• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    Provided are: a novel white mildew resistance marker for melon plants; a white mildew-resistant melon plant carrying a white mildew resistance gene locus; and a method for producing a white mildew-resistant melon plant using the aforementioned white mildew-resistant melon plant. The white mildew resistance marker for melon plants according to the present invention contains a white mildew resistance gene locus on chromosome-6 in a homozygous state, said marker being characterized in that the white mildew resistance gene locus on chromosome-6 meets at least one of the following requirements (1) and (2). (1) The white mildew resistance gene locus on chromosome-6 is specified by the length of an amplification fragment that is amplified using the below-mentioned primer set 1, wherein the length of the amplification fragment is 133 nucleotides or longer: the primer set 1 is composed of a forward primer 1 comprising the nucleotide sequence represented by SEQ ID NO: 1 and a reverse primer 1 comprising the nucleotide sequence represented by SEQ ID NO: 2. (2) The white mildew resistance gene locus on chromosome-6 is specified by polymorphisms in nucleotides located at position-45, position-48, position-49, position-51, position-108, position-120, position-139, position-214 and position-327 in the nucleotide sequence represented by SEQ ID NO: 3.
    公开号:ES2691593A2
    申请号:ES201890033
    申请日:2016-05-31
    公开日:2018-11-27
    发明作者:Kazuo Kosugi；Ryohei Arimoto；Daisuke Maeda；Akihito KANO；Ryuji Ikesue
    申请人:TAKII & Co Ltd；Takii and Co Ltd；
    IPC主号:
    专利说明:

    5
    10
    fifteen
    twenty
    25
    30
    35
    oídio that includes a locus of resistance to oídio, and a method to produce a plant of melon resistant to oídio using the same.
    Means to solve the problem
    In order to achieve the above objective, the present invention provides an oid resistance marker for a melon plant, which includes: an oid resistance locus on chromosome 6 in a homozygous form, where the oid resistance locus on the chromosome 6 meets at least one of the following conditions (1) and (2):
    Condition (1): The oid resistance locus on chromosome 6 is identified by a length of an amplified fragment obtained by amplification using the following primer set 1, and the length of the amplified fragment is 133 bp or more.
    Primer set 1:
    a direct primer 1 consisting of a base sequence of SEQ ID NO: 1 a reverse primer 1 consisting of a base sequence of SEQ ID NO: 2
    Condition (2): The oid resistance locus on chromosome 6 is identified by base polymorphisms at positions 45, 48, 49, 51, 108, 120, 139, 214 and 327 in a base sequence of SEQ ID NO: 3.
    The present invention also provides a mildew-resistant melon plant that includes: an oid resistance locus on chromosome 6 in a homozygous form, where the oid resistance locus on chromosome 6 meets at least one of the following conditions ( 1 and 2):
    Condition (1): The oid resistance locus on chromosome 6 is identified by a length of an amplified fragment obtained by amplification using the following primer set 1, and the length of the amplified fragment is 133 bp or more.
    Primer set 1:
    a direct primer 1 consisting of a base sequence of SEQ ID NO: 1 a reverse primer 1 consisting of a base sequence of SEQ ID NO: 2
    Condition (2): The oid resistance locus on chromosome 6 is identified by base polymorphisms at positions 45, 48, 49, 51, 108, 120, 139, 214 and 327 in a base sequence of SEQ ID NO: 3.
    The present invention also provides a method for producing an mildew-resistant melon plant, which includes the following steps (a) and (b):
    5
    10
    fifteen
    twenty
    25
    30
    35
    (a) cross the mildew-resistant melon plant according to the present invention with another melon plant; Y
    (b) select a mildew-resistant melon plant from one or more melon plants obtained in step (a) or its progeny lines.
    Effects of the invention
    The inventors of the present invention carried out diligent studies, and discovered a new locus of resistance to powdery mildew as a marker of resistance to powdery mildew that exhibits resistance to powdery mildew. Melon plants that include the powder resistance marker have resistance to powdery mildew. Therefore, the mildew resistance marker for melon plants according to the present invention allows easy detection of mildew resistant melon plants, for example. Also, the mildew-resistant melon plant according to the present invention includes the mildew-resistant locus, for example, and, therefore, may have oidium resistance, for example. In addition, the oid resistance locus can confer oid resistance even if it is a single gene locus (monogenic factor), for example. Therefore, according to the mildew-resistant melon plant of the present invention, for example, progenies that have oidium resistance from F1 obtained by crossing the mildew-resistant melon plant of the present invention can also be easily obtained with other melon plants or their progenies. In addition, a melon plant that includes the mildew resistance marker is resistant to breeds of mildew mildew capable of infecting melon plants that include the mildew resistance genes described in the prior art document, for example. Therefore, the mildew-resistant melon plant of the present invention can eliminate the need for prevention and extermination using agricultural chemical compounds as conventionally performed, so that the labor problem and the cost of spraying the chemical compounds can be avoided agricultural, for example.
    Brief description of the drawings
    [Fig. 1] Figure 1 is a schematic view showing the relative locations of single nucleotide polymorphisms (SNPs) and the like on chromosome 6.
    [Figs. 2A to 2D] Figures 2A to 2D show photographs illustrating criteria to evaluate the disease index of melon plants in Example 1.
    5
    10
    fifteen
    twenty
    25
    30
    35
    Way of carrying out the invention
    1. Oid resistance marker for melon plants
    The powder resistance marker for a melon plant (also referred to simply as "resistance marker" hereinafter) according to the present invention is, as described above, an powder resistance marker for a melon plant. , which includes: an oid resistance locus on chromosome 6 in a homozygous form, where the oid resistance locus on chromosome 6 meets at least one of the following conditions (1) and (2):
    Condition (1): The oid resistance locus on chromosome 6 is identified by a length of an amplified fragment obtained by amplification using the following primer set 1, and the length of the amplified fragment is 133 bp or more.
    Primer set 1:
    a direct primer 1 consisting of a base sequence of SEQ ID NO: 1 a reverse primer 1 consisting of a base sequence of SEQ ID NO: 2
    Condition (2): The oid resistance locus on chromosome 6 is identified by base polymorphisms at positions 45, 48, 49, 51, 108, 120, 139, 214 and 327 in a base sequence of SEQ ID NO: 3.
    The oid resistance marker of the present invention is characterized in that it includes an oid resistance locus on chromosome 6 in a homozygous form and that the oid resistance locus on chromosome 6 meets at least one of the conditions (1 ) and (2).
    Other configurations or conditions are not particularly limited.
    In the present invention, "melon plants" are plants classified in Cucumis melo of the genus Cucumis.
    In the present invention, examples of the powdery mildew pathogen include Sphaerotheca fuliginea (also called "Podosphaera xanthii") and Erysiphe polygoni.
    In the present invention, the term "powdery mildew" can also be referred to as "powdery mildew", for example. Resistance means the ability to inhibit or suppress the
    5
    10
    fifteen
    twenty
    25
    30
    35
    occurrence and progression of damage due to infection with the pathogen of powdery mildew, for example. Specifically, resistance can mean any of the following, for example: prevent damage from occurring; stop the progression of damage that has already occurred; and suppress (also referred to as "inhibit") the progression of damage that has already occurred.
    In the present invention, the "chromosome" can also be referred to as a "linkage group", for example. Therefore, in the present invention, chromosomes 1 to 12 of a melon plant can also be referred to as, for example, linkage groups 1 to 12, respectively, and chromosome 6 can also be referred to as, for example, group Linkage 6. Linkage groups can be determined based on genome sequence information in melon plants with reference to the following Reference Document 1, for example. Genome sequence information in melon plants is available on the website ( https://melonomics.net/) of MELONOMICS Project, for example. Specifically, chromosome 6 (linkage group 6) in the present invention can be determined based on a piece of genome sequence information, Melon_genome_v3.5.1, in melon plants described on the MELONOMICS Project website with reference to the following Reference Document 1, for example.
    Document Reference 1: Jason M. Argyris et al., "Use of targeted SNP selection for an improved anchoring of the melon (Cucumis melo L.) scaffold genome assembly", BMC Genomics, 2015 vol. 16: 4.
    Although the resistance marker of the present invention includes the resistance locus on chromosome 6 in a homozygous manner as described above, the mildew-resistant melon plant may include the resistance locus on chromosome 6, rather than in the chromosome 6. chromosome 6, on any chromosome other than chromosome 6, for example. That is, the mildew-resistant melon plant can include the resistance locus on chromosome 6 on any of chromosome 1, chromosome 2, chromosome 3, chromosome 4, chromosome 5, chromosome 7, chromosome 8, chromosome 9, chromosome 10, chromosome 11 and chromosome 12. When the mildew-resistant melon plant includes the resistance marker on any chromosome other than chromosome 6, the mildew-resistant melon plant may include a resistance locus on a chromosome other than chromosome 6 or two loci of resistance on a chromosome (s) other than chromosome 6, for example. In the latter case, the mildew-resistant melon plant can include the two resistance loci in
    5
    10
    fifteen
    twenty
    25
    30
    35
    the same chromosome or on different chromosomes, for example.
    The locus of resistance to powdery mildew refers to a locus of quantitative trait or a region of gene that confers resistance to powdery mildew. In general, the locus of a quantitative character (QTL) refers to a region of chromosome that is involved in the expression of a quantitative character. The QTL can be specified using a molecular marker that indicates a specific locus on a chromosome. The technique for specifying the QTL using the molecular marker is well known in the art.
    In the present invention, a molecular marker used to specify (also referred to as "identify" hereinafter) the millet resistance locus is not particularly limited. Examples of the molecular marker include SNP markers, amplified fragment length polymorphism (AFLP) markers, restriction fragment length polymorphism (RFLP) markers, microsatellite markers, sequence characterized amplified region markers (SCAR) and markers of cut amplified polymorphic sequence (CAPS). Examples of microsatellite markers include short tandem repeat (STR) markers and single sequence repeat (SSR) markers. The resistance locus can be identified by one type of marker or by two or more types of markers, for example.
    In the present invention, an SNP tag can be used, or two or more SNP tags can be used in combination, for example.
    In the present invention, the resistance locus meets: (i) a condition based on at least one of the length of each of the amplified fragments obtained by amplification using the primer set and the combination of polymorphisms (also referred to as "SNP" hereinafter) of bases. That is, the resistance locus meets at least one of the conditions (1) and (2), described above. In addition, the resistance locus may meet, for example: (ii) a condition based on at least one of the base sequence of each of the amplified fragments obtained by amplification using the primer set and a base sequence that includes the combination of SNP; (iii) a condition based on the base sequence of a region that includes at least one of the base sequence of each of the amplified fragments obtained by amplification using the primer set and a base sequence that includes the combination of SNP; or any combination of (i) to (iii), as will be described
    5
    10
    fifteen
    twenty
    25
    30
    35
    later. When the resistance locus meets any combination of (i) to (iii), the combination is not particularly limited, and its examples include the following combinations. Although the resistance locus complies (i), the present invention is not limited thereto. For example, instead of (i), the resistance locus can meet (ii) or (iii), or it can meet the combination of (ii) and (iii).
    Combination of (i) and (ii)
    Combination of (i) and (iii)
    Combination of (i), (ii) and (iii)
    (i) Condition based on amplified fragment length and SNP combination
    As described in the previous point (i), the resistance locus meets the condition based on at least one of the length of each of the amplified fragments obtained by amplification using the primer set and the SNP combination, and specifically, the Resistance locus meets at least one of the conditions (1) and (2). In the following description, SNPs under the respective conditions are newly identified by the inventors of the present invention, and those skilled in the art can identify the chromosomal locations of these SNPs based on the base sequences that include these SNPs to be described later. .
    In condition (1), the resistance locus is identified by the length of each of the amplified fragments obtained by amplification using the following primer set 1. The length of the amplified fragment can be measured, for example, by amplifying the gene of a Melon plant using the following primer set 1 and analyzing the resulting amplified fragment. The analysis of the amplified fragment can be sequenced from the amplified fragment or analysis by electrophoresis or the like, for example. The following primer set 1 amplifies, for example, the base sequence from positions 5857028 to 5857159 on chromosome 6 in the genome sequence information described above in melon plants.
    Primer set 1
    a direct primer 1: 5’-AATCTCAACAAGTGAGCTTTTATTGT-3 ’(SEQ ID NO: 1) a reverse primer 1: 5’-CATGATTATCTTCAATTTTCTTTTTGTC-3’ (SEQ ID NO: 2)
    The length of the amplified fragment may be 133 bp or more, and its upper limit may not be
    5
    10
    fifteen
    twenty
    25
    It is particularly limited. The upper limit of the length of the amplified fragment may be, for example, 140 bp or less or 135 bp or less, and the range of the length of the amplified fragment may be, for example, 133 bp to 140 bp or 133 bp to 135 bp. Preferably, the length of the amplified fragment is 133 bp. Until now, the relevance of the length of the amplified fragment obtained by amplification using primer set 1 with powder resistance has not been reported. The length of the amplified fragment is a new length of an amplified fragment first discovered by the inventors of the present invention as implicated in the resistance to powdery mildew.
    In condition (2), the resistance locus is identified by the combination of nine types of SNPs (also referred to as "first set of SNPs", hereafter referred to in this document) in the base sequence of SEQ ID NO: 3. The nine types of SNPs are the SNPs at positions 45, 48, 49, 51, 108, 120, 139, 214 and 327 in the base sequence of SEQ ID NO: 3. Hereinafter in In this document, SNPs in positions 45, 48, 49, 51, 108, 120, 139, 214 and 327 are also referred to as "SNP145", "SNP148", "SNP149", "SNP151", "SNP1108", " SNPW, "SNP1139", "SNP1214" and "SNPW, respectively. SNP145, SNP148, SNP149, SNP151, SNP1108, SNP1120, SNP1139, SNP1214 and SNP1327 are the 1st to 9th base underlined in square brackets in the base sequence of SEQ ID NO: 3, respectively. The base sequence of SEQ ID NO: 3 can be obtained from the melon plant deposited under FERM Accession No. BP-22291 to be described later, for example. The base sequence of SEQ ID NO: 3 corresponds to, for example, the base sequence from positions 5586975 to 5587541 on chromosome 6 in the genome sequence information in melon plants.
    SEQ ID NO: 3
    5 ’-GGAAAAATGCAGGGGAAGGCGAAGAGCAGCCTTCGGAGAGGAAA [A] AA [A] [1] T [11TTTTGGTTGAACATAACAT ACT ATTGGT AGTTGGAATT CCAAGT AT GAGCACAGAT [T] GAAAGGCATTT [A] TTTTCT [A]
    CGAAGT CTTTTGCTTT CACCCTATT GCAGATT CT AT GCCCACTGAAATT CT CT CTGT ^ AAAGCT CCA | [T] CTT CCAACTCGT CCT CT GCTGCT GTTTCTTTTTCTT CTCT CT CTT CCTTAGCCAAAT CT AGGT CAAAGGCTAAGTCTAAAAAACCAT CCAAAAT CAAGGATTCTCTCACATC [C] TCTGGGTTTCACTTGTTTGTTTAATTCGTTTGTACTTTTGTTTATGATTACTCTTTTCGCT CT AAGT AT AATT CT CAT GT ACTTT GAGCATTAGT CT CTTTT GTT AAT ACATTTAAAGAGGCT CGTAT CAAT GTTT GGT GCTG ACCT CCAAGGAAAT AT CCAACAACTTTT AGTT GAGGTGCACTTAAAAAT ATTTCCCT CAAT CACTTT GGAT ACAT GCGGTTA AGTCGCTTTTGGCAG-3 '
    The first set of SNPs indicates polymorphisms so that, for example, the 1st to 9th base underlined in square brackets in SEQ ID NO: 3 are A, A, T, T, T, A, A, T and C,
    5
    10
    fifteen
    twenty
    25
    30
    35
    respectively. That is, for example, a melon plant is resistant to powdery mildew when SNPI45, SNP148, SNP149, SNP151, SNP1108, SNP1120, SNP1139, SNP1214 and SNP1327 in the first set of SNPs are A, A, T, T, T, A , A, T and C, respectively, and is susceptible to oídio when the combination of the bases is different from the previous combination (for example, when they are A, T, T, T, T, A, G and T or when G, A, A, A, G, C, A, C and T). Until now, the relevance of the first set of SNPs with resistance to powdery mildew has not been reported. The first set of SNPs is a new combination of SNPs first discovered by the inventors of the present invention as implicated in the resistance to powdery mildew.
    In condition (2), the resistance locus can also be identified, for example, by the base sequence from positions 204 to 213 (SEQ ID NO: 7: 5'-AAAAGCTCCA-3 ') in the base sequence of SEQ ID NO: 3. The base sequence of SEQ ID NO: 7 is the base sequence boxed in the base sequence of SEQ ID NO: 3. That is, for example, a melon plant is resistant When the first set of SNPs described above includes the combination of the bases exhibiting the resistance to powdery mildew, and also, the base sequence of SEQ ID NO: 7 is included in a base sequence corresponding to the sequence of bases of SEQ ID NO: 3, and is susceptible to waste when the sequence of bases of SEQ ID NO: 7 is not included. Until now, the relevance of the base sequence of SEQ ID NO: 7 with resistance to powdery mildew has not been reported. The base sequence of SEQ ID NO: 7 is a new base sequence first discovered by the inventors of the present invention as implicated in the resistance to powdery mildew.
    In the present invention, the resistance locus can meet one of the conditions (1) and (2) or both conditions (1) and (2), for example. Preferably, the resistance locus meets both conditions (1) and (2) because the resistance locus shows greater correlation with the resistance to powdery mildew.
    The resistance locus can also fulfill, as the condition based on the combination of SNP, at least one of the following conditions (3) and (4), for example.
    Condition (3): The oid resistance locus on chromosome 6 is identified by the base polymorphisms at positions 50, 141 and 266 in the base sequence of SEQ ID NO: 4.
    5
    10
    fifteen
    twenty
    25
    SEQ ID NO: 4
    5 '-AGGAAACGAAGAATAGACGAAATGTCAAGGTTGCTATTCTAATACCATG [C] TTCCCAAGTCAGACCAGCTTCATTCC AGCAT AT AT CAAGAGATT GGT ATT CT CT GACGTGACTT CTT AAT TKWG CCACACC [T] ACT CCAGA [A] ATTCCCCAATTTCAT TTAGATT AACATTTTACAGT CGAAT AAT CTGCT CAAT CCCACCAACCCAGTCATTT AATTT AT CT GT GGACT GCAACGACAA
    A TAATAAAAAAAAA A AAAAT A AAA TA A TT1 TTATAA A A AA A A ATAATA A A A TA A A T A TAAA TTATAAAA TT A TTAATA A AA
    M I VjU I UUrtLíftUrtUftrtUUUU I MUUtt I MU L I J I I U I UUrtrtUVjrtUrtU I OU I UttUtt I Utttt I rt I jOM I I O I UOUrt I I n I I UL »I UrtUtt
    TT CAT CT CGT AT AT ACTTAAT CCAACTTT CTACATT GCCAAAAAATTT CT GGCCTACAAAGCAAAT AT GACCCT AAACTT GA AGAAACCAAT ATTGTAAAAGCTTT AACT CAACAT AT GAGGAGAT ATTTTTAT GCCA ^ ACAT AAT CAAGAATAT GTACTT
    Condition (4): The oid resistance locus on chromosome 6 is identified by the base polymorphisms at positions 99, 174, 184, 199 and 200 in the base sequence of SEQ ID NO: 5.
    SEQ ID NO: 5 5’-
    GTTCGGATCGGAAAATTCAATCAAAGGAATAAGCGCTACAAAACAATAAACACACACATA
    CATCCAAAAATTACAAATCTCCTATCATCATCAAGAAA [C] AGAAAAACCAAACCGAAAAC
    GAAATAAACGCCAAATAATTTCAGAAAATCGATGCGACGGAATAAGAAATGCAT [G] TATC
    TGGTA [T] GATCGAAAGAGAAA [A] [T] ATACGAGATCCGGTGGTTTGCCAGAGCTGCATCTC
    GCCGTCTTCATAATCGCCTTCGGGACGAACGGCGATGAGAACAAGGTAATCGCCCTTG
    CGGACAACGTTGTCGATGGCCCATTTGAGGGCTTTAATGCTGCAGGCAGAGAAATCCA
    CCGCGACGCCGACTCTCCGTTGACCGTCCATGCTTTTTGTGGGTTGGGATTTTCAGTGC
    GTTTGAGCTTTGTGGAAGGAAGGAAGAATGGAATGAATGTCGGAAAGCTTGG-3 ’
    In condition (3), the resistance locus is identified, for example, by the combination of three types of SNPs (also referred to as "second set of SNPs" hereinafter) in the SEQ base sequence ID NO: 4. The three types of SNPs are, for example, SNPs in positions 50, 141 and 266 in the base sequence of SEQ ID NO: 4. Hereinafter, SNPs in positions 50, 141 and 266 are also referred to as "SNP250", "SNP2141" and "SNP2266", respectively. SNP250, SNP2141 and SNP2266 are the 1st to 3rd base underlined in square brackets in the base sequence of SEQ ID NO: 4, respectively. The base sequence of SEQ ID NO: 4 can be obtained from the melon plant deposited under FERM Accession No. BP-22291 to be described later, for example. The sequence of bases of SEQ ID NO: 4 corresponds to, by
    5
    10
    fifteen
    twenty
    25
    30
    35
    For example, the base sequence from positions 6398131 to 6398627 on chromosome 6 in the genome sequence information described above in melon plants.
    The second set of SNPs indicates polymorphisms so that, for example, the 1st to 3rd base underlined in square brackets in SEQ ID NO: 4 are C, A and T respectively. That is, for example, a melon plant is resistant to powdery mildew when SNP250, SNP2141 and SNP2266 in the second set of SNPs are C, A and T, respectively, and is susceptible to powdery mildew when the combination of the bases is different from the previous combination (for example, when they are T, T and A). Until now, the relevance of the second set of SNPs with resistance to powdery mildew has not been reported. The second set of SNPs is a new combination of SNPs first discovered by the inventors of the present invention as implicated in the resistance to powdery mildew.
    In condition (3), the resistance locus can also be identified, for example, by the combination of SNPs at positions 132 and 457 in the base sequence of SEQ ID NO: 4. Hereinafter, SNPs in positions 132 and 457 are also referred to as "SNP2132" and "SNP2457", respectively. SNP2132 and SNP2457 are the 1st and 2nd base squared in the base sequence of SEQ ID NO: 4, respectively.
    SNP2132 and SNP2457 are polymorphisms so that, for example, the 1st and 2nd boxed base underlined in SEQ ID NO: 4 are T and A, respectively. That is, for example, a melon plant is resistant to powdery mildew when the second set of SNP described above includes the combination of bases that have resistance to powdery mildew, and also, SNP2132 and SNP2457 are T and A, respectively, and is susceptible to oídio when the combination of the bases is different from the previous combination. So far, the relevance of SNP2132 and SNP2457 with resistance to powdery mildew has not been reported. The combination of SNP2132 and SNP2457 is a new combination of SNP first discovered by the inventors of the present invention as implicated in the resistance to powdery mildew.
    In condition (4), the resistance locus is identified, for example, by the combination of five types of SNPs (also referred to as "third set of SNPs" hereinafter) in the SEQ base sequence ID NO: 5. The five types of SNPs are, for example, SNPs at positions 99, 174, 184, 199 and 200 in the base sequence of SEQ ID NO: 5. Hereinafter, SNPs in positions 99, 174, 184,
    5
    10
    fifteen
    twenty
    25
    30
    35
    199, and 200 are also referred to as "SNP399", "SNP3174", "SNP3184", "SNP3199", and "SNP3200", respectively. SNP399, SNP3174, SNP3184, SNP3199, and SNP3200 are the 1st to 5th base underlined in square brackets in the base sequence SEQ ID NO: 5, respectively. The base sequence of SEQ ID NO: 5 can be obtained from the melon plant deposited under FERM Accession No. BP-22291 to be described later, for example. The base sequence of SEQ ID NO: 5 corresponds to, for example, the base sequence from positions 5269642 to 5270103 on chromosome 6 in the genome sequence information described above in melon plants.
    The third set of SNPs indicates polymorphisms so that, for example, the 1st to 5th base underlined in square brackets in SEQ ID NO: 5 are C, G, T, A, and T, respectively. That is, for example, a melon plant is resistant to powdery mildew when SNP399, SNP3174, SNP3184, SNP3199, and SNP3200 in the third set of SNPs are C, G, T, A and T, respectively, and is susceptible to powdery mildew when the combination of the bases is different from the previous combination (for example, when they are T, A, C, T and C). Until now, the relevance of the third set of SNPs with resistance to powdery mildew has not been reported. The third set of SNPs is a new combination of SNPs first discovered by the inventors of the present invention as implicated in the resistance to powdery mildew.
    When the resistance locus also meets at least one of the conditions (3) and (4), the combination of the conditions met by the resistance locus is not particularly limited, and its examples include the following combinations:
    Combination of conditions (1) and (3)
    Combination of conditions (1) and (4)
    Combination of conditions (2) and (3)
    Combination of conditions (2) and (4)
    Combination of conditions (1), (2) and (3)
    Combination of conditions (1), (2) and (4)
    Combination of conditions (1), (2), (3) and (4)
    Although the resistance locus meets at least one of the conditions (1) and (2) in the present invention, the resistance locus is not limited thereto. The resistance locus can meet at least one of the conditions (3) and (4), instead of at least one of the conditions (1) and (2). In this case, the resistance locus can fulfill one of the
    5
    10
    fifteen
    twenty
    25
    30
    35
    conditions (3) and (4) or both conditions (3) and (4), for example. Preferably, the resistance locus meets both conditions (3) and (4) because the resistance locus shows greater correlation with the resistance to powdery mildew.
    (ii) Condition based on the sequence (s) of bases
    As described in the previous point (ii), the resistance locus can meet, for example, a condition based on at least one of the base sequence of each of the amplified fragments obtained by amplification using the primer set and a sequence of bases that includes the combination of SNP and specifically, the resistance locus can meet at least one of the following conditions (5) and (6). In the following condition (5), the following polynucleotides (a2) and (a3) are polynucleotides each having a function equivalent to that of the next polynucleotide (a1) with respect to the resistance to powdery mildew in the resistance locus. In the following condition (6), the following polynucleotides (b2) and (b3) are polynucleotides each having a function equivalent to that of the next polynucleotide (b1) with respect to the resistance to powdery mildew in the resistance locus.
    Condition (5): The oid resistance locus on chromosome 6 is identified by the following polynucleotide (a). Said polynucleotide (a) is selected from the group consisting of (a1), (a2) and (a3), where
    polynucleotide (a1) is a polynucleotide consisting of the base sequence of SEQ ID NO: 6;
    the polynucleotide (a2) is a polynucleotide consisting of a sequence of bases obtained by deletion, substitution, insertion and / or addition of one or more bases in the base sequence of the polynucleotide (a1); Y
    The polynucleotide (a3) is a polynucleotide that consists of a base sequence that has at least 80% sequence identity to the base sequence of the polynucleotide (a1).
    Condition (6): The oid resistance locus on chromosome 6 is identified by the following polynucleotide (b). Said polynucleotide (b) is selected from the group consisting of (b1), (b2) and (b3), where
    polynucleotide (b1) is a polynucleotide consisting of the base sequence of SEQ ID NO: 3;
    5
    10
    fifteen
    twenty
    25
    30
    35
    The polynucleotide (b2) is a polynucleotide consisting of a sequence of bases obtained by deletion, substitution, insertion and / or addition of one or more bases in the base sequence of the polynucleotide (b1) with the base (A) in the position 45, the base (A) in position 48, the base (T) in position 49, the base (T) in position 51, the base (T) in position 108, the base (A) in position 120, the base (A) at position 139, the base (T) at position 214, and the base (C) at position 327 in the base sequence of the polynucleotide (b1) that is conserved; Y
    The polynucleotide (b3) is a polynucleotide consisting of a base sequence that has at least 80% sequence identity to the base sequence of the polynucleotide (b1) with the base (A) at position 45, the base (A ) at position 48, the base (T) at position 49, the base (T) at position 51, the base (T) at position 108, the base (A) at position 120, the base (A ) at position 139, the base (T) at position 214, and the base (C) at position 327 in the base sequence of the polynucleotide (b1) that is conserved.
    In polynucleotide (a1), the base sequence of SEQ ID NO: 6 is as shown below. The polynucleotide (a1) consisting of the base sequence of SEQ ID NO: 6, is obtained, for example, by amplifying the gene of a melon plant using primer set 1, for example. The base sequence of SEQ ID NO: 6 is, for example, the base sequence of the amplified fragment that includes direct primer 1. The polynucleotide (a1) can be obtained from the melon plant deposited under N. Access FERM BP-22291 to be described later, for example.
    SEQ ID NO: 6 5’-
    AATCTCAACAAGTGAGCTTTTATTGTAAAAAATACAACACAAGTAAGAGTGTGTGTATTTA
    TAATTGAAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAAACAAGACAAAAAGAAAATT
    GAAGATAATCATG-3 ’
    In polynucleotide (a2), the number of the "one or more" bases is, for example, 1 to 27, 1 to 20, 1 to 15, 1 to 7, 1 to 5, 1 to 4, 1 to 3, 1, or 2. In the present invention, the numerical range with respect to the number of bases describes all positive integers that fall within that range, for example, ie, for example, the description "one to five bases" discloses all "one, two, three, four and five bases" (the same applies hereinafter in this document).
    5
    10
    fifteen
    twenty
    25
    30
    35
    In the polynucleotide (a3), the "sequence identity" is, for example, at least 80%, at least 85%, at least 89%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%. "Sequence identity" can be determined by aligning two base sequences (the same applies hereinafter).
    In polynucleotide (b1), the 1st to 9th base underlined in square brackets in SEQ ID NO: 3 are bases corresponding to the polymorphisms of SNP145, SNP148, SNP149, SNP151, SNP1108, SNP1120, SNP1139, SNP1214 and SNP1327, respectively. The polynucleotide (b1) can be obtained from the melon plant deposited under FERM Accession No. BP-22291 to be described later, for example.
    In polynucleotide (b2), the number of the "one or more" bases is, for example, 1 to 112, 1 to 84, 1 to 62, 1 to 56, 1 to 28, 1 to 23, 1 to 17, 1 to 12, 1 to 6, 1 to 3, 1, or 2.
    In polynucleotide (b2), the base sequence can also be conserved from positions 204 to 213 (SEQ ID NO: 7: 5’-AAAAGCTCCA-3 ’) in the base sequence of polynucleotide (b1), for example. In this case, the polynucleotide (b2) is, for example, a polynucleotide consisting of a sequence of bases obtained by deletion, substitution, insertion and / or addition of one or more bases in the base sequence of the polynucleotide (b1) with the base (A) in position 45, the base (A) in position 48, the base (T) in position 49, the base (T) in position 51, the base (T) in position 108, the base (A) at position 120, the base (A) at position 139, the base (T) at position 214, the base (C) at position 327, and the sequence of bases from positions 204 to 213 (5'-AAAAGCTCCA-3 ') in the base sequence of the polynucleotide (b1) that is conserved.
    In polynucleotide (b3), the "sequence identity" is, for example, at least 80%, at least 85%, at least 89%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%.
    In polynucleotide (b3), the base sequence can also be conserved from positions 204 to 213 (SEQ ID NO: 7: 5’-AAAAGCTCCA-3 ’) in the base sequence of polynucleotide (b1), for example. In this case, the polynucleotide (b3) is, for example, a polynucleotide consisting of a base sequence that has at least 80% sequence identity to the base sequence of the polynucleotide (b1) with the base (A) in the
    5
    10
    fifteen
    twenty
    25
    30
    35
    position 45, the base (A) in position 48, the base (T) in position 49, the base (T) in position 51, the base (T) in position 108, the base (A) in the position 120, the base (A) in position 139, the base (T) in position 214, the base (C) in position 327, and the sequence of bases from positions 204 to 213 (5'-AAAAGCTCCA- 3 ') in the base sequence of the polynucleotide (b1) that is conserved.
    When the resistance locus meets at least one of the conditions (5) and (6), the resistance locus can meet one of the conditions (5) and (6) or both conditions (5) and (6), for example . Preferably, the resistance locus meets both conditions (5) and (6) because the resistance locus shows greater correlation with the resistance to powdery mildew.
    The resistance locus can also fulfill, as the condition based on a sequence (s) of bases, at least one of the following conditions (7) and (8), for example. In the following condition (7), the following polynucleotides (c2) and (c3) are polynucleotides each having a function equivalent to that of the next polynucleotide (c1) with respect to the resistance to powdery mildew in the resistance locus. In the following condition (8), the following polynucleotides (d2) and (d3) are polynucleotides each having a function equivalent to that of the next polynucleotide (d1) with respect to the resistance to powdery mildew in the resistance locus.
    Condition (7): The oid resistance locus on chromosome 6 is identified by the following polynucleotide (c). Said polynucleotide (c) is selected from the group consisting of (c1), (c2) and (c3), where
    polynucleotide (c1) is a polynucleotide consisting of the base sequence of SEQ ID NO: 4;
    The polynucleotide (c2) is a polynucleotide consisting of a sequence of bases obtained by deletion, substitution, insertion and / or addition of one or more bases in the base sequence of the polynucleotide (c1) with the base (C) in the position 50, the base (A) at position 141, and the base (T) at position 266 in the base sequence of the polynucleotide (c1) that is conserved; Y
    The polynucleotide (c3) is a polynucleotide that consists of a base sequence that has at least 80% sequence identity to the base sequence of the polynucleotide (c1) with the base (C) at position 50, the base (A ) at position 141, and the base (T) at position 266 in the base sequence of the polynucleotide (c1) that is conserved.
    5
    10
    fifteen
    twenty
    25
    30
    35
    Condition (8): The oid resistance locus on chromosome 6 is identified by the following polynucleotide (d). Said polynucleotide (d) is selected from the group consisting of (d1), (d2) and (d3), where
    The polynucleotide (d1) is a polynucleotide consisting of the base sequence of SEQ ID NO: 5,
    The polynucleotide (d2) is a polynucleotide consisting of a sequence of bases obtained by deletion, substitution, insertion and / or addition of one or more bases in the base sequence of the polynucleotide (d1) with the base (C) in the position 99, the base (G) at position 174, the base (T) at position 184, the base (A) at position 199, and the base (T) at position 200 in the base sequence of the polynucleotide ( d1) that is preserved, and
    The polynucleotide (d3) is a polynucleotide consisting of a base sequence that has at least 80% sequence identity to the base sequence of the polynucleotide (d1) with the base (C) at position 99, the base (G ) at position 174, the base (T) at position 184, the base (A) at position 199, and the base (T) at position 200 in the base sequence of the polynucleotide (d1) that is retained.
    In polynucleotide (c1), the 1st to 3rd base underlined in square brackets in SEQ ID NO: 4 are bases corresponding to the polymorphisms of SNP250, SNP2141 and SNP2266, respectively. The polynucleotide (c1) can be obtained from the melon plant deposited under FERM Accession No. BP-22291 to be described later, for example.
    In polynucleotide (c2), the number of the "one or more" bases is, for example, 1 to 100, 1 to 75, 1 to 55, 1 to 50, 1 to 25, 1 to 20, 1 to 15, 1 to 10, 1 to 5, 1 to 3, 1, or 2.
    In the polynucleotide (c2), for example, the base (T) in position 132 and the base (A) in position 457 can also be retained in the polynucleotide (c1). In this case, the polynucleotide (c2) is, for example, a polynucleotide consisting of a sequence of bases obtained by deletion, substitution, insertion and / or addition of one or more bases in the base sequence of the polynucleotide (c1) with the base (C) in position 50, the base (T) in position 132, the base
    (A) at position 141, the base (T) at position 266, and the base (A) at position 457 in the base sequence of the polynucleotide (c1) that is conserved.
    In the polynucleotide (c3), the "sequence identity" is, for example, at least 80%, at least 85%, at least 89%, at least 90%, at least 95%, at least 96%, at least 97
    5
    10
    fifteen
    twenty
    25
    30
    35
    %, at least 98% or at least 99%.
    In the polynucleotide (c3), for example, the base (T) in position 132 and the base (A) in position 457 can also be retained in the polynucleotide (c1). In this case, the polynucleotide (c3) is, for example, a polynucleotide consisting of a base sequence that has at least 80% sequence identity to the base sequence of the polynucleotide (c1) with the base (C) in position 50, base (T) at position 132, base (A) at position 141, base (T) at position 266, and base (A) at position 457 in the base sequence of the polynucleotide (c1) that is conserved.
    In polynucleotide (d1), the 1st to 5th base underlined in square brackets in SEQ ID NO: 5 are bases corresponding to the polymorphisms of SNP399, SNP3174, SNP3184, SNP3199 and SNP3200, respectively. The polynucleotide (d1) can be obtained from the melon plant deposited under FERM Accession No. BP-22291 to be described later, for example.
    In the polynucleotide (d2), the number of the "one or more" bases is, for example, 1 to 93, 1 to 70, 1 to 51, 1 to 48, 1 to 24, 1 to 19, 1 to 15, 1 to 10, 1 to 5, 1 to 3, 1, or 2.
    In the polynucleotide (d3), the "sequence identity" is, for example, at least 80%, at least 85%, at least 89%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%.
    When the resistance locus also meets at least one of the conditions (7) and (8), the combination of the conditions met by the resistance locus is not particularly limited, and its examples include the following combinations.
    Combination of conditions (5) and (7)
    Combination of conditions (5) and (8)
    Combination of conditions (6) and (7)
    Combination of conditions (6) and (8)
    Combination of conditions (5), (6) and (7)
    Combination of conditions (5), (6) and (8)
    Combination of conditions (5), (6), (7) and (8)
    Although the resistance locus meets "(i) Condition based on fragment length
    5
    10
    fifteen
    twenty
    25
    30
    35
    amplified and the combination of SNP "in the present invention, the resistance locus is not limited thereto. As described above, the resistance locus can meet “(ii) Condition based on the sequence (s) of bases”, instead of “(i) Condition based on the length of the amplified fragment and the combination of SNP "In this case, the resistance locus can meet, for example, at least one of the conditions (7) and (8), instead of at least one of the conditions (5) and (6). Also, in In this case, the resistance locus can meet one of the conditions (7) and (8) or both conditions (7) and (8), for example Preferably, the resistance locus meets both conditions (7) and (8) because the resistance locus shows greater correlation with the resistance to powdery mildew.
    (iii) Condition based on the base sequence of the region
    As described in the previous point (iii), the resistance locus can meet, for example, the condition based on the base sequence of a region that includes at least one of the base sequence of each of the amplified fragments obtained by amplification using the primer set and a base sequence that includes the combination of SNP, and specifically, the resistance locus can meet the following condition (9). The region may include all or part of at least one of the base sequence of the amplified fragment and the base sequence that includes the combination of SNP, for example.
    Condition (9): The oid resistance locus on chromosome 6 is identified by a sequence between the sites of two SNPs selected from the group consisting of the following SNP (A), SNP (B), and SNP (C) in the chromosome
    (A) a SNP selected from the group consisting of SNPs at positions 45, 48, 49, 51, 108, 120, 139, 214, and 327 in the base sequence of SEQ ID NO: 3
    (B) an SNP selected from the group consisting of SNPs at positions 50, 132, 141, 266 and 457 in the base sequence of SEQ ID NO: 4
    (C) an SNP selected from the group consisting of SNPs at positions 99, 174, 184, 199 and 200 in the base sequence of SEQ ID NO: 5.
    Regarding SNP (A), SNPs in positions 45, 48, 49, 51, 108, 120, 139, 214 and 327
    5
    10
    fifteen
    twenty
    25
    30
    35
    they are, for example, bases corresponding to the polymorphisms SNP145, SNP148, SNP149, SNP151, SNP1108, SNP1120, SNP1139, SNP1214 and SNP1327, respectively.
    With respect to SNP (B), SNPs at positions 50, 132, 141, 266 and 457 are, for example, bases corresponding to the polymorphisms of SNP250, SNP2132, SNP2141, SNP2266 and SNP2457, respectively.
    With respect to SNP (C), SNPs at positions 99, 174, 184, 199 and 200 are, for example, bases corresponding to the polymorphisms of SNP399, SNP3174, SNP3184, SNP3199 and SNP3200, respectively.
    The end of the side in the 5 'direction and the end of the side in the 3' direction of the region can be identified, for example, by the sites of two SNPs selected from the group consisting of SNPs (A), (B) and ( C), as described above. The region is not limited as long as it is located between the sites of two SNPs selected from the group consisting of SNPs (A), (B) and (C), for example, and may or may not include both or one of the sites of the two SNPs, for example. When the region includes the SNP sites, the end of the 5 ’side and the 3’ side of the region are the SNP sites. The bases at the end of the side in the 5 'direction and the end of the side in the 3' direction may each be an underlined or boxed base in the above base sequences or they may be a base other than the underlined base and the bases boxed in the above base sequences, for example.
    Specifically, SNPs at the end of the 5 ’side and the 3’ side end can be determined based on the chromosomal locations of the SNPs (A), (B) and (C), for example. For example, as shown in Fig. 1, SNPs (A), (B) and (C) are located on chromosome 6 of a melon plant in the order of SNP (C), SNP (A) and SNP (B) from the side of the side in the 5 'direction (SNP399) to the side in the 3' direction (SNP2457). Also, as shown in Fig. 1, the base sequence that forms the amplified fragment when amplified is located between SNP (A) and SNP (B), for example. In this case, examples of the combination of the two SNPs that identify the region include the following combinations:
    Combination of SNP (A) and SNP (B)
    Combination of SNP (A) and SNP (C)
    Combination of SNP (B) and SNP (C)
    5
    10
    fifteen
    twenty
    25
    30
    35
    Among these combinations, for example, the following combination is preferable because the resistance locus shows greater correlation with the resistance to powdery mildew.
    Combination of SNP (B) and SNP (C)
    When the resistance locus is identified by the base sequence of a region between the sites of two SNPs, it is preferable that the resistance locus also meets the condition (s) described above relevant to the base sequence of the region. Specifically, it is preferably that the resistance locus meets, in the base sequence of the region, at least one of the conditions (1) and (2), for example. Also, it is preferable that the resistance locus also meets, in the base sequence of the region, at least one of the conditions (3) and (4), for example.
    The relevant condition may be, for example, a condition relevant to the sequence of bases between the SNP sites at the ends of the 5 'side and the 3' side that identify the region, and can be determined as appropriate. based, for example, on the chromosomal locations of SNPs (A), (B) and (C) and the base sequence that forms the amplified fragment when amplified as shown in Fig. 1. The number of relevant conditions can be Be one or more, for example. As a specific example, all conditions relevant to the base sequence located between the SNP sites that identify the region can be used as the relevant conditions
    The combination of the base sequence between the two SNP sites in the region and the condition (s) relevant to the base sequence of the region to be met by the resistance locus is not particularly limited, and it can be the following condition (a), (b) or (c), for example.
    Condition (a): The oid resistance locus on chromosome 6 includes the base sequence of a region between the SNP (A) and SNP (B) sites on the chromosome, and meets at least one of the conditions (1 ) and (2).
    Condition (b): The oid resistance locus on chromosome 6 includes the base sequence of a region between the SNP (B) and SNP (C) sites on the chromosome, and meets at least one of the conditions (1 ) and (2).
    5
    10
    fifteen
    twenty
    25
    30
    35
    Condition (c): The oid resistance locus on chromosome 6 includes the base sequence of a region between the SNP (B) and SNP (C) sites on the chromosome, and meets at least one of the conditions (1 ) and (2) and at least one of the conditions (3) and (4).
    In condition (a), the resistance locus can meet one of the conditions (1) and (2) or both conditions (1) and (2), for example.
    In condition (b), the resistance locus can meet one of the conditions (1) and (2) or both conditions (1) and (2), for example.
    In condition (c), the combination of the conditions to be fulfilled by the resistance locus is not particularly limited, and its examples include the following combinations: Combination of conditions (1) and (3)
    Combination of conditions (1) and (4)
    Combination of conditions (2) and (3)
    Combination of conditions (2) and (4)
    Combination of conditions (1), (2) and (3)
    Combination of conditions (1), (2) and (4)
    Combination of conditions (1), (2), (3) and (4)
    The resistance marker according to the present invention can confer oidium resistance to melon plants, for example. In the present invention, the degree of powdery mildew resistance of a melon plant can be expressed by the disease index with reference to the method described in the following Reference Document 2, for example. Regarding the calculation of the disease index according to this method, it can refer to the explanation in Example 1 to be described below, and the disease index of 1 or less can be evaluated as being tolerant (resistant) to powdery mildew and the index of disease of 2 or more can be evaluated as being susceptible to powdery mildew, for example.
    Document Reference 2: LongZhou Liu et al., "A Sequence-amplified Characterized Region Marker for a Single, Dominant Gene in Melon PI 134198 that Confers Resistance to a Unique Race of Podosphaera xanthii in China", HORTSCIENCE, 2010, vol. 45 , No. 9, pp. 1,407-1,410.
    5
    10
    fifteen
    twenty
    25
    30
    35
    The resistance marker according to the present invention can also include a marker for any other resistance, for example.
    2. Mildew-resistant melon plant
    The mildew-resistant melon plant of the present invention is, as described above, an mildew-resistant melon plant which includes: an oid resistance locus on chromosome 6 in a homozygous form, where the oid resistance locus on chromosome 6 it meets at least one of the following conditions (1) and (2).
    Condition (1): The oid resistance locus on chromosome 6 is identified by a length of an amplified fragment obtained by amplification using the following primer set 1, and the length of the amplified fragment is 133 bp or more.
    Primer set 1:
    a direct primer 1 consisting of a base sequence of SEQ ID NO: 1 a reverse primer 1 consisting of a base sequence of SEQ ID NO: 2 Condition (2):
    The oid resistance locus on chromosome 6 is identified by base polymorphisms at positions 45, 48, 49, 51, 108, 120, 139, 214 and 327 in the base sequence SEQ ID NO: 3.
    The mildew-resistant melon plant of the present invention is characterized in that it includes an oid resistance locus on chromosome 6 in a homozygous manner and that the oid resistance locus on chromosome 6 meets at least one of the conditions ( 1 and 2). Other configurations or conditions are not particularly limited. The mildew-resistant melon plant of the present invention includes the resistance marker of the present invention as the resistance locus. Therefore, for example, the above description with respect to the resistance marker of the present invention also applies to the mildew resistant melon plant of the present invention. In the present invention, the oid resistance locus on chromosome 6 should be interpreted as interchangeable with the resistance locus in the resistance marker of the present invention, for example. The above descriptions regarding the resistance marker of the present invention etc. It also applies to the mildew-resistant melon plant of the present invention, for example.
    The mildew-resistant melon plant of the present invention is resistant to powdery mildew.
    5
    10
    fifteen
    twenty
    25
    30
    35
    In the powder-resistant melon plant of the present invention, the resistance to powdery mildew is conferred by the locus of resistance described above. Although the mildew-resistant melon plant of the present invention includes the resistance locus on chromosome 6 in a homozygous form, the mildew-resistant melon plant can include the locus of resistance on chromosome 6, rather than on the chromosome 6, on any chromosome other than chromosome 6, for example. That is, the mildew-resistant melon plant can include the resistance locus on chromosome 6 on any of chromosome 1, chromosome 2, chromosome 3, chromosome 4, chromosome 5, chromosome 7, chromosome 8, chromosome 9, chromosome 10, chromosome 11 and chromosome 12. When the mildew-resistant melon plant includes the resistance marker on any chromosome other than chromosome 6, the mildew-resistant melon plant may include a resistance locus on a chromosome other than chromosome 6 or two loci of resistance on a chromosome (s) other than chromosome 6, for example. In the latter case, the mildew-resistant melon plant can include the two resistance loci on the same chromosome or on different chromosomes, for example. As described above, the "chromosome" can also be referred to as a "linkage group", for example, and the reference can be made to the above description with respect to the chromosome and the linkage group.
    In the powder-resistant melon plant of the present invention, the above description with respect to the resistance marker of the present invention also applies to the resistance locus, for example.
    The mildew-resistant melon plant of the present invention can meet one of the conditions (1) and (2) or both conditions (1) and (2), for example. Preferably, the mildew-resistant melon plant meets both conditions (1) and (2) because the mildew-resistant melon plant shows greater correlation with the resistance to powdery mildew.
    The mildew-resistant melon plant of the present invention can be, for example, the melon plant deposited under Accession No. FERM BP-22291 (Cucumis melo) or a progeny line thereof. The deposited melon plant includes the resistance locus on chromosome 6 in a homozygous form, for example. The information in the deposit is as follows.
    Type of deposit: international deposit.
    Name of the depositary institution: "National Institute of Technology and
    5
    10
    fifteen
    twenty
    25
    30
    35
    Evaluation ”; NITE-IPOD.
    Address: 2-5-8-120, Kazusakamatari, Kisarazu-shi, Chiba 292-0818, Japan.
    Access No. FERM BP-22291.
    Identification name: Takii8.
    Acceptance date: August 14, 2015.
    The mildew-resistant melon plant according to the present invention can also be produced, for example, by introducing the locus of resistance to a melon plant. The method for introducing the locus of resistance to a melon plant is not particularly limited, and a conventionally known genetic engineering procedure can be used, for example. The locus of resistance to be introduced may be the locus of oid resistance described above, for example.
    The characteristics of the mildew-resistant melon plant of the present invention other than oidium resistance, such as, for example, morphological and biological characteristics, are not particularly limited.
    The mildew-resistant melon plant of the present invention can also have any other resistance.
    The term "plant body" as used in the present invention may refer to any individual plant representing the entire plant or a part of the individual plant. The part of the individual plant may be any of the organs, tissues, cells and propagules For example, examples of organs include petals, corollas, flowers, leaves, seeds, fruits, stems and roots, tissue is a part of the organ, for example, the part of the plant body can be a type of organ, tissue and / or cell, or two or more types of organs, tissues and / or cells, for example.
    3. Method to produce the mildew-resistant melon plant
    Next, the method for producing an mildew-resistant melon plant according to the present invention (also referred to simply as "production method" hereinafter) will be described. The methods to be described below are merely illustrative, and the The present invention is by no means limited to these methods In the present invention, the production method can also be referred to as the "method of
    5
    10
    fifteen
    twenty
    25
    30
    35
    crop ”, for example. Also, in the present invention, the powder resistance locus should be interpreted as interchangeable with the resistance marker according to the present invention.
    As described above, the method for producing an mildew-resistant melon plant according to the present invention includes the following steps (a) and (b):
    (a) cross the mildew-resistant melon plant according to the present invention with another melon plant; Y
    (b) select a mildew-resistant melon plant from one or more melon plants obtained in step (a) or its progeny lines.
    The production method according to the present invention is characterized in that the mildew-resistant melon plant according to the present invention is used as the mother plant, and other stages or conditions are not particularly limited. The above descriptions regarding the resistance marker of the present invention etc. they also apply to the production method of the present invention, for example. As described above, the oid resistance locus can confer oid resistance even if it is a single gene locus, for example. Therefore, according to the production method of the present invention, for example, using the resistance locus, the progenies exhibiting the resistance to powdery mildew can also be easily obtained from F1 obtained by crossing the melon plant resistant to powdery mildew. of the present invention with other melon plants or their progenies.
    In step (a), an oil-resistant melon plant used as the first mother plant is not limited as long as it is the oil-resistant melon plant of the present invention. The mildew-resistant melon plant is preferably the melon plant described above deposited under FERM Accession No. BP-22291 or its progeny line, for example. The mildew-resistant melon plant used as the first mother plant in step (a) can also be obtained by the detection method of the present invention to be described below, for example. Therefore, it is possible to provide the mildew-resistant melon plant, for example, by selecting it from one or more melon plants to be examined (also referred to as "candidate melon plants") by the next stage (x) before the stage ( a), for example:
    (x) select the mildew resistant melon plant of the present invention from one or more melon plants to be examined.
    5
    10
    fifteen
    twenty
    25
    30
    35
    In step (x), the selection of the mildew-resistant melon plant can be referred to as the selection of the melon plant that includes the resistance locus. Therefore, step (x) can be carried out by the following stages (x1) and (x2), for example.
    (x1) detect the presence or absence of an oid resistance locus in a homozygous form on the chromosomes of each of the one or more melon plants to be examined; Y
    (x2) select one or more melon plants to be examined that have the mildew resistance locus in a homozygous form as a mildew-resistant melon plant.
    As described above, the selection in step (x) is the selection of a melon plant that includes the millet resistance locus, for example. Specifically, the mildew-resistant melon plant can be selected by detecting the locus of mildew resistance with respect to the one or more melon plants to be examined. As described above in relation to the resistance marker of the present invention, the powder resistance locus can be detected using, for example, any of (i) to (iii) or any combination of (i) to (iii) fulfilled by the resistance locus: "(i) Condition based on the length of the amplified fragment and the combination of SNP", "(ii) Condition based on the sequence (s) of bases", and "(iii) Condition based on the base sequence of the region ”.
    The selection in step (x) will be described with reference to the following specific example. However, it should be noted that the present invention is not limited thereto. The description with respect to the oid resistance locus provided above in relation to the resistance marker of the present invention also applies to the oid resistance locus in the production method of the present invention.
    The selection in step (x) is, for example, the selection of a mildew-resistant melon plant that includes an oid resistance locus on chromosome 6 in a homozygous form, and the oid resistance locus on the chromosome 6 meets at least one of the conditions (1) and (2).
    In step (x), the resistance locus is selected, for example, by (i) the condition based on at least one of the length of each of the amplified fragments obtained by amplification using the primer set and the SNP combination , how I know
    5
    10
    fifteen
    twenty
    25
    30
    35
    described above. In addition, as will be described below, the resistance locus can be selected, for example, by (ii) the condition based on at least one of the base sequence of each of the amplified fragments obtained by amplification using the primer set and a base sequence that includes the combination of SNP, (iii) the condition based on the base sequence of a region that includes at least one of the base sequence of each of the amplified fragments obtained by amplification using the primer set and a base sequence that includes the combination of SNP, or any combination of these conditions. When the resistance locus is selected by a combination of these conditions, the combination is not particularly limited, and its examples include the following combinations. Although the resistance locus is selected by (i), for example, the present invention is not limited thereto. For example, instead of (i), the resistance locus can be selected by (ii) or (iii), or by the combination of (ii) and (iii).
    Combination of (i) and (ii)
    Combination of (i) and (iii)
    Combination of (i), (ii) and (iii)
    (1) Selection by condition based on amplified fragment length and SNP combination
    In the resistance locus, (i) the condition based on the length of the amplified fragment and / or the combination of SNP to be used for selection is not particularly limited, and the description in the section "(i) Condition based on length of the amplified fragment and the combination of SNP "provided above in relation to the resistance marker of the present invention also applies thereto, for example.
    As a specific example, the selection in step (x) can be, for example, the selection of an oid-resistant melon plant that meets one of the conditions (1) and (2) or an oid-resistant melon plant that It meets both conditions (1) and (2). In condition
    (2), the resistance locus can also be identified, for example, by the base sequence from positions 204 to 213 in the base sequence of SEQ ID NO: 3 (SEQ ID NO: 7: 5'-AAAAGCTCCA -3').
    In addition, in step (x), the resistance locus can also fulfill, as the condition based on the combination of SNP, at least one of the conditions (3) and (4), for example.
    5
    10
    fifteen
    twenty
    25
    30
    35
    In condition (3), the resistance locus can also be identified, for example, by the combination of SNPs at positions 132 and 457 in the base sequence of SEQ ID NO: 4.
    When the resistance locus also meets at least one of the conditions (3) and (4), the combination of the conditions met by the resistance locus is not particularly limited, and its examples include the combinations given above as examples in the description. with respect to the resistance marker of the present invention.
    Although the resistance locus meets, for example, at least one of the conditions (1) and (2) in the production method of the present invention, the resistance locus is not limited thereto. The resistance locus can meet at least one of the conditions (3) and (4), instead of at least one of the conditions (1) and (2). In this case, the resistance locus can meet one of the conditions (3) and (4) or both conditions (3) and (4), for example. Preferably, the resistance locus meets both conditions (3) and (4) because the resistance locus shows greater correlation with the resistance to powdery mildew.
    (ii) Selection by condition based on base sequence (s)
    The selection in step (x) is, for example, selection of a mildew-resistant melon plant that includes the oid resistance locus on chromosome 6 in a homozygous form, and the oid resistance locus on chromosome 6 It can meet at least one of the conditions (5) and (6). In the resistance locus, (ii) the condition based on the sequence (s) of bases to be used for selection is not particularly limited, and the description in section "(ii) Condition based on the (s) base sequence (s) "provided above in relation to the resistance marker of the present invention also applies thereto, for example.
    As a specific example, the selection in step (x) can be, for example, the selection of an oid-resistant melon plant that meets one of the conditions (5) and (6) or an oid-resistant melon plant that It meets both conditions (5) and (6).
    In condition (6), the polynucleotide (b2) can be such that, for example, the sequence of bases from positions 204 to 213 is also preserved (SEQ ID NO: 7: 5’-
    5
    10
    fifteen
    twenty
    25
    30
    35
    AAAAGCTCCA-3 ’) in the polynucleotide base sequence (b1). In condition (6), the polynucleotide (b3) may be such that, for example, the base sequence from positions 204 to 213 (SEQ ID NO: 7: 5'-AAAAGCTCCA-3 ') is also preserved the base sequence of the polynucleotide (b1).
    In addition, in step (x), the resistance locus can also fulfill, as the condition based on a sequence (s) of bases, at least one of the conditions (7) and (8), for example. In condition (7), the polynucleotide (c2) can be such that, for example, the base (T) in position 132 and the base (A) in position 457 are also retained in the base sequence of the polynucleotide (c1). In condition (7), the polynucleotide (c3) can be such that, for example, the base (T) in position 132 and the base (A) in position 457 are also retained in the base sequence of the polynucleotide (c1).
    When the resistance locus also meets at least one of the conditions (7) and (8), the combination of the conditions met by the resistance locus is not particularly limited, and its examples include the combinations given above as examples in the description. with respect to the resistance marker of the present invention.
    (iii) Selection by condition based on the sequence of bases in the region
    The selection in step (x) is, for example, the selection of an oid-resistant plant that includes the oid resistance locus on chromosome 6 in a homozygous form, and the oid resistance locus on chromosome 6 can fulfill the condition (9). In the resistance locus, (iii) the condition based on the base sequence of the region to be used for selection is not particularly limited, and the description in section “(iii) Condition based on the sequence of bases in the region "Provided above in relation to the resistance marker of the present invention also applies thereto, for example.
    As a specific example, it is preferable that the resistance locus meets, in the base sequence of the region, at least one of the conditions (1) and (2), for example. Also, it is preferable that the resistance locus also meets, in the base sequence of the region, at least one of the conditions (3) and (4), for example.
    5
    10
    fifteen
    twenty
    25
    30
    35
    Also, the resistance locus can meet the condition described above (a), (b) or (c), for example.
    The chromosome to be subjected to detection of the presence or absence of the resistance locus in a homozygous form is preferably chromosome 6.
    In step (a), the other melon plant to be used as the mother plant is not particularly limited, and it can be, for example, a melon plant that carries a known mildew resistance gene, a melon plant that has any another resistance, or the mildew-resistant melon plant of the present invention.
    In step (a), the method for crossing the mildew-resistant melon plant with the other melon plant is not particularly limited, and a known method can be employed.
    In step (b), the melon plants from which a mildew resistant melon plant is selected may be the melon plants obtained in stage (a) or progeny lines obtained from these melon plants, for example. Specifically, for example, the melon plants from which an mildew resistant melon plant is selected may be the melon F1 plants obtained by crossing at step (a) or their progeny lines. The progeny line may be a progeny or a backcross progeny of the melon plant F1 obtained by the crossing in step (a), or it may be a melon plant obtained by crossing the melon plant F1 with another plant of Melon, for example.
    In step (b), the selection of a mildew resistant melon plant can be achieved, for example, by examining the resistance to powdery mildew directly or indirectly.
    In step (b), the direct examination can be carried out by evaluating the millet of the melon plant F1 obtained or a progeny line thereof based on the disease index described above, for example. Specifically, for example, the direct examination can be carried out by inoculating the F1 melon plant or its progeny line with powdery mildew and evaluating the resistance to powdery mildew based on the disease index. In this case, for example, you can select the F1 melon plant or the progeny line that shows the disease index of 1 or less as a mildew-resistant melon plant.
    5
    10
    fifteen
    twenty
    25
    30
    35
    In step (b), the selection by indirect examination can be achieved by the following stages (b1) and (b2), for example:
    (b1) detect the presence or absence of the locus of resistance to powdery mildew in a homozygous way on the chromosomes of each of the one or more melon plants obtained in step (a) or its progeny lines, and
    (b2) select the one or more melon plants obtained in stage (a) or their progeny lines that have the locus of resistance to powdery mildew as plant (s) of melon resistant to oidium.
    Selection of the melon plant (s) resistant to powdery mildew in stage (b) can be performed in the same way as in stage (x), mainly, by detecting the presence or absence of the locus of resistance to powdery mildew in a homozygous form, for example. More specifically, the selection can be made by detecting the presence or absence of the oid resistance locus in a homozygous form using the molecular marker.
    The production method of the present invention preferably further includes the cultivation of the mildew resistant melon plant selected in step (b).
    The melon plant or progeny line that was shown to be resistant to powdery mildew in the manner described above can be selected as the melon plant resistant to powdery mildew.
    The production method of the present invention can also include the seed collection stage of the progeny line obtained by crossing.
    4. Screening method for mildew-resistant melon plants
    The screening method for mildew-resistant melon plants according to the present invention (also referred to simply as "screening method" hereinafter) is a screening method that includes the stage of: as a mother plant for production from a cross-resistant mildew-resistant plant, select a mildew-resistant melon plant that includes, as a marker of mildew resistance for melon plants, a locus of mildew resistance on chromosome 6 in a homozygous form of one or more melon plants to examine, where the locus of resistance to powdery mildew in the
    5
    10
    fifteen
    twenty
    25
    30
    35
    chromosome 6 meets at least one of the conditions (1) and (2):
    Condition (1): The oid resistance locus on chromosome 6 is identified by a length of an amplified fragment obtained by amplification using the following primer set 1, and the length of the amplified fragment is 133 bp or more.
    Primer set 1:
    a direct primer consisting of a base sequence of SEQ ID NO: 1 a reverse primer consisting of a base sequence of SEQ ID NO: 2
    Condition (2): The oid resistance locus on chromosome 6 is identified by base polymorphisms at positions 45, 48, 49, 51, 108, 120, 139, 214 and 327 in a sequence of bases SEQ ID NO : 3.
    The screening method according to the present invention is characterized in that it includes the step of selecting an oid-resistant plant that includes, as a marker of resistance to mildew plants, an locus of resistance to oidium on chromosome 6 in a homozygous form of one or more melon plants to be examined and that the locus of resistance to powdery mildew on chromosome 6 meets at least one of the conditions (1) and (2). Other stages or conditions are not particularly limited. According to the screening method of the present invention, an powder-resistant mother plant can be obtained using the resistance marker of the present invention. The above descriptions regarding the resistance marker of the present invention etc. It can also be applied to the screening method of the present invention, for example.
    For the selection of the mother plant, the explanation for the step (x) above provided in relation to the method for producing an mildew resistant melon plant according to the present invention is also applied, for example.
    Examples
    In the following, the present invention will be specifically described with reference to the examples. However, it should be noted, that the present invention is in no way limited to the embodiments described in the following examples.
    [Example 1]
    The present example analyzed the mode of inheritance of an oid resistance locus in
    5
    10
    fifteen
    twenty
    25
    30
    35
    new melon plants resistant to powdery mildew, identified the locus of resistance to powdery mildew and examined the correlation between the locus of resistance to oidium and resistance to oidium, to examine whether the locus of resistance to oidium serves as a marker of resistance to oidium for Melon plants, if the melon plants that include the resistance locus are resistant to powdery mildew, and if the detection of the mildew-resistant melon plants can be performed using the mildew resistance marker for melon plants.
    (1) Deposited line
    To develop new melon plants resistant to powdery mildew, a large number of seeds collected from the melon lines obtained by subculture farming were subjected to a farm belonging to TAKII & CO., LTD., And resistance to I hate the resulting melon lines. As a result, new lines of melon with resistance to powdery mildew (Cucumis melo) that had resistance to powdery mildew were obtained (also referred to as "produced hereinafter.") The new melon plants resistant to powdery mildew were deposited under No. Access FERM BP-22291. Hereinafter, these mildew-resistant melon plants are referred to as the "deposited line".
    (2) Mode of inheritance of resistance to powdery mildew
    Melon plants of the deposited line (Access No. FERM BP-22291) were crossed with melon plants susceptible to "Harukei No. 3" mildew (available from Genbank NARO as a registered plant under No. Access JP32097, Cucumis melo) ”(also referred to as“ susceptible melon plants ”hereinafter), whereby an F2 segregation population was made up of 61 individuals (also referred to as“ 61 lines ” hereinafter) In addition, an oyster fungus inoculation test was carried out in the following manner using the 61 lines.Each individual of the deposited line includes SNP145, SNP148, SNP149, SNP151, SNP1108, SNP1120, SNP1139, SNP1214 and SNP1327, SNP250, SNP2132, SNP2141, SNP2266 and SNP2457, and SNP399, SNP3174, SNP3184, SNP3199 and SNP3200 on chromosome 6 in a homozygous, resistant type. the conditions (1) to (9) The deposited line is such that two copies of chromosome 6 include the base sequence from positions 204 to 213 in the base sequence of SEQ ID NO: 3 and the length of each of the amplified fragments obtained by
    5
    10
    fifteen
    twenty
    25
    30
    35
    amplification using the primer set is 133 bp. On the other hand, each of the susceptible melon plants include SNP145, SNP148, SNP149, SNP151, SNP1108, SNP1120, SNP1139, SNP1214, and SNP1327, SNP250, SNP2132, SNP2141, SNP2266 and SNP2457, and SNP3194, SNP3194, SNP3194, SNP3194, SNP3194, SNP3194, SNP3194, SNP3194, SNP3194, SNP3194, SNP3194, SNP3194 , and SNP3200 on chromosome 6 in a homozygous susceptible type. The susceptible melon plant is so that two copies of chromosome 6 do not include the base sequence from positions 204 to 213 in the base sequence of SEQ ID NO: 3 and the length of each of the fragments obtained by amplification using the primer set is 132 bp. That is, the susceptible melon plant is a melon plant that does not meet conditions (1) to (9).
    The mildew inoculation test was carried out as follows with reference to the method described in the previous Reference Document 2.
    The mildew line of powdery mildew 1 (race 3.5) was grown in a melon plant ("OTOME NO INORI", TAKII & CO., LTD.) Grown in an isolated culture device. The fungal flora of the powdery mildew on leaves of the melon plant was scraped off the leaves, and the conidia of the powdery mildew were collected. After that, sterile distilled water was added to the conidia. A suspension obtained after adding the sterile distilled water was filtered through a KimWipes® cloth, and the filtrate was collected. In addition, a conidial suspension was prepared by diluting the filtrate with sterile distilled water to achieve a concentration of 5x104 conidia / ml. The conidial suspension thus obtained was used as an inoculum. The 61 lines were sown on smoked rice husks beforehand and then placed in 1 / 10,000th Wagner pots filled with sterilized soil. In the inoculation test, melon plants were used with the third true leaf developing. The conidial suspension was sprayed evenly over the entire melon plants using a hand spray. After that, the melon plants were grown for 2 weeks in an environment control room under the following conditions: 20 ° C to 25 ° C, a humidity of 60% to 80%, 14,000 Lux, and a day duration 12 hours Next, with respect to the developed melon plants, the disease investigation was carried out as follows. Also, the investigation of the disease was carried out in the same manner with respect to 10 individuals selected from the deposited line and 10 lines of susceptible melon plants. The breed of powdery mildew was determined based on the following Reference Document 3.
    5
    10
    fifteen
    twenty
    25
    30
    Document Reference 3: Fernando J. Yuste-Lisbona et al., "Codominant PCR-based markers and candidate genes for powdery mildew resistance in melon (Cucumis melo L.)", Theor. Appl. Genet, 2011, vol. 122, pp. 747-758.
    In the investigation of the disease, with reference to the method described in the previous Reference Document 2, the disease index of the leaves of the melon plants submitted to the investigation was evaluated according to the following criteria. Figures 2A to 2D show, as evaluation criteria for the disease index, photographs showing representative examples of the leaves of melon plants with a disease index 0 (Fig. 2A), a disease index 1 (Fig .2B), a disease index 2 (Fig. 2C), and a disease index 3 (Fig. 2D). In these photographs, a region where sporulation is observed is outlined with a continuous line and indicated with an arrow.
    Disease index 0: Sporulation is not observed (highly resistant).
    Disease index 1: slight sporulation (resistant) is observed.
    Disease index 2: sporulation is observed in a limited region.
    Disease index 3: high level of sporulation is observed over a wide region.
    The results obtained are shown in Table 1 below. As can be seen in Table 1, in the 61 lines, the number of individuals with a disease index of 1 or less, that is, the individuals resistant to powdery mildew were 15, which represented 24.6% of the Total number of individuals. From the relationship between the disease indices of the 61 lines and the appearance frequencies of the individuals who had the corresponding disease indices, it was found that the mode of inheritance of the resistance to powdery mildew of the deposited line was recessive monogenic. Susceptible melon plants subjected to disease research under the same conditions were found to be susceptible to powdery mildew. In addition, the deposited line was found to be resistant to powdery mildew. It has not been known of a locus of resistance to recessive monogenic oidium. Therefore, it was found that the locus of oid resistance included in the deposited line is a new locus of oid resistance.
    [Table 1]
    5
    10
    fifteen
    twenty
    25
     Disease index Total number of individuals Proportion of individuals with disease index of 1 or less
     0  1 2 3
     Deposited line  7 3 0 0 10 100%
     Susceptible melon plants  0 0 2 8 10 0%
     Segregation population F2  9 6 8 38 10 24.6%
    (3) Identification of the new locus of resistance to powdery mildew
    Subsequently, the DNA of each of the 61 lines was extracted by a usual method. In addition, the DNA was subjected to DNA testing. Then, based on the disease index determined in the previous point (2) and the result of the DNA test, the QTL analysis was performed using the analysis software ("QTL cartographer", NC STATE University). , on chromosome 6, a region with high correlation with the disease index was identified.The region with high correlation is a region that includes the base sequence that forms the amplified fragment when amplified using primer set 1 and the first set of SNP From these results, it was found that the new locus of resistance to powdery mildew includes a monogenic recessive gene on chromosome 6. Also, as a result of the analysis of the base sequence of the region with high correlation, it was found that the melon plants resistant to powdery mildew were each so that: the lengths of the fragments amplified from two copies of chromosome 6 using primer set 1 are a mbas of 133 bp; on both copies of chromosome 6, SNP145, SNP148, SNP149, SNP151, SNP1108, SNP1120, SNP1139, SNP1214 and SNP1327 are A, A, T, T, T, A, A, T and C, respectively ; and the two copies of chromosome 6 each include the base sequence from positions 204 to 213 in the base sequence of SEQ ID NO: 3.
    (4) New locus of resistance to powdery mildew and resistance to powdery mildew
    The DNA of each of the 61 lines was amplified by PCR using primer set 1, and the lengths of the amplified fragments obtained by amplification were measured. Also, the DNA of each of the 61 lines was amplified by PCR using the following
    5
    10
    fifteen
    twenty
    25
    30
    primer set 2, and the polymorphic bases corresponding to the first set of SNPs were identified in the amplified fragments obtained by amplification. Amplification using primer set 1 was carried out by incubating the DNA at 94 ° C for 3 minutes, then subjecting the DNA to 35 treatment cycles (with a treatment at 94 ° C for 30 seconds, at 57 ° C for 30 seconds, and at 72 ° C for 60 seconds as a cycle), and then incubating the DNA at 72 ° C for 3 minutes. Amplification using primer set 2 was carried out by incubating the DNA at 94 ° C for 3 minutes, then subjecting the DNA to 35 treatment cycles (with a treatment at 94 ° C for 30 seconds, at 56 ° C for 30 seconds, and at 72 ° C for 60 seconds as a cycle), and subsequently incubating the DNA at 72 ° C for 3 minutes. Next, based on the lengths of the amplified fragments and the polymorphic bases corresponding to the first set of SNPs, the 61 lines were classified into resistant homozygous melon plants (A), heterozygous melon plants (H), and plants. homozygous melon susceptible type (B). Their results are shown in Table 2 below. In Table 2 below, "A" indicates individuals for whom it was found that the lengths of the amplified fragments obtained by amplification of the two copies of chromosome 6 were both 133 bp or more and the first set of SNPs was in homozygous resistant type. "H" indicates individuals for whom it was found that the length of the amplified fragment obtained by amplification of one of the two copies of chromosome 6 was 133 bp or more, the length of the amplified fragment obtained by amplification of the another copy of chromosome 6 was less than 133 bp and the first set of SNPs was in the heterozygous form. "B" indicates individuals for whom it was found that the lengths of the amplified fragments obtained by amplification of the two copies of chromosome 6 were both less than 133 bp and the first set of SNPs was in the homozygous susceptible type.
    Primer set 2
    a direct primer 2: 5’-GGAAAAATGCAGGGGAAG-3 ’(SEQ ID NO: 8)
    a 2: 5’-CTGCCAAAAGCGACTTAACC-3 ’reverse primer (SEQ ID NO: 9)
    [Table 2]
     Genotype  Disease index Total number of individuals Proportion of individuals with disease index
     0 1 2 3 of 1 or less
    5
    10
    fifteen
    twenty
    25
    30
     TO  9 6 0 0 15 100%
     H  0 0 7 23 30 0%
     B  0 0 1 15 16 0%
    As can be seen in Table 2, individuals classified as "A" all had a disease index of 1 or less. On the other hand, individuals classified as "H" and "B" all showed a disease index of 2 or more These results demonstrate that the new oid resistance locus identified by the lengths of the amplified fragments and the first set of SNP is responsible for the oid resistance, also, from the fact that the resistance locus identified by the lengths of the amplified fragments and the first set of SNPs, that is, the resistance locus that meets both conditions (1) and (2) is responsible for the resistance to powdery mildew, it was found that the resistance locus serves as a marker of resistance to powdery mildew for melon plants and that the detection of mildew-resistant melon plants is possible using the powdery mildew marker for melon plants.
    (5) Known powdery mildew resistance test
    From the 61 lines, 10 lines of the homozygous resistant type individuals were selected. Then, each of the 10 lines were self-crossed to produce a selected line F3. In addition, with respect to the ten selected F3 lines produced in this way (F3-1 to F3-10), an oyster fungus inoculation test was carried out in the same manner as in the previous point (2) using 10 individuals for each selected line F3. Next, disease rates were determined for the respective selected F3 lines. The disease index of the corresponding selected line F3 was determined according to the following equation.
    disease index = [(0 x n0) + (1 x n ^ + (2 x n2) + (3 * n3)] / the number of individuals investigated
    In the previous equation, "0, 1, 2 and 3" each indicates a disease index, and "n0, n1, n2, and n3" indicates the number of individuals evaluated who have a disease index of 0, an index of disease of 1, a disease index of 2, and a disease index of 3, respectively.
    In the powdery mildew inoculation test, a mildew line of oidium 2 (race 2F), a line of mildew mushroom 3 (race 5), and an oyster mushroom line 4 (race G) were used, in addition of the mildew line of oidium 1. Also, the inoculation test 5 of mildew was carried out and the disease index was evaluated in the same manner as in the previous one, except that, instead of the selected lines F3 , the following melon plants were used: as melon plants susceptible to known powdery mildew, Vedrantais (available on the following website: http://www.burpee.com/heirloom-seeds-and- plants / heirloom-melons / melon-vedrantais-prod002040.html), PMR45 (available from the 10 "United States Department of Agriculture" [USDA] as PI601383) , and the susceptible melon plants described above, such as known mildew-resistant melon plants, PMR5 (available at USDA as Ames26809), WMR29 (available from the "Institut National de la Recherche Agronomique" [INRA]), Edisto47 (available at USDA as NSL34600), PI414723 (available in USDA), MR1 (available in INRA), and PI124112 (available in 15 USDA); and the deposited line. The races of the powdery mildew were determined with reference to the previous Reference Document 3. The results obtained are shown in Table 3.
    [Table 3]
     Line 1 (Race 3.5) Line 2 (Race 2F) Line 3 (Race 5) Line 4 (Race G)
     Vedrantais  3 3 3 3
     PMR45  3 3 3 3
     PMR5  3 0 0 3
     WMR29  3 0 3 3
     Edisto47  3 0 3 3
     PI414723  0 0 0 3
     MR1  3 0 0 0
     PI124112  3 0 0 3
     Susceptible melon plants  3 3 3 3
     Deposited line  0.3 0.2 0.1 0.1
     F3-1  0.2 0.3 0.2 0.1
     F3-2  0.1 0.2 0.2 0.2
     F3-3  0.1 0.1 0.3 0.2
     F3-4  0.2 0.1 0.1 0.1
    5
    10
    fifteen
    twenty
    25
    30
     F3-5  0.1 0.2 0.3 0.2
     F3-6  0.1 0.3 0.1 0.1
     F3-7  0.2 0.1 0.2 0.2
     F3-8  0.2 0.2 0.1 0.3
     F3-9  0.3 0.2 0.1 0.1
     F3-10  0.1 0.1 0.2 0.1
    As can be seen in Table 3, the known mildew-susceptible melon plants Vedrantais and PMR45 and the susceptible melon plants described above were all susceptible to all mildew mildew lines. The known mildew-resistant melon plants PMR5 and PI124112 were resistant to the mildew lines of mildew 2 and 3, while they were susceptible to the mildew lines of mildew 1 and 4. WMR29 and Edisto47 were resistant to the mushroom line of oídio 2, while they were susceptible to the mildew lines of oídio 1, 3 and 4. PI1414723 was resistant to the mildew lines of oídio 1 to 3, while it was susceptible to the mildew line of oídio 4. MR1 was resistant to the mildew lines of oidium 2 to 4, while it was susceptible to the mildew line of oidium 1. On the contrary, the selected lines F3 and the deposited line were resistant to all the mildew lines of oidium. In addition, since oid mildew lines 1 to 4 are all capable of infecting melon plants that include known oid resistance genes, it was found that the locus of resistance is also effective against oid mildew lines capable of of infecting melon plants that include known mildew resistance genes. These results demonstrate that the selected lines F3 and the deposited line are resistant to a plurality of known races of powdery mildew. In addition, while the known mildew-resistant melon plants were susceptible to at least one of the mildew lines of mildew 1 to 4, the selected lines F3 and the deposited line were resistant to all the mildew lines of mildew 1 to 4 These results demonstrate that the resistance locus that fulfills both conditions (1) and (2) is a new mildew resistance locus different from the resistance loci included in known mildew resistant melon plants.
    (6) Oid resistance locus on chromosome 6
    A segregation population F2 was produced in the same manner as in the previous point (2). Next, with respect to the F2 segregation population thus produced, the lengths of the amplified fragments and the polymorphic bases corresponding to the first set of SNPs were identified in the same manner as the previous point (4).
    5
    10
    fifteen
    twenty
    25
    30
    35
    In addition, the DNA of each individual in the F2 segregation population was amplified by PCR using the following primer sets 3 and 4, and the polymorphic bases corresponding to the second set of SNPs and the third set of SNPs in the amplified fragments obtained were identified by amplification. The amplification using primer set 3 was carried out by incubating the DNA at 94 ° C for 3 minutes, then subjecting the DNA to 35 treatment cycles (with a treatment at 94 ° C for 30 seconds, at 51 ° C for 30 seconds, and at 72 ° C for 60 seconds as a cycle), and subsequently incubating the DNA at 72 ° C for 3 minutes. Amplification using primer set 4 was carried out by incubating the DNA at 94 ° C for 3 minutes, then subjecting the DNA to 35 treatment cycles (with a treatment at 94 ° C for 30 seconds, at 58 ° C for 30 seconds, and at 72 ° C for 60 seconds as a cycle), and subsequently incubating the DNA at 72 ° C for 3 minutes.
    Primer set 3
    a direct primer 3: 5’-AGGAAACGAAGAATAGACG-3 ’(SEQ ID NO: 10)
    a reverse primer 3: 5’-TGAGAACCGGAAAGAGAAGC-3 ’(SEQ ID NO: 11)
    Primer set 4
    a direct primer 4: 5’-GTTCGGATCGGAAAATTCAA-3 ’(SEQ ID NO: 12)
    a 4: 5’-CCAAGCTTTCCGACATTCAT-3 ’reverse primer (SEQ ID NO: 13)
    Next, with respect to the F2 segregation population, the lengths of the amplified fragments and genotypes of the first set of SNPs, the second set of SNPs, and the third set of SNPs were classified. Also, with respect to the F2 segregation population, the mildew inoculation test was carried out and the disease index was evaluated in the same manner as in the previous point (2). Among the results obtained, Table 4 shows that the results obtained with respect to: four individuals (lines X1 to X4) that differ from each other in the lengths of the amplified fragments and the genotypes of the first set of SNPs, the second set of SNP, and the third set of SNP; the deposited line; the susceptible line; and the F1 lines obtained from the deposited line and the susceptible line. Regarding the lengths of the amplified fragments shown in Table 4 below, "A" indicates that the lengths of the amplified fragments obtained by amplification of the two copies of chromosome 6 using primer set 1 were both 133 bp or more. "H" indicates that the length of the amplified fragment obtained by amplification of one of the two copies of chromosome 6 using the
    primer set 1 was 133 bp or more, and the length of the amplified fragment obtained by amplification of the other copy of chromosome 6 was less than 133 bp. "B" indicates that the lengths of the amplified fragments obtained by amplification of the two copies of chromosome 6 were both less than 133 bp. Furthermore, with respect to the first set of 5 SNPs, the second set of SNPs, and the third set of SNPs shown in Table 4 below, "A" indicates that each of the SNP sets was in the homozygous resistant type, "H" indicates that each of the SNP sets was in the homozygous form, and " H ”indicates that each of the SNP sets was in the homozygous susceptible type. In Table 4, A is shaded.
    10
    [Table 4]
     Second set of SNP Fragment lengths by amplification First set of SNP Third set of SNP Disease index
     Line X1  H A A A 0
     Line X2  A H H H 3
     Line X3  H H H A 3
     Line X4  H A A H 1
     Deposited line  A A A A 0
     F1 lines  H H H H 3
     Susceptible melon plant  B B B B 3
    As can be seen in Table 4, all individuals classified as "A" with respect to the lengths of the amplified fragments and the first set of SNPs had a disease index of 1 or less. From these results, found that, in the resistance locus, the lengths of the amplified fragments and the first set of SNPs show high correlation with resistance to powdery mildew. In other words, it was found that conditions (1) and (2) show high correlation with resistance to powdery mildew. Also, from the fact that the lengths of the amplified fragments and the first set of SNPs show high correlation with the resistance to powdery mildew, it was found that a region between the
    5
    10
    fifteen
    twenty
    25
    30
    35
    sites of any of the two SNPs selected from the second set of SNPs and the third set of SNPs, that is, a region that includes the amplified fragments and the first set of SNPs, shows high correlation with resistance to powdery mildew. In other words, it was found that condition (9) shows high correlation with resistance to powdery mildew. From these results, it was found that the resistance locus that meets at least one of the conditions (1) and (2) and the resistance locus that meets the condition (9) each serves as a marker of resistance to powdery mildew for Melon plants and that it is possible to detect mildew-resistant melon plants using the mildew resistance marker for melon plants.
    Although the present invention has been described above with reference to the embodiments and examples, the present invention is in no way limited thereto. Various changes and modifications can be made that may become apparent to those skilled in the art in the configuration and details of the present invention without departing from the scope of the present invention.
    This application claims priority from Japanese Patent Application No. 2015222794 filed on November 13, 2015. The full disclosure of this Japanese patent application is incorporated herein by reference.
    Industrial applicability
    The mildew resistance marker for melon plants according to the present invention allows easy detection of mildew resistant melon plants, for example. Also, the mildew-resistant melon plant according to the present invention includes the mildew-resistant locus, for example, and thus may have oidium resistance, for example. In addition, the oid resistance locus can confer oid resistance even if it is a single gene locus, for example. Therefore, according to the powder-resistant plant of the present invention, for example, progenies that have resistance to powdery mildew can also be easily obtained from the F1 obtained by crossing the water-resistant melon plant of the present invention with other plants. of melon or its progeny. In addition, a melon plant that includes the dust resistance marker is resistant to breeds of powdery mildew capable of infecting melon plants that include the powder resistance genes described in the prior art document, for example. Therefore, the mildew-resistant melon plant of the present invention can eliminate the need for prevention and
    extermination using agricultural chemical compounds as conventionally performed, so that the labor problem and cost for spraying agricultural chemical compounds can be avoided, for example.
    5 [Sequence listing]
    TF15023WO_ST25.txt
    5
    10
    fifteen
    twenty
    25
    30
    35
    1. An oid resistance marker for a melon plant, where the oid resistance marker comprises an oid resistance locus on chromosome 6 in a homozygous form, where the oid resistance locus on chromosome 6 meets the minus one of the following conditions (1) and (2):
    Condition (1): the oid resistance locus on chromosome 6 is identified by a length of an amplified fragment obtained by amplification using a primer set
    1. and the length of the amplified fragment is 133 bp or more,
    wherein the primer set 1 comprises a direct primer 1 consisting of a base sequence SEQ ID NO: 1, and a reverse primer 1 consisting of a base sequence of SEQ ID NO: 2; Y
    Condition (2): the oid resistance locus on chromosome 6 is identified by base polymorphisms at positions 45, 48, 49, 51, 108, 120, 139, 214 and 327 in a base sequence of SEQ ID NO: 3.
    2. The powder resistance marker according to claim 1, wherein in the condition
    (2), the oid resistance locus on chromosome 6 is identified by a base sequence from positions 204 to 213 in the base sequence of SEQ ID NO: 3.
    3. The powder resistance marker according to claim 1 or 2, wherein the powder resistance locus on chromosome 6 meets at least one of the following conditions
    (3) and (4):
    Condition (3): the oid resistance locus on chromosome 6 is identified by base polymorphisms at positions 50, 141 and 266 in a base sequence of SEQ ID NO: 4; Y
    Condition (4): the oid resistance locus on chromosome 6 is identified by base polymorphisms at positions 99, 174, 184, 199 and 200 in a base sequence of SEQ ID NO: 5.
    4. The powder resistance marker according to any one of claims 1 to 3, wherein the powder resistance locus on chromosome 6 meets at least one of the following conditions (5) and (6):
    Condition (5): the oid resistance locus on chromosome 6 is identified by polynucleotide (a), where said polynucleotide (a) is polynucleotide (a1) or (a3), being the
    权利要求:
    Claims (15)
    [1]
    5
    10
    fifteen
    twenty
    25
    30
    35
    polynucleotide (a1) a polynucleotide consisting of a base sequence of SEQ ID NO: 6, and polynucleotide (a3) being a polynucleotide consisting of a base sequence that has at least 90% sequence identity to the sequence of polynucleotide bases (a1); Y
    Condition (6): the oid resistance locus on chromosome 6 is identified by polynucleotide (b), where said polynucleotide (b) is polynucleotide (b1) or (b3), polynucleotide (b1) being a polynucleotide that it consists of the base sequence of SEQ ID NO: 3, and the polynucleotide (b3) being a polynucleotide consisting of a base sequence that has at least 90% sequence identity to the base sequence of the polynucleotide (b1) with the base (A) in position 45, the base (A) in position 48, the base (T) in position 49, the base (T) in position 51, the base (T) in position 108 , the base (A) at position 120, the base (A) at position 139, the base (T) at position 214, and the base (C) at position 327 in the base sequence of the polynucleotide (b1 ) that is preserved.
    [5]
    5. The powder resistance marker according to any one of claims 1 to 4, wherein the powder resistance locus on chromosome 6 meets at least one of the following conditions (7) and (8):
    Condition (7): the oid resistance locus on chromosome 6 is identified by polynucleotide (c), where said polynucleotide (c) is polynucleotide (c1) or (c3), polynucleotide (c1) being a polynucleotide that it consists of the base sequence of SEQ ID NO: 4, and the polynucleotide (c3) being a polynucleotide consisting of a base sequence that has at least 80% sequence identity to the base sequence of the polynucleotide (c1) with the base (C) at position 50, the base (A) at position 141, and the base (T) at position 266 in the base sequence of the polynucleotide (c1) that is conserved; Y
    Condition (8): the oid resistance locus on chromosome 6 is identified by the following polynucleotide (d), where said polynucleotide (d) is the polynucleotide (d1) or (d3), the polynucleotide (d1) being a polynucleotide consisting of the base sequence of SEQ ID NO: 5, and the polynucleotide (d3) being a polynucleotide consisting of a base sequence that has at least 80% sequence identity to the base sequence of the polynucleotide (d1 ) with the base (C) in position 99, the base (G) in position 174, the base (T) in position 184, the base (A) in position 199, and the base (T) in position 200 in the base sequence of the polynucleotide (d1) that is conserved.
    5
    10
    fifteen
    twenty
    25
    30
    35
    [6]
    6. A mildew-resistant melon plant comprising:
    an oid resistance locus on chromosome 6 in a homozygous form,
    where the oid resistance locus on chromosome 6 meets at least one of the following conditions (1) and (2):
    Condition (1): the oid resistance locus on chromosome 6 is identified by a length of an amplified fragment obtained by amplification using the following primer set 1, and the length of the amplified fragment is 133 bp or more,
    wherein the primer set 1 comprises a direct primer 1 consisting of a sequence of bases SEQ ID NO: 1 and a reverse primer 1 consisting of a sequence of bases SEQ ID NO: 2; Y
    Condition (2): the oid resistance locus on chromosome 6 is identified by base polymorphisms at positions 45, 48, 49, 51, 108, 120, 139, 214 and 327 in a base sequence of SEQ ID NO: 3.
    [7]
    7. The mildew-resistant melon plant according to claim 6, wherein, in condition (2), the locus of powdery mildew on chromosome 6 is identified by a base sequence from positions 204 to 213 in the sequence of bases of SEQ ID NO: 3.
    [8]
    8. The mildew-resistant melon plant according to claim 6 or 7, wherein the oid resistance locus on chromosome 6 meets at least one of the following conditions (3) and (4):
    Condition (3): the oid resistance locus on chromosome 6 is identified by base polymorphisms at positions 50, 141 and 266 in a base sequence of SEQ ID NO: 4; Y
    Condition (4): the oid resistance locus on chromosome 6 is identified by base polymorphisms at positions 99, 174, 184, 199 and 200 in a base sequence of SEQ ID NO: 5.
    [9]
    9. The mildew-resistant melon plant according to any one of claims 6 to 8, wherein the oid resistance locus on chromosome 6 meets at least one of the following conditions (5) and (6):
    Condition (5): the oid resistance locus on chromosome 6 is identified by polynucleotide (a), where said polynucleotide (a) is polynucleotide (a1) or (a3), polynucleotide (a1) being a polynucleotide that consists of a sequence of bases of SEQ ID
    5
    10
    fifteen
    twenty
    25
    30
    35
    NO: 6, and the polynucleotide (a3) being a polynucleotide consisting of a base sequence that has at least 90% sequence identity to the base sequence of the polynucleotide (a1); Y
    Condition (6): the oid resistance locus on chromosome 6 is identified by the following polynucleotide (b), where said polynucleotide (b) is polynucleotide (b1) or (b3), polynucleotide (b1) being a polynucleotide consisting of the base sequence of SEQ ID NO: 3, and the polynucleotide (b3) being a polynucleotide consisting of a base sequence that has at least 90% sequence identity to the base sequence of the polynucleotide (b1 ) with base (A) in position 45, base (A) in position 48, base (T) in position 49, base (T) in position 51, base (T) in position 108, the base (A) at position 120, the base (A) at position 139, the base (T) at position 214, and the base (C) at position 327 in the base sequence of the polynucleotide ( b1) that is preserved.
    [10]
    10. The mildew-resistant melon plant according to any one of claims 6 to 9, wherein the oid resistance locus on chromosome 6 meets at least one of the following conditions (7) and (8):
    Condition (7): the oid resistance locus on chromosome 6 is identified by polynucleotide (c), where said polynucleotide (c) is polynucleotide (c1) or (c3), polynucleotide (c1) being a polynucleotide that it consists of the base sequence of SEQ ID NO: 4, and the polynucleotide (c3) being a polynucleotide consisting of a base sequence that has at least 80% sequence identity to the base sequence of the polynucleotide (c1) with the base (C) at position 50, the base (A) at position 141, and the base (T) at position 266 in the base sequence of the polynucleotide (c1) that is conserved; Y
    Condition (8): the oid resistance locus on chromosome 6 is identified by the following polynucleotide (d), where said polynucleotide (d) is the polynucleotide (d1) or (d3), the polynucleotide (d1) being a polynucleotide consisting of the base sequence of SEQ ID NO: 5, and the polynucleotide (d3) being a polynucleotide consisting of a base sequence that has at least 80% sequence identity to the base sequence of the polynucleotide (d1 ) with the base (C) in position 99, the base (G) in position 174, the base (T) in position 184, the base (A) in position 199, and the base (T) in position 200 in the base sequence of the polynucleotide (d1) that is conserved.
    [11]
    11. The mildew-resistant melon plant according to any one of claims 6
    5
    10
    fifteen
    twenty
    25
    30
    35
    to 10, where the mildew-resistant melon plant is a melon plant identified by FERM Accession No. BP-22291 or a progeny line thereof.
    [12]
    12. The mildew-resistant melon plant according to any one of claims 6 to 11, wherein the mildew-resistant melon plant is a plant body or a part thereof.
    [13]
    13. The mildew-resistant melon plant according to any one of claims 6 to 12, wherein the mildew-resistant melon plant is a seed.
    [14]
    14. A screening method for a mildew-resistant melon plant, characterized in that it comprises selecting a mildew-resistant cantaloupe plant that includes a mildew-resistant marker for melon plants consisting of an oid-resistance locus in chromosome 6 in a homozygous form of one or more melon plants to be examined, where the millet resistance locus on chromosome 6 meets at least one of the conditions (1) and (2):
    Condition (1): the oid resistance locus on chromosome 6 is identified by a length of an amplified fragment obtained by amplification using the following primer set 1, and the length of the amplified fragment is 133 bp or more,
    wherein the primer set 1 comprises a direct primer 1 consisting of a sequence of bases SEQ ID NO: 1 and a reverse primer 1 consisting of a sequence of bases SEQ ID NO: 2; Y
    Condition (2): the oid resistance locus on chromosome 6 is identified by base polymorphisms at positions 45, 48, 49, 51, 108, 120, 139, 214 and 327 in a sequence of bases SEQ ID NO : 3.
    [15]
    15. The screening method according to claim 14, wherein in condition (2), the oid resistance locus on chromosome 6 is identified by a base sequence from positions 204 to 213 in the SEQ base sequence ID NO: 3.
    [16]
    16. The screening method according to any one of claims 14 or 15, wherein the oid resistance locus on chromosome 6 meets at least one of the following conditions (3) and (4):
    Condition (3): the oid resistance locus on chromosome 6 is identified by base polymorphisms at positions 50, 141 and 266 in a base sequence of the
    5
    10
    fifteen
    twenty
    25
    30
    35
    SEQ ID NO: 4; Y
    Condition (4): the oid resistance locus on chromosome 6 is identified by base polymorphisms at positions 99, 174, 184, 199 and 200 in a base sequence of SEQ ID NO: 5.
    [17]
    17. The screening method according to any one of claims 14 to 16, wherein the oid resistance locus on chromosome 6 meets at least one of the following conditions (5) and (6):
    Condition (5): the oid resistance locus on chromosome 6 is identified by polynucleotide (a), where said polynucleotide (a) is polynucleotide (a1) or (a3), polynucleotide (a1) being a polynucleotide that it consists of a base sequence of SEQ ID NO: 6, and the polynucleotide (a3) being a polynucleotide consisting of a base sequence that has at least 90% sequence identity to the base sequence of the polynucleotide (a1) ; Y
    Condition (6): the oid resistance locus on chromosome 6 is identified by polynucleotide (b), where said polynucleotide (b) is polynucleotide (b1) or (b3), polynucleotide (b1) being a polynucleotide that consists of the base sequence SEQ ID NO: 3, and the polynucleotide (b3) being a polynucleotide consisting of a base sequence having at least 90% sequence identity to the base sequence of the polynucleotide (b1) with the base (A) in position 45, base (A) in position 48, base (T) in position 49, base (T) in position 51, base (T) in position 108, base (A) at position 120, base (A) at position 139, base (T) at position 214, and base (C) at position 327 in the base sequence of polynucleotide (b1) that is preserved.
    [18]
    18. The screening method according to any one of claims 14 to 17, wherein the oid resistance locus on chromosome 6 meets at least one of the following conditions (7) and (8):
    Condition (7): the oid resistance locus on chromosome 6 is identified by polynucleotide (c), where said polynucleotide (c) is polynucleotide (c1) or (c3), polynucleotide (c1) being a polynucleotide that it consists of the base sequence of SEQ ID NO: 4, and the polynucleotide (c3) being a polynucleotide consisting of a base sequence that has at least 80% sequence identity to the base sequence of the polynucleotide (c1) with the base (C) at position 50, the base (A) at position 141, and the base (T) at position 266 in the base sequence of the polynucleotide (c1) that is
    preserves Y
    Condition (8): the oid resistance locus on chromosome 6 is identified by polynucleotide (d), where said polynucleotide (d) is polynucleotide (d1) or (d3), polynucleotide (d1) being a polynucleotide that consists of the base sequence of SEQ ID 5 NO: 5, and the polynucleotide (d3) being a polynucleotide consisting of a base sequence that has at least 80% sequence identity to the base sequence of the polynucleotide (d1 ) with the base (C) in position 99, the base (G) in position 174, the base (T) in position 184, the base (A) in position 199, and the base (T) in position 200 in the base sequence of the polynucleotide (d1) that is conserved.
    10
    image 1
    类似技术:
    公开号 | 公开日 | 专利标题
    Ammar et al.2009|Mapping of QTLs controlling Na+, K+ and CI− ion concentrations in salt tolerant indica rice variety CSR27
    Koning-Boucoiran et al.2012|The mode of inheritance in tetraploid cut roses
    US11246276B2|2022-02-15|Powdery mildew resistance marker for winter squash plants, powdery mildew resistant winter squash plant, method for producing powdery mildew resistant winter squash plant using the same, and method for imparting powdery mildew resistance to winter squash plant
    ES2691593B1|2019-09-13|OID RESISTANCE MARKER FOR MELON PLANTS, OIDIO RESISTANT MELON PLANT, AND METHOD FOR PRODUCING OIDIO RESISTANT MELON PLANT USING SUCH MARKER
    ES2352061T3|2011-02-15|OID RESISTANCE AND ABSENCE OF NECROSIS IN CUCUMIS SATIVUS.
    Rosado et al.2016|QTL mapping for resistance to Ceratocystis wilt in Eucalyptus
    US10244691B2|2019-04-02|Root-knot nematode resistance marker for tomato plant, root-knot nematode resistant tomato plant, production method for root-knot nematode resistant tomato plant, and screening method for root-knot nematode resistant tomato plant
    ES2749966T3|2020-03-24|Disease resistant tomato plants
    Lamour2009|SEX, SELECTION, AND THE WEALTH OF VARIATION
    ES2403404T3|2013-05-17|Marker genetically related to tobamovirus resistance in cucumber and its use
    EP3290526A1|2018-03-07|Marker for leaf mold resistance in tomato plant, leaf mold-resistant tomato plant, method for producing leaf mold-resistant tomato plant, and method for screening for leaf mold-resistant tomato plant
    Smith2010|Genetic and molecular mapping studies on a population derived from Vitis vinifera x Muscadinia rotundifolia and genetic diversity of wild Muscadinia rotundifolia
    Popoola et al.2014|CAPS markers TAO1 and TG105 in the identification of I2 resistant gene in Nigerian accessions of tomato, Solanum lycopersicum L.
    Niu et al.2012|Inferring the invasion history of coral berry Ardisia crenata from China to the USA using molecular markers
    JP2019024483A|2019-02-21|Mildew resistant pumpkin plants using the same, and methods for imparting powdery mildew resistance to pumpkin plants
    CN107090497A|2017-08-25|With the SNP marker of upland cotton resisting verticillium major gene resistance close linkage
    Liu et al.2020|Mapping Quantitative Trait Loci for High-Temperature Adult-Plant Resistance to Stripe Rust in Spring Wheat PI 197734 Using a Doubled Haploid Population and Genotyping by Multiplexed Sequencing
    EP2966167A1|2016-01-13|Prsv-resistant cucumber, and method for producing cucumber exhibiting resistance to prsv and zymv
    GarcÃa-Estrada et al.2016|Characterization of Phytophthora nicotianae causing vinca blight in urban areas and ornamental nurseries in Culiacan, Mexico
    Cindy et al.2020|Identification of a polymorphism within the Rosa multiflora muRdr1A gene linked to resistance to multiple races of Diplocarpon rosae W. in tetraploid garden roses |
    Aznarte-Mellado et al.2014|Molecular characterization of the interspecific hybrid Pistacia vigros |
    CN111073990A|2020-04-28|Dominant molecular marker of rice blast resistance gene Pi67| and application thereof
    JP2014168430A|2014-09-18|Brown spot-resistant cucumber plants, and method for producing brown spot-resistant cucumber plants and powdery mildew-resistant cucumber plants
    Nagel2012|Species of Phytophthora associated with a native ecosystem in Gauteng
    同族专利:
    公开号 | 公开日
    JP2017086016A|2017-05-25|
    WO2017081876A1|2017-05-18|
    US10772273B2|2020-09-15|
    ES2691593R1|2019-01-22|
    ES2691593B1|2019-09-13|
    JP6811526B2|2021-01-13|
    TR201806450T1|2018-06-21|
    US20180325057A1|2018-11-15|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    JP6306252B1|2017-07-31|2018-04-04|タキイ種苗株式会社|Powdery mildew resistance marker of pumpkin plant, powdery mildew resistant pumpkin plant, method for producing powdery mildew resistant pumpkin plant using the same, and method for imparting powdery mildew resistance to pumpkin plant|
    CN111121629B|2019-12-31|2021-03-26|广西壮族自治区农业科学院|Soybean leaf wrinkling field identification method|
    法律状态:
    2018-11-27| BA2A| Patent application published|Ref document number: 2691593 Country of ref document: ES Kind code of ref document: A2 Effective date: 20181127 |
    2019-01-22| EC2A| Search report published|Ref document number: 2691593 Country of ref document: ES Kind code of ref document: R1 Effective date: 20190115 |
    2019-09-13| FG2A| Definitive protection|Ref document number: 2691593 Country of ref document: ES Kind code of ref document: B1 Effective date: 20190913 |
    优先权:
    申请号 | 申请日 | 专利标题
    JP2015222794A|JP6811526B2|2015-11-13|2015-11-13|Powdery mildew resistance marker of melon plant, powdery mildew resistant melon plant, and method for producing powdery mildew resistant melon plant using it.|
    JP2015-222794|2015-11-13|
    PCT/JP2016/066009|WO2017081876A1|2015-11-13|2016-05-31|White mildew resistance marker for melon plants, white mildew-resistant melon plant, and method for producing white mildew-resistant melon plant using said white mildew-resistant melon plant|
    [返回顶部]