• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    Triple mutante del complejo mycobacterium tuberculosis erp-, phop- y dim-. The present invention relates to a microorganism isolated from the mycobacterium tuberculosis complex comprising the inactivation or deletion of the erp gene, the phop gene and a gene that prevents the production of thiocerol dimicocerosols (dim). Said microorganism is useful for the treatment or prevention of tuberculosis, for the treatment of bladder cancer and as a vector or adjuvant. In addition, it also relates to the pharmaceutical composition comprising it and to its use as a vaccine, vector or adjuvant; as well as the production method of said microorganism. (Machine-translation by Google Translate, not legally binding)
    公开号:ES2549366A1
    申请号:ES201430421
    申请日:2014-03-25
    公开日:2015-10-27
    发明作者:Luis SOLANS BERNAD；Juan Ignacio Aguilo Anento；Santiago URANGA MAIZ；Brigitte Gicquel；Carlos Martin Montañes
    申请人:Universidad de Zaragoza；
    IPC主号:
    专利说明:

    The present invention relates to a microorganism isolated from the Mycobacterium tuberculosis complex comprising the inactivation or deletion of the erp gene, the phoP gene and a gene that prevents the production of thiocerol dimicocerosates (DIM). Said microorganism is useful for the treatment or prevention of tuberculosis, for the treatment of bladder cancer and as a vector or adjuvant. Therefore, the present invention could be framed in the medical field. STATE OF THE TECHNIQUE
    Tuberculosis (TB) remains one of the most important global public health problems and Mycobacterium tuberculosis, the causative agent of human TB, infects a third of the world's population. In 2011, 8.7 million new cases were detected and 1.4 million people died from the disease. With TB causing a quarter of the deaths caused in patients infected with the human immunodeficiency virus (HIV) and the emergency caused by the increase in drug-resistant M. tuberculosis strains, an effective vaccine is more necessary than ever to reduce disease weight (Glaziou P, et al. Semin Respir Crit Care Med 2013 Feb; 34 (1): 3-16)
    The current vaccine used against tuberculosis, Mycobacterium bovis Bacille-Calmette Guerin (BCG), has been administered since 1921 conferring protection against the most severe forms of the disease (tuberculous meningitis and miliary tuberculosis) in children but loses effectiveness protecting against the pulmonary form of the disease, the most common form of transmission (WHO. Information Sheet: observed rate of vaccine reactions Bacille Calmette-Ghérin (BCG) vaccine. Global Vaccine Safety, Immunization and Biologicals 2012 April 2012). Although BCG is considered a very safe vaccine and is administered globally, severe immunodeficiency states have been linked to an increased risk of dissemination in the BCG post-vaccination system (Murphy D, et al. Tuberculosis (Edinb) 2008 88 (4): 344-57). Those risk groups for which BCG vaccination is contraindicated include patients with immunodeficiencies, both primary and secondary, and people infected with the HIV virus, including infants (WHO.


    Information Sheet: observed rate of vaccine reactions Bacille Calmette-Ghérin (BCG) vaccine. Global Vaccine Safety, Immunization and Biologicals. 2012 April 2012). There has been a special concern about the involvement of HIV in the safety of BCG vaccination (Mak TK, et al. Lancet 2008 Sep 6; 372 (9641): 786-7). A recent retrospective has documented a high frequency of BCG infections in children infected with HIV (Hesseling AC, et al. Vaccine 2007 Jan 2; 25 (1): 14-8). The current vaccination policy of the World Health Organization recommends non-vaccination with BCG in children known to be infected with HIV, with or without manifested symptoms.
    One of the advantages of using live attenuated vaccines based on clinical isolates of M. tuberculosis is that they keep most of the antigens absent in
    M. bovis and others that BCG lost during the successive crop process (Arbues A, et al. Vaccine 2013 31 (42): 4867-73; Brosch R, et al. Proc Natl Acad Sci USA 2007 104 (13): 5596-601), therefore they represent a rational alternative to replace BCG. In addition, the use of BCG is contraindicated in patients with both primary and secondary immunodeficiencies, including those infected with HIV (WHO. Information Sheet: observed rate of vaccine reactions Bacille Calmette-Ghérin (BCG) vaccine. Global Vaccine Safety, Immunization and Biologicals . 2012 April 2012). The development of new vaccines safer than BCG that can be used in this population is necessary.
    The main challenge in the development of live vaccines is to achieve a satisfactory degree of attenuation and safety while maintaining the immunogenicity and protection of the vaccine. There are examples in the literature of live attenuated mutants of M. tuberculosis as vaccine candidates that, although attenuated, confer protection against BCG-like disease. For example, a mutant simpe auxotrophic M. tuberculosis deficient in leucine biosynthesis (¨leu) has been attenuated in vitro and in vivo but is characterized by low protective efficacy compared to BCG (Hondalus MK, et al. Infect Immun 2000 68 (5): 2888-98).
    The vaccine called MTBVAC, is a live M. tuberculosis vaccine based on deletions in the phoP and fadD26 genes and is the first vaccine that meets the Geneva criteria (Kamath AT, et al. Vaccine 2005 23 (29): 3753- 61). MTBVAC confers greater protection than BCG in mouse model and has a safety profile


    similar (Arbues A, et al. Vaccine 2013 31 (42): 4867-73). MTBVAC is the first attenuated M. tuberculosis-based vaccine that has entered clinical trials (clinical trial identifier at ClinicalTrials.gov: NCT02013245). However, MTBVAC is not recommended for use in patients at risk of immunosuppression.
    5 During the past decade numerous efforts were put into the construction of new vaccines against tuberculosis, including vaccines capable of being used in immunosuppressed patients (Marinova D, et al. Vaccines 2013 Dec: 12 (12): 1431-48). To this end, different approaches have been used, including recombinant BCG strains, administration of enhancers after BCG vaccination.
    10 or live attenuated strains of M. tuberculosis, all of them are in different phases of clinical or preclinical trials. However, a vaccine that is sufficiently effective and sufficiently attenuated is necessary to be used in patients at risk of immunosuppression, even in newborns at risk of immunosuppression. DESCRIPTION OF THE INVENTION
    The present invention relates to a recombinant microorganism belonging to the M. tuberculosis complex comprising the inactivation or deletion of the erp gene, the phoP gene and a gene that prevents thiocerol dimicocerosate production
    20 (pthicerol dimycocerosates, DIM). The three mutations have a synergistic effect in their extreme attenuation, the triple mutant is surprisingly highly attenuated and maintains the ability to protect against tuberculosis. Therefore, it is useful in all patients, even in patients at risk of immunosuppression.
    In the present invention the triple mutation has been performed in M. tuberculosis and the
    25 results are extrapolated to the other members of the M. tuberculosis complex. The person skilled in the art knows that the members of the M. tuberculosis complex, among which are M. tuberculosis (the main causative agent of tuberculosis in humans), M. bovis (responsible for TB in cattle and that includes the BCG strain), M. africanum (the main cause of TB in Africa), M. microti, M. caprae, M. pinnipedii,
    30 and M. canetti represent a single species due to the similarities between them (Cole ST, et al. Nature 1998 393: 537-544; Imaeda T, International Journal of Systematic


    Bacteriology 1985 35 (2): 147-150; Van Soolingen D, et al. International Journal of Systematic Bacteriology 199747 (4): 1236-1245; Brosch R, et al. PNAS 2002 99 (6): 3684–3689). On the other hand, as the person skilled in the art knows well, among the different members of the M. tuberculosis complex, the existence of the phoP gene, of several genes that produce DIM (among them the fadD26 gene) and of the erp gene (Berthet) is known FX, et al. Science 1998 Oct 23; 282 (5389): 759-62; Bigi F, et al. Tuberculosis (Edinb) 2005 Jul; 85 (4): 221-6) and also the great similarity between them ( Zahrt TC and Deretic V, PNAS 2001 98 (22): 12706-12711; Soto CY, et al. J Clin Microbiol 2004 42 (1): 212-219; Camacho LR, et al. Mol Microbiol 1999 34 (2): 257-267, Camacho LR, et al. J Biol Chem 2001 276 (23): 19845-19854; Cox JS, et al. Nature 1999 402: 79-83).
    The present invention also relates to the use of the microorganism of the invention and of the pharmaceutical composition comprising it for the same indications as those skilled in the art know for the BCG vaccine. Therefore, the microorganism of the invention and the pharmaceutical composition of the invention can be used for the treatment or prevention of tuberculosis, for the treatment against bladder cancer (Lamm DL, et al. The Journal of Urology 2000; 163: 1124-1129; Saint F, et al. European Urology 2003; 43: 351-361), and as an adjuvant or vector (Stover CK, et al. Nature 1991; 351 (6): 456-460 and Bastos RG, et al Vaccine 2009; 27: 6495-6503).
    Therefore, a first aspect, the present invention relates to an isolated microorganism belonging to the Mycobacterium tuberculosis complex, hereinafter this isolated microorganism will be called the microorganism of the present invention, which comprises the inactivation or deletion of:
    to.  the erp gene,
    b.  the phoP gene and
    C. a gene that prevents thiocerol dimicocerosate (DIM) production. The microorganism of the invention is therefore referred to as "erp-phoP-DIM-".
    In a preferred embodiment, the isolated microorganism of the present invention is characterized in that the gene that prevents the production of DIM is the fadD26 gene. This most referred microorganism of the invention is therefore referred to as "erp-phoPfadD26-", also referred to in the present invention as "MTBVAC erp-" when derived from the strain of M. tuberculosis Mt103.


    In the present invention, "Mycobacterium tuberculosis" complex is understood to mean microorganisms of the Mycobacterium genus that cause tuberculosis in mammals such as M. tuberculosis (the main causative agent of tuberculosis in humans), M. bovis (responsible for TB in cattle and which includes the strain BCG), M. africanum (the
    5 main cause of TB in Africa), M. microti, M. caprae, M. pinnipedii, and M. canetti and representing a single species due to the similarities between them (Cole ST, et al. Nature 1998393: 537-544 ; Imaeda T International Journal of Systematic Bacteriology 1985 35 (2): 147-150; Van Soolingen D, et al. International Journal of Systematic Bacteriology 199747 (4): 1236-1245; Brosch R, et al. PNAS 2002 99 (6 ): 3684–3689).
    In another embodiment of the invention, the isolated microorganism of the invention is selected from the list comprising M. tuberculosis, M. bovis, M. africanum, M. caprae, M. pinnipedii, M. canetti and M. microti. In yet another more preferred embodiment, the isolated microorganism of the invention is M. tuberculosis.
    In the present invention, "inactivation" is understood as the disruption of the expression of a gene by any method known to the person skilled in the art, for example, by the insertion of an antibiotic resistance marker or by deletion of the gene. In the present invention, "deletion" means the elimination of part of
    20 a gene or a complete gene that causes the expression of said gene and phenotype in the deleted strain to be lost.
    In the present invention, "erp" gene is understood as the gene called Rv3810 known to the person skilled in the art, also known as pirG. For example, in the case of M. tuberculosis strain H37Rv it refers to the gene with GenBank reference number L38851.1, (NC_002755.2 in the case of M. tuberculosis strain CDC1551), in the case of M. bovis strain AF2122 / 97 to the gene with GenBank reference number NC_002945.3, gene identification 1093509 (GenBank) and in the case of M. africanum strain GM041182 to the gene with GenBank reference number NC_015758.1,
    30 gene identification 10957490 (GenBank).
    In the present invention, the "phoP" gene is understood as the gene called Rev0757 known to the person skilled in the art. For example, in the case of M. tuberculosis strain H37Rv refers to the gene with GenBank reference number NC_000962.3 in M. 35 tuberculosis H37Rv, in the case of M. bovis strain AF2122 / 97 to the gene with reference number of the GenBank NC_002945.3, gene identification 1092447 (GenBank) and in


    the case of M. africanum strain GM041182 to the gene with GenBank reference number NC_015758.1 gene identification 1095513 (GenBank).
    In the present invention, genes that prevent (prevent) the production of DIM
    5 (thiocerol dimicocerosates) are those known to the person skilled in the art (forexample, those described in Camacho LR, et al. J Biol Chem. 2001 276 (23): 19845-54).These genes can be selected from the list comprising: fadD26, fadD28, ddrCand mmpL7. In a particular embodiment it is the fadD26 gene (named by the expertin the matter Rv2930). For example, the M. tuberculosis fadD26 gene of the strain
    10 H37Rv with GenBank reference number NC_000962.3, in the case of M. bovis strain AF2122 / 97 to the gene with GenBank reference number NC_002945.3 gene identification 1092151 (in GenBank) and in the case of M. africanum strain GM041182 to the gene with GenBank reference number NC_015758.1 gene identification 10956394 (GenBank).
    The microorganism of the invention may or may not comprise antibiotic resistance markers, such as a kanamycin resistance marker.
    Another aspect of the invention relates to the use of the microorganism isolated from the
    20 invention for the preparation of a pharmaceutical composition. Alternatively, the present invention also refers to the isolated microorganism of the invention for use as a medicament.
    In a preferred embodiment, the use of the microorganism of the invention is characterized in that the pharmaceutical composition or medicament is a vaccine.
    Another aspect of the invention relates to the use of the isolated microorganism of the invention for the preparation of a pharmaceutical composition for the treatment or prevention of tuberculosis. Alternatively, the present invention also relates
    30 to the isolated microorganism of the invention for use in the treatment or prevention of tuberculosis.
    Another aspect of the invention relates to the use of the isolated microorganism of the invention for the preparation of a pharmaceutical composition for the treatment of
    35 bladder cancer. Alternatively, the present invention also relates to


    Isolated microorganism of the invention for use in the treatment of bladder cancer.
    The term "pharmaceutical composition"; in this memory refers to any
    5 substance used for prevention, diagnosis, relief, treatment or cure ofdiseases. In the context of the present invention it refers to a compositioncomprising the isolated microorganism of the invention. The compositionPharmaceutical of the invention can be used both alone and in combination withother pharmaceutical compositions, including vaccines and antivirals. The combination
    10 of said pharmaceutical composition with vaccines or antivirals could make the immune response they generate more effective, thus acting as an adjuvant. The term pharmaceutical composition and medicament are used interchangeably in that invention.
    In the context of the present invention the term "vaccine" refers to an antigen preparation used to elicit an immune system response to disease caused by a bacterium or a virus. It is a preparation of antigens that, once inside the body, provokes the response of the immune system through the production of antibodies and generates immunological memory producing
    20 permanent or transient immunity.
    The vaccine of the present invention may be live or inactivated.
    In the present invention the term "antiviral" refers to any substance that does not
    25 allows replication, assembly or release of viruses, such as interferon or ribavirin.
    "Treatment" refers to both therapeutic and prophylactic treatment or preventive measures. Those necessary for treatment include those already associated with
    30 alterations as well as those in which the alteration is prevented. An "alteration" is any condition that would benefit from treatment with the composition of the invention, as described herein.
    In a preferred embodiment, the different uses of the microorganism of the present
    The invention, described so far, is characterized in that they are carried out in an individual at risk of immunosuppression. An individual at risk of immunosuppression


    It may be an HIV-bearing subject, or who has alterations in cellular immunity (for example, by solid organ transplantation, lymphomas or chronic renal failure) or with other causes of immunosuppression, such as solid malignancies and leukemia. In a preferred embodiment, the individual is a carrier of HIV.
    5Another aspect described in the present invention relates to the use of the microorganism.isolated from the invention as a vector or adjuvant.
    Here, the term "adjuvant" refers to an agent, which can stimulate
    10 the immune system increasing its response to a vaccine. The microorganism of the present invention can be used as an adjuvant to other vaccine antigens from other infectious diseases such as diphtheria, tetanus, pertussis, or degenerative diseases such as amyotrophic lateral sclerosis among others.
    Here, the term "vector" refers to the fact that the microorganism of the invention may comprise other vaccine antigens from other infectious diseases such as diphtheria, tetanus, pertussis, or degenerative diseases such as amyotrophic lateral sclerosis among others.
    Another aspect described in the present invention refers to a pharmaceutical composition comprising the isolated microorganism of the invention.
    In a preferred embodiment, the pharmaceutical composition of the invention may further comprise a pharmaceutically acceptable carrier or excipient.
    In another still more preferred embodiment, the pharmaceutical composition of the invention may further comprise an adjuvant.
    In the present invention, when the microorganism is accompanied by an adjuvant it could be, for example, those known to those skilled in the art, for example, but not limited to, the aluminum salts "aluminum phosphate" and "aluminum hydroxide" Freud's complete adjuvant or squalene.
    The term "excipient" refers to a substance that helps the absorption of the pharmaceutical composition comprising the isolated microorganism of the invention,


    it stabilizes or helps in its preparation in the sense of giving it a consistency, shape, flavor or any other specific functional characteristic. Thus, the excipients could have the function of keeping the ingredients together such as starches, sugars or cellulose, sweetening function, dye function, function of
    5 protection of the medicine such as to isolate it from air and / or moisture, filling function of a tablet, capsule or any other form of presentation such as dibasic calcium phosphate, disintegrating function to facilitate the dissolution of the components and its absorption in the intestine, without excluding other types of excipients not mentioned in this paragraph.
    10 A "pharmacologically acceptable carrier" refers to those substances, or combination of substances, known in the pharmaceutical sector, used in the preparation of pharmaceutical forms of administration and includes, but are not limited to, solids, liquids, solvents or surfactants. The vehicle can be a substance
    Inert or analogous to any of the compounds of the present invention and whose function is to facilitate the incorporation of the drug as well as other compounds, allow a better dosage and administration or give consistency and form to the pharmaceutical composition. When the presentation form is liquid, the vehicle is the diluent. The term "pharmacologically acceptable" refers to the
    20 compound referred to is allowed and evaluated so as not to cause damage to the organisms to which it is administered.
    In another preferred embodiment, the composition of the invention may further comprise another active ingredient, for example vaccine antigens from other
    25 infectious diseases such as diphtheria, tetanus, whooping cough, or degenerative diseases such as amyotrophic lateral sclerosis among others.
    As used herein, the term "active ingredient" ("active substance", "pharmaceutically active substance", "active ingredient" or "pharmaceutically active ingredient") means any component that potentially provides a pharmacological activity or other different effect on the diagnosis, cure, mitigation, treatment or prevention of a disease, which affects the structure or function of the body of man or other animals. The term includes those components that promote a chemical change in the preparation of the drug and are present in it
    35 intended modified form that provides the specific activity or effect.


    The pharmaceutical composition or medicament provided by this invention may be provided by any route of administration, for which said composition will be formulated in the pharmaceutical form appropriate to the route of administration chosen. For this reason, a preferred embodiment for this aspect of the invention relates to the pharmaceutical composition where said pharmaceutical composition is presented in a form adapted to administration transdermally, parenterally, intranasally, respiratoryly, periorally, sublingually, orally or topically.
    In another preferred embodiment, the pharmaceutical composition of the invention is characterized in that it is in lyophilized, solid or liquid form.
    In another preferred embodiment, the pharmaceutical composition of the invention can be administered either in a single dose or in repeated doses at the choice of the person skilled in the art.
    Another aspect described in the present invention relates to the use of the pharmaceutical composition described above to stimulate and / or induce the immune response in a subject.
    In a preferred embodiment of the use of the pharmaceutical composition of the invention, it is administered as a vaccine or as a vector or adjuvant, preferably for the treatment or prevention of tuberculosis, and / or for the treatment of bladder cancer. Thus, alternatively the pharmaceutical composition of the invention is used for the treatment or prevention of tuberculosis and / or for the treatment of bladder cancer.
    In a preferred embodiment, the individual or subject to be treated is an individual at risk of immunosuppression, preferably a carrier of the human immunodeficiency virus,
    or who have alterations of cellular immunity (solid organ transplantation, lymphomas, chronic renal failure) or other causes of immunosuppression such as solid malignancies and leukemia. In another preferred embodiment, the individual is a neonate with or without a risk of immunosuppression and can also be an HIV-bearing neonate.


    Another aspect described in the present invention relates to a method for constructing the isolated microorganism of the present invention comprising the inactivation or deletion of:
    to.  the erp gene,
    b.  the phoP gene and
    C. of a gene that prevents the production of DIM.
    In a preferred embodiment, the method of the invention is characterized in that the gene that prevents the production of DIM is the fadD26 gene.
    In another preferred embodiment, the method of the invention is characterized in that the isolated microorganism is selected from the list comprising M. tuberculosis, M. bovis, M. africanum, M. caprae, M. pinnipedii, M. canetti and M. microti, the microorganism M. tuberculosis being preferred.
    Throughout the description and the claims the word quot; comprehequot; and its variants are not intended to exclude other technical characteristics, additives, components or steps. For those skilled in the art, other objects, advantages and features of the invention will be derived partly from the description and partly from the practice of the invention. The following examples and figures are provided by way of illustration, and are not intended to be limiting of the present invention. BRIEF DESCRIPTION OF THE FIGURES
    FIG. 1 Describe the construction and characterization of mutants by erp- deletion. A) Scheme of the constructed deletions, Mt103 erp- and MTBVAC erp-. B) Characterization of the mutants obtained. The DNA was amplified using the primer pairs, erpMUT1 / res1 and erpMUT2 / res2. Mutants 1 and 2 were obtained from Mt103 and mutants 3 and 4 were obtained from MTBVAC. Mutants 2 and 4 were selected since amplification was obtained in both PCRs. C) The attenuation profile of the simple erp mutant in Mt103 was measured by a competition test inoculating an equal amount of Mt103 and Mt103 erp-CFU intra-peritoneally in mice with a severe and combined immunodeficiency (SCID). Three weeks post-infection, Mt103 had displaced Mt103 erp - an order in base 10, indicating that the inactivation of erp was altering the bacterium's ability to replicate in vivo.


    FIG. 2. It is shown that the hyper-attenuation of MTBVAC erp- is due to a non-additive but synergistic effect. A) Intracellular replication in MH-S cell line, representative graph of a triplicate B) Survival experiment in mice (**
    5 equivalent to plt; 0.001), the differences between all groups were significant plt; 0.001.
    FIG. 3. It is shown that MTBVAC erp- protects against tuberculosis. A) Lung induced protection 4 weeks post infection, B) spleen induced protection 4 weeks post infection (* equivalent plt; 0.005, ** equivalent plt; 0.001, ***
    10 equivalent plt; 0.0001)
    FIG. 4. Induced immunity in C57BL6 mice is shown. A) Levels of activation of CD4 + / IFNȖ + cells in spleen 4 weeks post infection. B) Levels of activation of CD8 + / IFNȖ + cells in spleen 4 weeks post infection. C) Levels of activation of CD4 + / IFNȖ + cells in lung 4 weeks post infection. D) Levels of
    15 activation of CD8 + / IFNȖ + cells in lung 4 weeks post infection (* equivalent plt; 0.005). EXAMPLES
    The invention will now be illustrated by tests carried out by the inventors, which demonstrates the effectiveness of the product of the invention.
    Example 1: Generation of the triple mutant phoP-DIM-erp 1.1 Materials and Methods
    Bacterial strains and culture conditions. Escherichia coli HB101 and mycobacterial strains M. tuberculosis H37Rv (Pasteur Institute reference strain), M. tuberculosis Mt103 (clinical isolate) (Arbues A, et al. Vaccine 2013 31 (42): 4867-73),
    M. bovis BCG Pasteur and MTBVAC (Arbues A, et al. Vaccine 2013 31 (42): 4867-73) were used in the present invention. Mycobacterial strains were grown at 37 ° C in 7H9 medium (Difco) supplemented with 0.2% glycerol, 0.05% Tween® 80 and 10%


    albumin-dextrose-catalase (ADC, Middlebrook), in 7H10 plates in medium supplemented with 0.5% glycerol and 10% albumin-dextrose-catalase (ADC, Middlebrook) or in 7H11 plates with medium supplemented with 0.5% glycerol and 10% albumin-dextrose-catalase (ADC, Middlebrook), polymyxin B 50 U / ml, trimetroprim 0.02mg / ml and amphotericin B 0.01 mg / ml (please, commercial houses). The resulting mutants were cultured in the same medium. E. coli HB101, used for cloning procedures, was grown at 37 ° C in liquid Luria-Bertani (LB) medium or in LB agar plates. When required, kanamycin (Km) was used at a concentration of 20 μg / ml, gentamicin at a concentration of 10 μg / ml for 7H10 medium or 20 μg / ml for LB medium and 4% sucrose (weight / volume).
    Plasmid construction and allelic replacement. A 2.2 kilobase (kb) fragment containing the erp gene was amplified using Mt103 genomic DNA using as primers, erpF (AGCGGGCCCTCGATGCGGTGGTCAGC) (SEQ ID NO: 1) and erpRv (AAGGGGCCCATACTCGGTCTGATACCACGG 2) (SEQ ID NO: 2). It was cloned into a pGEM-Teasy® vector. A Km resistance marker, flanked by res sites to be able to subsequently remove the resistance marker, from plasmid pCG122 (Arbues A, et al. Vaccine 2013 31 (42): 4867-73) was cloned into the BamHI and EcoRI sites of the erp gene resulting in a deletion of 431 base pairs (bp) in the reading frame (pLZ2). The pLZ3 suicide plasmid was constructed by inserting a 8955 bp fragment containing the erp :: km fragment from pLZ2 into the ApaI site of plasmid pJQ200-xylE (Arbues A, et al. Vaccine 2013 31 (42): 4867-73) . Two polymerase chain reaction (PCR) primers were designed to characterize the new constructs and confirm double genome recombination, erpMUT1 (ACGTCGAGATCGTTGTAGTTCATCAC) (SEQ ID NO: 3), located 5 'from the recombined region, and erpMUT2 (CCAAGTTCCACGGACCCGT) (SEQ ID NO: 4) located at 3 ', res 1 and res 2 (Arbues A, et al. Vaccine 2013 31 (42): 4867-73), both were used for the same purpose.
    Construction of the mutants. Different erp mutants (Figure 1A) were obtained using the classic homologous double recombination method (Lamrabet O, et al. Tuberculosis (Edinb) 2012 92 (5): 365-76). A suicide vector containing, a sucB gene (lethal in mycobacteria), an xylE gene (gives coloration in the presence of catechol), Gmr (confers resistance to gentamicin) and an electrophores were electrophored in Mt103 and MTBVAC.


    copy of the deleted erp gene that included a kanamycin resistance marker (Kmr); the single recombination mutants were selected on plates containing kanamycin and gentamicin, were not able to grow in the presence of sucrose and had a yellow coloration in the presence of catechol. The double recombination mutants were selected on plaques containing kanamycin, unable to grow the plaque containing gentamicin, had no yellowing in the presence of catechol and survived in the presence of sucrose. Correct recombination was analyzed by PCR using as primers erpMUT1 (SEQ ID NO: 3) and erpMUT2 (SEQ ID NO: 4) (flanking the recombined region) and primers located at the "res" sites of the construction (as described In Arbues A, et al. Vaccine 2013 31 (42): 4867-73), the colonies selections were those that were obtained amplified in the two PCRs (Figure 1B).
    Infection of mouse alveolar macrophage cell line, MH-S. 2x104 MH-S cells (ATCC® CRL-2019 ™) were seeded in 24-well plates (TPP) in DMEM medium enriched with 10% fetal bovine serum and 2mM glutamine and were infected with bacterial suspensions of Mt103, MTBVAC or MTBVAC erp - at a multiplicity of infection of 1: 1. The cultures were incubated at 37 ° C in an atmosphere of 5% CO2. After 4h of infection, the cell monolayers were washed three times with phosphate buffered saline (PBS) to eliminate any non-internalized bacteria. At various post-infection times (4h, 24h, 72h or 168h) the infected cells were lysed with 0.1% triton ™ X_100 and appropriate dilutions were seeded in 7H10 plates to count colony-forming units (cfu) of intracellular bacteria.
    Competition of Mt103 and Mt103 erp-in SCID mice. A group of 5 CB17 SCID mice of 8 weeks of age was infected intraperitoneally with 106 viable bacteria from strains Mt103 and Mt103 erp-. Three weeks post-infection, the mice were sacrificed and the lungs and spleens were collected to measure the number of cfus sowing in 7H11 and 7H11 plus Km 20 μg / ml to discriminate between Mt103 and Mt103 erp-.
    Survival determination in SCID mice. Groups of 5 8-week-old CB17 SCID mice were infected intraperitoneally with 106 viable bacteria from the strains: Mt103, Mt103 erp-, Mycobacterium bovis BCG Pasteur, MTBVAC and


    MTBVAC erp-. The end point of the experiment was established through the survival of the animal, a weight less than 17g was established as a point of sacrifice. Statistical analysis was performed using GraphPad Prism software.
    Vaccination and protective efficacy. Groups of six C57BL / 6JRj mice were
    5 vaccinated with 105 viable bacteria from the appropriate strains intradermally. At four weeks post-infection; the mice were infected with approximately 103 cfu of M. tuberculosis H37Rv intratracheally. At 8 weeks post-infection, the mice were sacrificed and the lungs and spleens were collected to measure the number of cfus by sowing in 7H11 plates. He
    10 statistical analysis was performed using GraphPad Prism software.
    Candidate-induced immunogenicity in C57BL / 6 mice. C57BL / 6 mice were immunized subcutaneously with 105 viable bacteria from the appropriate strains. The mice were kept in groups of 5 individuals for four weeks, at which time the lungs and spleen were sacrificed and removed. 15 The spleens were crushed and the cell suspensions were treated with red blood cell lysing buffer (SIGMA) buffer to remove red blood cells. The lungs were homogenized in the buffer: 10mM HEPES-NaOH pH 7.4. 150 mM NaCl, 5mM KCl, 1 mM MgCl2 and 1.8 mM CaCl2; crushed with gentleMACS dissociator (MACS) and incubated with red blood cell lysing buffer (SIGMA) buffer. 106 splenocytes or 20 lung cells were seeded in 96-well plates (TPP) and incubated in RPMI medium supplemented with 10% fetal bovine serum and 2mM glutamine, 100 U / ml penicillin, 100 μg / ml streptomycin and ȕ-mercaptoethanol 50 PM; in the presence of PPD (SSI) 1 μg / ml at 37 ° C in an atmosphere of 5% CO2. At 18h incubation, the cells were labeled with Į-IFN-APC (BD) and Į-CD4-FITC (BD)
    25 using the BD Cytofix / Cytoperm Fixation / Permeabilization kit according to the manufacturer's instructions. Cells were analyzed by flow cytometry using FACsAria ™ (BD). Statistical analysis was performed using GraphPad Prism software.
    Example 2: In vivo studies with the triple mutant phoP-DIM-erp 2.1 The inactivation of erp attenuates M. tuberculosis in vivo


    In the present invention it is shown that the triple mutation phoP-DIM-erp-attenuates
    M. tuberculosis in vivo surprisingly. M. tuberculosis exemplifies the other mycobacteria of the M. tuberculosis complex as indicated above, whereby the invention relates to the phoP-DIM-erp-mutants of the M. tuberculosis complex.
    The attenuation profile of the simple erp mutant in Mt103 was measured by a competition assay inoculating an equal amount of Mt103 and Mt103 erp-CFU intra-peritoneally in SCID mice. Three weeks post-infection, Mt103 had displaced Mt103 erp- an order in base 10 (Figure 1C), indicating that the inactivation of erp was altering the bacterium's ability to replicate in vivo. 2.2 The hyper-attenuation of MTBVAC erp- is due to a synergistic effect of the three mutations
    First we set out to study whether erp inactivation in MTBVAC conferred additional attenuation in the cellular model (using the protocol of Arbues A, et al. Vaccine 2013 31 (42): 4867-73). For this, the MH-S cell line was used as an alveolar macrophage model for replication in experiments in which Mt103, MTBVAC and MTBVAC erp were studied. Mt103 was able to replicate two orders in 72 hours in the MH-S cells reaching three after seven days of infection, the behavior of MTBVAC and MTBVAC erp-was very similar being unable to replicate more than one logarithm seven days post-infection ( Figure 2A).
    Next, we studied the attenuation of the MTBVAC erp-strain in CB17 SCID mice compared to Mt103, Mt103 erp-, BCG Pasteur and MTBVAC. The survival comparison of the animals vaccinated with Mt103 or Mt103 erp-confirmed the data obtained in the competition trial, the mice inoculated with the mutant strain survived significantly two more weeks. SCID mice vaccinated with MTBVAC erp- survived 42 to 51 weeks (Figure 2B), being able to recover viable bacteria in lung and spleen after that period (data not shown). When the survival of the groups vaccinated with MTBVAC and MTBVAC erp- was analyzed, the data revealed a surprisingly marked attenuation profile of the strain MTBVAC erp-, these animals surviving approximately one year while the mice vaccinated with MTBVAC succumbed at 120


    days. The results shown in Figure 2 clearly indicate that the attenuation profile of MTBVAC erp- is due to a synergistic effect of the inactivation of the three genes (Figure 2A and 2B). Finally, MTBVAC erp- was significantly safer than BCG Pasteur in this model.
    5 2.3 MTBVAC erp- protects at the same level as BCG against tuberculosis
    A high level of attenuation can result in a fall in protective efficacy, therefore we analyze (using the protocol of Arbues A, et al. Vaccine 2013 31 (42): 486773) the protective capacity that conferred MTBVAC by comparing it with BCG and MTBVAC, using H37Rv to cause an infection in C57BL / 6 mice. Both,
    10 BCG and MTBVAC erp-, showed similar efficacy in lung protection, while MTBVAC showed better protection (Figure 3A). A similar result was observed in spleen (Figure 3B). 2.4 Immunogenicity induced by the vaccine candidate MTBVAC erp -.
    To analyze the immunogenicity of MTBVAC erp-, activation was measured at four
    15 weeks post-vaccination of CD4 + / IFNȖ + and CD8 + / IFNȖ + cells (using the protocol of Arbues A, et al. Vaccine 2013 31 (42): 4867-73). For this, the M. bovis BCG, MTBVAC and MTBVAC erp- strains were used. An increase of both cell populations, CD4 + / IFNȖ + and CD8 + / IFNȖ +, was observed in all vaccinated groups (Figure 4). Despite this, a lower percentage of splenocytes was detected
    -
    20 CD4 + / IFNȖ + in the case of MTBVAC erp being significant when compared to MTBVAC. A similar profile is observed in the lungs, but in this case no statistically significant differences were obtained (Figure 4A). No significant differences were found in CD8 + / IFNȖ + cells between the groups studied (Figure 4B, 4D). 25 CONCLUSION
    In the present invention it is demonstrated that a recombinant microorganism belonging to the Mycobacterium tuberculosis complex comprising inactivation
    or deletion of the erp gene, the phoP gene and a gene that prevents thiocerol dimicocerosate (DIM) production, exemplified by the fadD26 gene, is useful as


    hyperatenuated vaccine, making it especially useful for individuals at risk of immunosuppression.
    Surprisingly, MTBVAC hyperatenuation due to the inactivation of erp could lead one to think that they would somehow dramatically affect its effectiveness in its ability to confer protection, however, it is not so. The data shown in the present invention demonstrate that when comparing MTBVAC erp-with BCG, the protection against infection is very similar, although MTBVAC erp-is much more attenuated. The hyper-attenuation phenotype in SCID mice observed in the MTBVAC erp- mutant is higher than expected if we compare Mt103 and the simple mutant Mt103 erp -. The erp mutation introduced in MTBVAC (phoP-fad26-) has a synergistic attenuation effect that does not affect the protective ability of the vaccine against tuberculosis infection when compared to the current BCG strain.
    The hyper-attenuated bacteria vaccine of the M. tuberculosis complex of the present invention is therefore useful for use in patients at risk of immunosuppression, for example, those infected with HIV and those coinfected with HIV and TB.
    In addition, the triple mutant of the invention is also useful in all applications known to those skilled in the art that are made from mutants of M. tuberculosis, for example, in bladder cancer or as a vector or adjuvant.
    Due to the great similarity between the members of the M. tuberculosis complex, M. tuberculosis has been chosen as representative of it and therefore, the results obtained demonstrate the usefulness of the triple mutant of any of the members of said complex.
    The live attenuated M. tuberculosis MTBVAC vaccine has been approved by regulatory authorities for use in humans in clinical trials (ClinicalTrials.gov identifier: NCT02013245). In the present invention the strain MTBVAC erp - has been constructed by stable deletions with a kanamycin resistance marker that confer phoP-, Dim- and erp- phenotypes. The Geneva consensus guide for live M. tuberculosis vaccines advises building stable mutations without resistance marker (Kamath AT, et al. Vaccine 2005 23 (29): 3753-61;


    Walker KB, et al. Vaccine 2010 28 (11): 2259-70). Therefore the present invention also relates to M. tuberculosis complex bacteria that do not comprise resistance markers.

    权利要求:
    Claims (22)
    [1]
    1. Isolated microorganism belonging to the Mycobacterium tuberculosis complex that
    includes the inactivation or deletion of:5 a. the erp gene,
    b.  the phoP gene and
    C. a gene that prevents thiocerol dimicocerosate (DIM) production.
    [2]
    2. Isolated microorganism according to claim 1 wherein the gene that prevents DIM production is the fadD26 gene.
    [3]
    3. Isolated microorganism according to any one of claims 1 or 2 wherein isolated microorganism is selected from the list comprising M. tuberculosis,
    M. bovis, M. africanum, M. caprae, M. pinnipedii, M. canetti and M. microti. fifteen
    [4]
    4. Isolated microorganism according to claim 3 wherein the microorganism is M. tuberculosis.
    [5]
    5. Use of the isolated microorganism according to any of claims 1 to 4 20 for the preparation of a pharmaceutical composition.
    [6]
    6. Use according to claim 5 wherein the pharmaceutical composition is a vaccine.
    [7]
    7. Use of the isolated microorganism according to any of claims 1 to 4
    25 for the preparation of a pharmaceutical composition for the treatment or prevention of tuberculosis.
    [8]
    8. Use of the isolated microorganism according to any of claims 1 to 4
    for the preparation of a pharmaceutical composition for the treatment of bladder cancer.
    [9]
    9. Use of the isolated microorganism according to any of claims 1 to 4 as a vector or adjuvant.
    Use according to any of claims 7 to 9 in an individual at risk of immunosuppression.

    [11]
    11. Use according to claim 10 wherein the individual is a carrier of the human immunodeficiency virus.
    5 12. Pharmaceutical composition comprising the microorganism isolated according toany of claims 1 to 4.
    [13]
    13. Pharmaceutical composition according to claim 12 further comprising a
    pharmaceutically acceptable vehicle. 10
    [14]
    14. Pharmaceutical composition according to claim 13 further comprising an adjuvant.
    [15]
    fifteen. Pharmaceutical composition according to any of claims 12 to 14 in the
    15 that the pharmaceutical composition is in a pharmaceutical form suitable for administration transdermally, parenterally, intranasally, respiratoryly, periorally, sublingually, orally or topically.
    [16]
    16. Pharmaceutical composition according to any of claims 12 to 15 wherein the composition is in lyophilized, solid or liquid form.
    [17]
    17. Use of the pharmaceutical composition according to any of claims 12 to 16 to stimulate and / or induce the immune response in a subject.
    18. Use according to claim 17 as a vaccine.
    [19]
    19. Use according to claim 17 as a vector or adjuvant.
    [20]
    20. Use according to any of claims 17 to 19 for the treatment or prevention of tuberculosis.
    [21]
    21. Use according to any of claims 17 to 19 for the treatment of bladder cancer.
    22. Use according to any of claims 17 to 21 in an individual at risk of immunosuppression.

    [23]
    23. Use according to claim 22 wherein the individual is a carrier of the human immunodeficiency virus.
    24. Method for constructing the isolated microorganism according to any one of claims 1 to 4 comprising the inactivation or deletion of:
    to.  the erp gene,
    b.  the phoP gene and
    C. a gene that prevents the production of DIM. 10
    [25]
    25. Method according to claim 24 wherein the gene that prevents the production of DIM is the fadD26 gene.
    [26]
    26. Method according to any of claims 24 or 25 wherein microorganism
    The isolate is selected from the list comprising M. tuberculosis, M. bovis, M. africanum, M. caprae, M. pinnipedii, M. canetti and M. microti.
    [27]
    27. Method according to claim 26 wherein the microorganism is M. tuberculosis.

    FIG. 1A
    FIG. 1 B

    FIG. 1 C
    FIG. 2A

    FIG. 2B
    FIG. 3A

     FIG. 3B 

     FIG. 4A
     SpleenCD4 + / IFNͲɶ
    *
     FIG. 4B
     SpleenCD8 + / IFNͲɶ

     FIG. 4C
     Lung CD4 + / IFNͲɶ
    % cells
     FIG. 4D 
     Lung CD8 + / IFNͲɶ
    0.4
    % cells
    0.3
    0.2 0.1
    0.0

    SEQUENCE LIST
    <110gt; Zaragoza's University
    <120gt; Triple mutant of the Mycobacterium tuberculosis erp- complex,
    phoP- and DIM
    <130gt; ES1510.109
    <160gt; 4
    <170gt; PatentIn version 3.5
    <210gt; one
    <211gt; 26
    <212gt; DNA
    <213gt; Artificial sequence
    <220gt;
    <223gt; ErpF sense primer
    <400gt; one
    agcgggccct cgatgcggtg gtcagc 26
    <210gt; 2
    <211gt; 30
    <212gt; DNA
    <213gt; Artificial sequence
    <220gt;
    <223gt; ErpRV antisense primer
    <400gt; 2
    aaggggccca tactcggtct gataccacgg 30
    <210gt; 3
    <211gt; 26
    <212gt; DNA
    <213gt; Artificial sequence
    <220gt;
    <223gt; ErpMUT1 primer
    <400gt; 3
    acgtcgagat cgttgtagtt catcac 26
    <210gt; 4
    <211gt; 19
    <212gt; DNA
    <213gt; Artificial sequence
    <220gt;
    <223gt; ErpMUT2 primer
    <400gt; 4
    ccaagttcca cggacccgt 19
    类似技术:
    公开号 | 公开日 | 专利标题
    ES2366622T3|2011-10-24|BOMES OF RECOMBINANT BCG WITH POTENTIAL CAPACITY TO ESCAPE THE ENDOSOMA.
    Sambandamurthy et al.2005|Long-term protection against tuberculosis following vaccination with a severely attenuated double lysine and pantothenate auxotroph of Mycobacterium tuberculosis
    Conlan et al.2010|Differential ability of novel attenuated targeted deletion mutants of Francisella tularensis subspecies tularensis strain SCHU S4 to protect mice against aerosol challenge with virulent bacteria: effects of host background and route of immunization
    ES2313719T3|2009-03-01|ABUNDANT EXTRACELLULAR PRODUCTS AND PROCEDURE OF PRODUCTION AND USE OF THE SAME.
    US10010595B2|2018-07-03|Live recombinant booster vaccine against tuberculosis
    Locht2018|Will we have new pertussis vaccines?
    Locht2016|Live pertussis vaccines: will they protect against carriage and spread of pertussis?
    Usman et al.2017|Vaccine research and development: tuberculosis as a global health threat
    Ma et al.2017|A multistage subunit vaccine effectively protects mice against primary progressive tuberculosis, latency and reactivation
    JP2005538923A|2005-12-22|Mycobacterial vaccine
    ES2393007T3|2012-12-17|Prophylactic tuberculosis vaccine
    RU2760580C2|2021-11-29|RECOMBINANT BCG OVEREXPRESSING PhoP-PhoR
    ES2549366B1|2016-09-06|MUTANT TRIPLE OF THE MYCOBACTERIUM TUBERCULOSIS erp-, phoP- and DIM- COMPLEX
    US20130022638A1|2013-01-24|Tuberculosis Vaccine
    Garcia-Contreras et al.2012|Inhaled vaccines for the prevention of tuberculosis
    Ohara2012|Current status of tuberculosis and recombinant bacillus Calmette-Guérin vaccines
    Nadolinskaia et al.2020|Vaccines against tuberculosis: Problems and prospects
    KR101564323B1|2015-10-29|Vaccine composition for tuberculosis containing Rv3112 protein
    JP2021514392A|2021-06-10|Compositions used as prophylaxis for people at risk of TB infection or as a secondary drug to treat infected TB patients
    Vasconcelos-Junior et al.2009|Limitations of the BCG vaccine and new prophylaxis strategies against human tuberculosis
    Price2016|Pulmonary BCG vaccination for uniform protection against tuberculosis in environmental mycobacteria endemic regions
    KR20150036051A|2015-04-07|Inactivated mycobacteria for oral use in the prevention of tuberculosis
    Sarhan2007|Progress in tuberculosis vaccines development
    Chen2005|Long-Term Protection against Tuberculosis following Vaccination with a Severely Attenuated Double Lysine and Pan...
    同族专利:
    公开号 | 公开日
    WO2015144960A1|2015-10-01|
    ES2549366B1|2016-09-06|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    WO2018006939A1|2016-07-05|2018-01-11|Universidad De Zaragoza|Inactivated tuberculosis vaccine|
    法律状态:
    2016-09-06| FG2A| Definitive protection|Ref document number: 2549366 Country of ref document: ES Kind code of ref document: B1 Effective date: 20160906 |
    优先权:
    申请号 | 申请日 | 专利标题
    ES201430421A|ES2549366B1|2014-03-25|2014-03-25|MUTANT TRIPLE OF THE MYCOBACTERIUM TUBERCULOSIS erp-, phoP- and DIM- COMPLEX|ES201430421A| ES2549366B1|2014-03-25|2014-03-25|MUTANT TRIPLE OF THE MYCOBACTERIUM TUBERCULOSIS erp-, phoP- and DIM- COMPLEX|
    PCT/ES2015/070219| WO2015144960A1|2014-03-25|2015-03-25|Triple mutant of the erp, phop and dim mycobacterium tuberculosis complex|
    [返回顶部]