cells. ImageJ (NIH) image analysis software was used.
    [0147] Gene expression analysis (qPCR)
    [0148] TRI Reagent (MRC) was used to extract RNA from the various cell types, following the manufacturer's instructions. Once isolated, it was subjected to a treatment with DNase to eliminate possible contaminating DNA residues (1 ^ L of DNase, 2 ^ L of reaction buffer 10X -200 mM Tris-HCL pH 8.4, 20 mM MgCl2, 500 mM KCl- and completing with water up to 20 ^ L). For this, the reaction was incubated at 37 ° C for 15 minutes and finally stopped with 25mM of ethylenediaminetetraacetic acid (EDTA) at pH 8 for 15 minutes at 65 ° C. The quantity and quality of the RNA obtained in the Nanodrop ND-1000 was quantified. From the RNA extracted in the previous step, the complementary DNA (cDNA) was obtained using the Superscript®VILOTM cDNA Synthesis Kit (Invitrogen), performing the reverse transcription of 1 µg of RNA. The reverse transcription program comprised the following steps: 10 minutes at 25 ° C, 60 minutes at 42 ° C, 5 minutes at 85 ° C and holding the samples at 4 ° C. Finally, the DNA obtained was amplified using PowerUp ™ SYBR® Green Master Mix (Thermo Fisher Scientific) in the LightCycler 480 Instrument Roche Applied Science equipment. Replicas of each condition were made, using specific antisense and sense primers for the genes of interest: matrix metalloproteinase-3 (MMP-3). The reaction program consisted of the following steps: incubation for 10 min at 95 ° C, amplification of 50 cycles of 10 seconds at 95 ° C and 1 min at 65 ° C, and cooling for 20 seconds to 4 ° C. E1HPRT1 was used as the reference gene, and the levels of gene expression were analyzed referring to a cellular control (non-radiated or radiated cells not subjected to any treatment).
    [0150] The primers used are detailed below: HPRT1: TTGAGTTTGGAAACATCTGGAG (sense), GCCCAAAGGGAACTGATAGTC (antisense). IL-1P: CGAATCTCCGACCACCACTAC (sense), TCCATGGCCACAACAACTGA (antisense). IL-6: TGTAGCCGCCCCACACA (sense), GGATGTACCGAATTTGTTTGTA (antisense). MMP-3: CCCTGGGTCTCTTTCACTCA (sense), GCTGACAGCATCAAAGGACA (antisense)
    [0152] Healing, wound closure or Scratch assay.
    [0153] Fibroblasts were seeded in 6-well culture plates and grown to 90-100% confluence. At that time, a wound or scratch was made in the center of the well with the help of a 100 pL pipette tip, its longitudinal axis always remaining perpendicular to the bottom of the well. Subsequently, each well was carefully washed with culture medium (DMEM at 10% fetal bovine serum and 1% penicillin / streptomycin) to eliminate cells that could have detached, and finally the experimental treatments were applied in DMEM medium at 10%. of fetal bovine serum and 1% penicillin / streptomycin supplemented with the various compounds under study. Each well was photographed under the microscope on the day of scratch start and every 24 h until the end of the experiment. The total of cells present in the original wound space was quantified for each condition.
    权利要求:
    Claims (13)
    [1]
    1. A composition comprising a chemical compound according to formula (I):

    [2]
    2. The composition for use according to claim 1 characterized in that the chemical compound according to formula (I) is oleuropein.
    [3]
    The composition for use according to any of claims 1 to 2 characterized in that the side effects of radiotherapy and / or chemotherapy are manifested on the skin of an animal or individual.
    [4]
    4. The composition for use according to any of claims 1 to 3 characterized in that the individual or animal suffers from cancer.
    [5]
    5. The composition for use according to any of claims 1 to 4 characterized in that the individual or animal suffers from breast cancer.
    [6]
    because the composition comprises a carrier solvent, a preservative, a surfactant, a gelatinizing agent and / or a pH buffer.
    [7]
    7. The composition for use according to any of claims 1 to 6 characterized in that the composition comprises phospholipids, amino acids, vitamins and / or peptides.
    [8]
    8. The composition for use according to any of claims 1 to 7 characterized in that the composition is a gel, cream or ointment.
    [9]
    9. Use of a kit in the preparation of a drug for the treatment and / or prevention of the side effects of radiotherapy and / or chemotherapy in an animal or individual, characterized in that the kit comprises a composition that in turn comprises a chemical compound according to formula (I):

    [10]
    10. The use according to claim 9 characterized in that the chemical compound according to formula (I) is oleuropein.
    [11]
    The use according to any of claims 9 to 10 characterized in that the side effects of radiotherapy and / or chemotherapy are manifested on the skin of an animal or individual.
    [12]
    individual or animal suffers from cancer.
    [13]
    The use according to any one of claims 9 to 12 characterized in that the individual or animal suffers from breast cancer.
    类似技术:
    公开号 | 公开日 | 专利标题
    Gangadaran et al.2017|Extracellular vesicles from mesenchymal stem cells activates VEGF receptors and accelerates recovery of hindlimb ischemia
    Zahran et al.2015|Sildenafil activates antioxidant and antiapoptotic genes and inhibits proinflammatory cytokine genes in a rat model of renal ischemia/reperfusion injury
    Ghazavi et al.2017|Fibroblast growth factor type 1 |-overexpressed adipose-derived mesenchaymal stem cells | induce neuroprotection and functional recovery in a rat stroke model
    JP6484174B2|2019-03-20|Use of PEDF-derived polypeptides for preventing and / or improving skin aging
    Yi et al.2019|Bone marrow-derived cells or CXC motif chemokine 12 | treatment improve thin endometrium in a mouse model
    Gupta et al.2011|Suppressor of cytokine signaling-3 and intimal hyperplasia in porcine coronary arteries following coronary intervention
    Agnić et al.2015|Effects of isoflurane postconditioning on chronic phase of ischemia–reperfusion heart injury in rats
    Jin et al.2017|Endogenous stem cells were recruited by defocused low-energy shock wave in treating diabetic bladder dysfunction
    JP5539609B2|2014-07-02|Deer antler extract for promoting angiogenesis
    Yang et al.2020|Induction of HO-1 by 5, 8-dihydroxy-4ʹ, 7-dimethoxyflavone via activation of ROS/p38 MAPK/Nrf2 attenuates thrombin-induced connective tissue growth factor expression in human cardiac fibroblasts
    Shah et al.2020|Wound healing properties of histatin-5 and identification of a functional domain required for histatin-5-induced cell migration
    ES2789898B2|2021-10-14|COMPOSITION FOR THE TREATMENT OF SIDE EFFECTS OF RADIOTHERAPY AND / OR CHEMOTHERAPY
    Nakhoul et al.2020|The therapeutic effect of active vitamin D supplementation in preventing the progression of diabetic nephropathy in a diabetic mouse model
    CN110575540B|2021-11-02|Use of PDGF inhibitors for the production of a medicament for the treatment of inflammatory intestinal diseases
    KR20180102661A|2018-09-17|Stem cells for wound healing
    Ma et al.2015|17AAG improves histological and functional outcomes in a rat CCI model through autophagy activation and apoptosis attenuation
    Geng et al.2021|HGF-modified dental pulp stem cells mitigate the inflammatory and fibrotic responses in paraquat-induced acute respiratory distress syndrome
    RU2752089C1|2021-07-22|Application of the compound for the preparation of a drug for the treatment of cerebral microangiopathy
    Isik et al.2016|Mesenchymal stem cell therapy for the streptozotocin-induced neurodegeneration in rats
    KR20190115276A|2019-10-11|Stem cell having improved hypoxia adaptation and therapeutic potential by induction of bnip3 expression and method for preparing the same, and cell therapeutic composition comprising the same
    US20200352954A1|2020-11-12|Methods of treating age-related symptoms in mammals and compositions therefor
    TW202140775A|2021-11-01|Composition and method for preventing or treating eye disorder
    KR20200142521A|2020-12-22|Application of PEDF-derived short peptides to tendon healing
    Luo et al.2021|Injectable cartilage matrix hydrogel loaded with cartilage endplate stem cells engineered to release exosomes for non-invasive treatment of intervertebral disc degeneration
    Jay2018|Mast Cell Influence in the Progression of Post-burn Hypertrophic Scar Pathophysiology
    同族专利:
    公开号 | 公开日
    EP3960748A1|2022-03-02|
    ES2789898B2|2021-10-14|
    WO2020216984A1|2020-10-29|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    US20130337088A1|2008-09-04|2013-12-19|Alan David Widgerow|Methods for treating scars and aging skin|
    CN109125182A|2018-10-16|2019-01-04|阿谷巴科技（唐山）有限公司|A kind of Cleupin cold cream and preparation method thereof with bacteriostasis|
    RU2220142C2|1999-01-19|2003-12-27|Берингер Ингельхайм Фармасьютиклз, Инк.|Aromatic heterocyclic compounds as anti-inflammatory agents|
    法律状态:
    2020-10-26| BA2A| Patent application published|Ref document number: 2789898 Country of ref document: ES Kind code of ref document: A1 Effective date: 20201026 |
    2021-10-14| FG2A| Definitive protection|Ref document number: 2789898 Country of ref document: ES Kind code of ref document: B2 Effective date: 20211014 |
    优先权:
    申请号 | 申请日 | 专利标题
    ES201930367A|ES2789898B2|2019-04-25|2019-04-25|COMPOSITION FOR THE TREATMENT OF SIDE EFFECTS OF RADIOTHERAPY AND / OR CHEMOTHERAPY|ES201930367A| ES2789898B2|2019-04-25|2019-04-25|COMPOSITION FOR THE TREATMENT OF SIDE EFFECTS OF RADIOTHERAPY AND / OR CHEMOTHERAPY|
    PCT/ES2020/070269| WO2020216984A1|2019-04-25|2020-04-27|Composition for the treatment of the side effects of radiotherapy and/or chemotherapy|
    EP20796375.2A| EP3960748A1|2019-04-25|2020-04-27|Composition for the treatment of the side effects of radiotherapy and/or chemotherapy|
    [返回顶部]