in vivo synthesis of sialylated compounds

专利摘要:
The present invention is situated in the technical field of synthetic biology and metabolic engineering. more particularly, the present invention is situated in the technical field of fermentation of metabolically modified microorganisms. The present invention describes modified microorganisms capable of synthesizing sialylated compounds via an intracellular biosynthesis pathway. These microorganisms can dephosphorylate n-acetylglycosamine-6-phosphone into n-acetylglycosamine and convert n-acetylglycosamine to n-acetylmannosamine. These microorganisms also have the ability to convert n-acetylmannosamine to n-acetyl neuraminate. In addition, the present invention provides a method for the large-scale in vivo synthesis of sialylated compounds by cultivating a microorganism in a culture medium, which optionally comprises an exogenous precursor such as, but not limited to, lactose, lactonbiosis. n-acetylactosamine and / or an aglycone, wherein said microorganism intracellularly dephosphorylates n-acetylglycosamine-6-phosphone to n-acetylglycosamine, converts n-acetylglycosamine to n-acetylmannosamine and converts the latter to n-acetyl neuraminate.
公开号:BR112019013211A2
申请号:R112019013211
申请日:2017-12-26
公开日:2019-12-10
发明作者:Vercauteren Annelies；Van Herpe Dries；Peters Gert；Beauprez Joeri；Coussement Pieter
申请人:Inbiose N V；
IPC主号:

专利说明:

IN VIVO SYNTHESIS OF SIALYLATED COMPOUNDS [001] The present invention is situated in the technical field of synthetic biology and metabolic engineering. More particularly, the present invention is situated in the technical field of fermentation of metabolically modified microorganisms. The present invention describes modified microorganisms capable of synthesizing sialylated compounds via an intracellular biosynthesis pathway. These microorganisms can dephosphorylate N-acetylglycosamine-6-phosphate to N-acetylglycosamine and convert N-acetylglycosamine to Nacetylmannosamine. These microorganisms also have the ability to convert N-acetylmannosamine to N-acetylneuraminate. In addition, the present invention provides a method for large-scale in vivo synthesis of sialylated compounds, by culturing a microorganism in a culture medium, which optionally comprises an exogenous precursor such as, but not limited to lactose, lacto-N -biosis, Nacetylactosamine and / or an aglycone, wherein said microorganism dephosphorylates intracellularly Nacetylglycosamine-6-phosphate to N-acetylglycosamine, converts N-acetylglycosamine to N-acetylmannosamine and converts the latter to N-acetyl-neuraminate.
Background [002] Sialylated compounds such as sialic acid and sialylated oligosaccharides have gained attention in recent years, due to their wide application range. For example, sialic acid is considered to be an antiviral precursor. Sialylated oligosaccharides form an essential part of human milk and are attributed
Petition 870190058857, of 6/25/2019, p. 10/132
2/106 non-stick and immunomodulating properties; others described that they were involved in brain development. Sialylation, in general, of proteins, lipids or aglycone is used in anticancer drugs and in the treatment of neurological diseases.
[003] Sialic acid is a general term used to describe a large family of acid sugars that are predominantly found on the cell surface of eukaryotic cells. The most common sialic acid is N-acetylneuraminic acid or Neu 5Ac, a nine-carbon acid sugar that undergoes several modifications to generate members of the sialic acid family. As seen, for example, in Figure 1 of document W02008097366, the diversity of the sialic acid family is represented with more than 50 known members. Sialic acid represents a large family of cell surface carbohydrates that are derived from a nine-carbon acid parent compound called N-acetylneuraminic acid or Neu 5Ac. Neu 5Ac is often decorated with acetyl, phosphate, methyl, sulfate and lactyl groups, which are described as being necessary for desirable cell signaling and sialic acid-mediated cell adhesion events.
[004] Sialic acids and sialylated compounds are common in higher eukaryotic organisms that produce them in a conserved Biosynthetic route. This route starts with endogenous UDP-N-acetylglycosamine which is converted to sialic acid through the action of a UDP-Nacetylglycosamine 2-epimerase (hydrolysis) (EC 3.2.1.183), an N-acylmannosamine kinase (EC 2.7.1.60), a Nacylneuraminate-9-phosphate synthase (EC 2.5.1.57) and a
Petition 870190058857, of 6/25/2019, p. 11/132
3/106 phosphatase Neu 5Ac-9-P (EC 3.1.3.29). This sialic acid can subsequently be activated and transferred to the desired acceptor via a CMP sialic acid synthase (EC 2.7.7.43) and, for example, a sialyltransferase.
[005] Efforts have been made to express this Biosynthetic pathway in other eukaryotic organisms, while prokaryotic systems have not been reported. The pathway was functionally expressed in yeast (Pichia pastoris) and plant (Arabidopsis thaliana) to produce sialylated N-glycans. Nevertheless, large-scale production of sialylated oligosaccharides has never been reported. The functional overexpression of eukaryotic genes in prokaryotic systems continues to be a difficult task, with no determined result, due to the lack of specific chaperones, defective enzymatic folding and absent cellular organelles. In addition, the enormous energy requirement of the pathway and the depletion of intercellular UDPGlcNAc (UDP-N-acetylglycosamine), necessary for cell growth, remains.
[006] There are processes based on the enzymatic, chemical and fermentative production of sialylated compounds. However, they all have significant disadvantages. For example, chemical synthesis requires many sequential chemical steps and enzymatic synthesis requires expensive precursors, while the fermentative process is still under strong development. Nevertheless, the latter has the greatest potential for industrial production.
[007] One type of fermentative production process described uses a biosynthesis pathway that originates from prokaryotes such as Campylobacter jejuni that
Petition 870190058857, of 6/25/2019, p. 12/132
4/106 naturally produces sialic acid or sialylated compounds. This biosynthesis route starts from the endogenous UDP-Nacetylglycosamine that cells use for their cell wall. This is converted to N-acetylmannosamine and N-acetylneuraminate by the action of a UDP-Nacetylglycosamine epimerase (usually called neuC) and a sialic acid synthase (usually called neuB).
[008] By using only part of this prokaryotic biosynthesis route, Priem et al. (Glycobiology 12, 2002, 235-240) describe the use of live bacterial cells to produce sialyloligosaccharides. In this method, sialylactose was directly produced by the growth of metabolically modified cells of Escherichia coli strains that overexpressed the genes of Neisseria meningitidis for alpha-2,3-sialyltransferase and for CMP-Neu 5Ac synthase, these strains were still devoid of beta-galactosidase and N- acetylneuraminic acid (Neu 5Ac) aldolase activity. These microorganisms were grown in high cell density with glycerol as a carbon and energy source, while exogenous lactose and Neu 5Ac were provided as precursors for the synthesis of sialylactose. During growth, lactose and Neu 5Ac were internalized by inducing the expression of an E. coli galactoside and an exogenous Neu 5Ac permease. Lactose and Neu 5Ac accumulate in the cytoplasm, where Neu 5Ac was then converted to CMP-Neu 5Ac to be transferred further to lactose to form sialylactose. Large-scale production of sialyloligosaccharides by this microbiological method requires significant amounts of Neu 5Ac as a
Petition 870190058857, of 6/25/2019, p. 13/132
5/106 precursor.
[009] Another microbial system was developed for the production of sialyloligosaccharides without the need for an exogenous supply of sialic acid. Document W02007101862 describes this modality for the production of sialylated oligosaccharides with microorganisms comprising heterologous genes encoding a CMP-Neu 5Ac synthase, a sialic acid synthase, a UDP-GlcNAc-6-phosphate 2-epimerase and a sialyltransferase and in which the endogenous genes encoding silicic acid aldolase (NanA) and for ManNAc kinase (NanK) have been eliminated or inactivated. The use of this prokaryotic biosynthesis route is very energy intensive for the cell. In addition, the pathway described for the production of sialylated oligosaccharides competes with UDP-GlcNAc, which is essential for the peptidoglycan synthesis of the cells themselves. Based on this concept, Kang et al. created a production host that does not use sialic acid synthase, but endogenous sialic acid aldolase, which has a less favorable chemical balance (Metabolic engineering 14, 2012, 623-629).
[0010] EP1484406 describes a production of Neu 5Ac using E. coli which overexpresses N-acetylglycosamine 2-epimerase and Neu 5Ac synthase, but needs N-acetylglycosamine (GlcNAc) as an external precursor. In the method described, GlcNAc needs to be used as such. Therefore, cells in EP1484406 need to be disrupted in such a way that GlcNAc can be used directly by GlcNAc-2-epimerase. As described by Lundgren et al. (Org. Biomol. Chem., 2007, 5, 1903-1909)
Petition 870190058857, of 6/25/2019, p. 14/132
6/106 intact cells convert the GlcNAc that enters Nacetylglycosamine-6-phosphate (GlcNAc-6-P) that will be used by the cell for cell growth. This GlcNAc-6-P is not available intercellularly and cannot therefore be used for GlcNAc-2-epimerase which requires a non-phosphorylated GlcNAc for epimerization in ManNAc. This explains why EP1484406 cell permeabilization is necessary. As explained by Lundgren et al. _r GlcNAc6-P can be used for the production of Neu 5AC, but this requires another synthetic route comprising UDP-GlcNAc as an intermediate, which is described above in document W02007101862. The resulting pathway further increases energy demand compared to that described in the last patent because the GlcNAc uridylation requires extra ATP.
[0011] Deng et al. (Metabolic Engineering 7 (2005), 201-214) describes the production of GlcNAc by means of intracellular production of GlcNAc-6-P which is then efficiently dephosphorylated and secreted into the medium in the form of GlcNAc. According to Deng et al., This dephosphorylation occurs on export, in a more specific way in the periplasm of Escherichia coli. The produced extracellular GlcNAc described in this method is not available for intracellular conversion. This method for producing GlcNAc requires a batch process fed in two phases, that is, a cell growth phase followed by a GlcNAc production phase that is induced only after the culture reaches a high cell density, to minimize the inhibitory effects phosphorylated amino sugars.
Petition 870190058857, of 6/25/2019, p. 15/132
7/106 [0012] Others tried the same by heterologously expressing phosphatases and found the problem of reduced growth and strong metabolic burden (Lee and Oh, Metabolic engineering, 2015, 143-150). The main reason for the referred reduction in the growth / formation of biomass is the non-specificity of the phosphatase that is introduced, which dephosphorylates other essential phosphorylated compounds. Such modifications, therefore, lead to a reduction in physical capacity and lower specific productivity. In addition, it leads to selective pressure to change the production path during production, which reduces the overall stability of the process.
[0013] The pathways of production of sialic acid and sialylated oligosaccharides require the formation of high levels of phosphorylates (for example, GlcNAc-6-P) and intermediates of the nucleotide pathway. It is commonly understood that such formation leads to a specific degradation of these intermediates by the activation of specific phosphatases, which in turn lead to a reduction in fitness. To circumvent the effect of the expression of metabolic pathways on the growth of production hosts, it is standard to use expression systems susceptible to induction. In this method, the first biomass is formed and, later, in the production process, the production path is activated, for example, by the IPTG. This was applied by third parties for the production of sialic acid and sialylated oligosaccharides (W02007101862; Priem et al., Glicobiology 12, 2002, 235-240; Kang et al., Metabolic engineering 14, 2012, 623-629; Yang et al. , Metabolic engineering 43, 2017, 21-28). In addition to losing productivity and title, another disadvantage in using
Petition 870190058857, of 6/25/2019, p. 16/132
8/106 inducible systems is the excretion of intermediate pathway metabolites, such as GlcNAc and ManNAc. This leads to the requirement for additional processing steps downstream for purification, therefore, a higher production cost in the production of sialic acid, sialylactose or other sialylated compounds.
[0014] The methods for the production of sialylated compounds, discussed previously in the present case, are still insufficient to meet the great demand of the biotechnological, pharmaceutical and medical sectors. A metabolic engineering approach that successfully overcomes the problems mentioned above would represent a significant and long-awaited breakthrough in the field of technique.
SUMMARY [0015] Surprisingly, the inventors were able to create a delivery path that does not require induction, and does not require a UDP-GlcNAc epimerase epimerase, but allows for constitutive expression that also allows for better tuning of the metabolic path by improving production and reducing formation of by-products during the production process.
[0016] According to an embodiment of the present invention, there is provided a method for the production of sialylated compounds with microorganisms that do not require induction.
[0017] According to another embodiment of the present invention, a production pathway is provided which does not require a UDP-GlcNAc epimerase, and which comprises modulating the expression of phosphatase which does not represent a metabolic load for the cell as shown
Petition 870190058857, of 6/25/2019, p. 17/132
9/106 previously in the field of technique. The other said embodiment of the present invention also provides for increased sialylated compound production by modulating phosphatase expression.
[0018] According to another embodiment, the aforementioned process, when combined with the constitutive expression of genes in the metabolic pathway, also allows for better tuning of the metabolic pathway by reducing the formation of by-products during the production process.
DESCRIPTION [0019] The present invention describes an economic, more efficient and alternative way for the production of the production of sialylated compounds using microorganisms.
[0020] The present invention provides a method of producing sialylated compounds by the fermentative growth of microorganisms.
[0021] In particular, the invention relates to a method for the production of sialylated compounds, in which the method comprises culturing a microorganism in a culture medium. The microorganism converts the following reactions intracellularly: N-acetylglucosamine-6-phosphate to Nacetylglucosamine, N-acetylglucosamine to Nacetylmannosamine and N-acetylmannosamine to N-acetylneuraminate. In addition, this microorganism is unable to:
i) converting N-acetylglycosamine-6-P to glycosamine-6-P, ii) converting N-acetylglycosamine to N-acetylglycosamine-6P and iii) converting N-acetyl-neuraminate to N-acetyl mannosamine.
[0022] Preferably, the conversion of N
Petition 870190058857, of 6/25/2019, p. 18/132
10/106 acetylglycosamine-6-phosphate in N-acetylglycosamine is obtained by the action of a phosphatase expressed intracellularly. According to another preferred embodiment, Nacetylglycosamine is converted to N-acetylmannosamine by an intracellularly expressed N-acetylmannosamine epimerase. According to a preferred alternative embodiment, N-acetylmannosamine is converted by means of an intracellular sialic acid synthase expressed in N-acetyl-neuraminate. Even more preferably, the microorganism comprises all three enzymes in such a way that the microorganism converts i) Nacetylglycosamine-6-phosphate into N-acetylglycosamine by the action of a phosphatase expressed intracellularly, ii) Nacetylglycosamine in N-acetylmannosamine by an intracellular expression N-acetylmannosamine epimerase; and iii) Nacetylmannosamine to N-acetyl-neuraminate by means of an expressed intracellular sialic acid synthase.
[0023] Preferably, the microorganism used in the embodiment of the invention is unable to produce the following enzymes i) an N-acetylglucosamine-6-phosphate deacetylase, ii) an N-acetylglucosamine kinase and iii) an aldolase N-acetylneuraminate .
[0024] The present invention also provides a microorganism that expresses i) a phosphatase to dephosphorylate N-acetylglycosamine-6-phosphate into Nacetylglycosamine (EC 3.1.3.), Ii) a GlcNAc-2-epimerase to convert N-acetylglycosamine (GlcNAc ) in Nacetylmannosamine (manNac) (CE 5.1.3.8) and iii) a sialic acid synthase to synthesize N-acetylneuraminate (Neu 5Ac) from N-acetylmannosamine
Petition 870190058857, of 6/25/2019, p. 19/132
11/106 (ManNAc) (EC 2.5.1.56). In addition, this microorganism is unable to: i) convert N-acetylglucosamine-6-P to glucosamine-6-P, ii) convert N-acetylglucosamine to Nacetylglucosamine-6-P, and iii) convert N-acetylneuraminate for N-acetyl mannosamine.
[0025] According to one aspect, the invention provides a microorganism that is capable of catalyzing the following reactions: the intracellular conversion of Nacetylglycosamine-6-phosphate to N-acetylglycosamine, the
intracellular conversion of N-acetylglucosamine in N- acetylmannosamineconversion intracellular in N- acetylmannosamine in sialic acid. [0026] IS usually I accept that The N-
acetylglucosamine-6-phosphate is naturally efficiently excreted out of the cell and meanwhile dephosphorylated by phosphatases in the periplasm (see p. 212, second column, Deng et al., Metabolic Engineering 7 (2005), 201 -214). Therefore, without the present invention, this excreted product would be unavailable for conversion to sialic acid. In addition, re-internalization occurs through carrier proteins that phosphorylate Nacetylglucosamine.
[0027] The use of an intracellular N-acetylglucosamine-2epimerase ensures less energy consumption (ATP) than the classic prokaryotic route (via UDP-Nacetylglucosamine). This allows for a more efficient production of sialic acid, sialylated oligosaccharides and / or sialylated products with a healthier and more efficient strain. By improving expression levels, the unfavorable chemical balance is overcome and
Petition 870190058857, of 6/25/2019, p. 20/132
12/106 large amounts of free N-acetylglucosamine are required, as in the literature. In fact, in the art, this enzyme is only used in enzymatic reactions that use high concentrations of N-acetylglucosamine to produce N-acetylmannosamine. It would therefore be logical that the use of an epimerase would require large amounts of intracellular GlcNAc formed that was shown to be released into the medium (see Deng as described above), however, the present invention proved that this can be avoided. Another advantage of the present invention over enzymatic methods, is that inexpensive substrates can be used in the present invention, such as, for example, a monosaccharide such as, for example, glucose,
galactose or fructose one disaccharide such how, per example, sucrose or maltose or a polyol , such how, but not limited a, glycerol. This allows one method in
economical production by fermentation.
[0028] Different phosphatases (EC 3.1.3) that convert N-acetylglucosamine-6-phosphate to Nacetylglucosamine are described in the art and can be used in the present invention. The phosphatases of the HAD superfamily and the HAD-type family are described in the art. Examples of these families can be found in the enzymes expressed in the genes yqaB, inhX, yniC, ybiV, yidA, ybjl, yigL or cof of Escherichia coli. A phosphatase that catalyzes this reaction is identified in Blastocladiella emersonii. Phosphatases are generally specific and the activity is generally not related to family or structure. Other examples can therefore be found in all phosphatase families. Specific phosphatases
Petition 870190058857, of 6/25/2019, p. 21/132
13/106 are easily identified and tracked using well-known methods, such as described by Fahs et al.
(ACS Chem. Biol., 2016, 11 (11), 2944-2961).
[0029] Preferably, the phosphatase of the present invention is a phosphatase similar to HAD. A HAD-like phosphatase as defined herein refers to any phosphatase polypeptide comprising: - any one or more of the following reasons as defined below:
Reason 1: hDxDx [TV] (SEQ ID NO: 73), or
Reason 2: [GSTDE] [DSEN] x (1-2) [hP] x (l-2) [DGTS] (SEQ ID NOs: 74, 75, 76, 77) where h means a hydrophobic amino acid (A, I, L, M, F, V, P, G) and x can be any distinct amino acid.
[0030] According to another preferred embodiment, HAD-like polypeptides typically have an increasing order of preference at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88% , 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% of the global sequence identity with any of the polypeptides represented by SEQ ID NOs: 43 , 44, 45, 47, 48, 50, 51, 52, 54, 55 or 57. Preferably, these polypeptides also comprise at least one of the aforementioned motifs. Most preferably, they understand both Reasons.
[0031] The identity of the global sequence is determined using a global alignment algorithm, such as the Needleman Wunsch algorithm in the GAP program (GCG Wisconsin Package, Accelrys), preferably with standard parameters and preferably with mature protein sequences (or that is, without taking into account signs of
Petition 870190058857, of 6/25/2019, p. 22/132
14/106 secretion or transit peptides). In comparison to the overall identity of the sequence, the identity of the sequence will generally be higher when only conserved domains or motifs are considered.
[0032] According to a preferred embodiment, the HAD-like polypeptide comprises any of SEQ ID NOs: 43, 44, 45, 47, 48, 50, 51, 52, 54, 55 or 57.
[0033] According to another preferred embodiment, phosphatase is selected from the HAD superfamily or from the HAD-like phosphatase family. Most preferably, phosphatase is selected from the group comprising: i) enzymes expressed by means of the yqaS, inhX, yniC, ybiV, yidA, ybjl, yigL or cof genes from Escherichia coli, ii) Blastocladiella phosphatase emersonii and iii) other phosphatase families.
[0034] Examples of N-acetyl-D-glycosmin-2epimerase (EC 5.1.3.8) can be found in prokaryotes and eukaryotes. Examples for prokaryotes are found in cyanobacteria such as, for example, Acaryochloris marina, Anabaena variabilis, Anabaena marina, Nostoc punctiforme, Acaryochloris species, Anabaena species, Nostoc species and Synechocystis species. They are also found in Bacteroid species such as, for example, Bacteroids ovatus and Bacteroids thetaiotaomicron and in Capnocytophaga canimorsus and Mobiluncus mulieris. In eukaryotics, N-acetyl-Dglycosmin-2-epimerase is found in Glycin max, Mus musculus, Homo sapiens, Rattus norvegicus, Bos Taurus, Sus
Petition 870190058857, of 6/25/2019, p. 23/132
10/15 scrofa, Canis lupus. Preferably, in the method and microorganism of the present invention, N-acetylmannosamine-2-epimerase is selected from the group comprising i) N-acetylmannosamine-2-epimerase from cyanobacteria, with greater particularity from Acaryochloris marina, Anabaena variabilis, Anabaena marina, Nostoc punctiforme, Acariocloris species, Anabaena species, Nostoc species and Synechocystis species; ii) N-acetylmannosamine-2-epimerase from Bacteroides species, with greater particularity from Bacteroides ovatus, Bacteroides thetaiotaomicron, Capnocytophaga canimorsus and Mobiluncus mulieris; iii) Nacetyl-D-glucosamine-2-epimerase from Glycin max, Mus musculus, Homo sapiens, Rattus norvegicus, Bos Taurus, Sus scrofa or Canis lupus.
[0035] N-acetyl-neuraminate synthase (also called in the sialic acid synthase technique) activity (EC 2.5.1.56) is found in several prokaryotic organisms such as, for example, Streptococcus agalatiae, Bacillus subtilis, Legionella pneumophilla, Campylobacter jejuni, Idiomarina loihiensis, Moritella viscosa, Aliivibrio salmonicida, Escherichia coli, Methanocaldococcus jannaschi, Clostridium sordellii, Butyrivibrio proteoclasticus, Micromonas commoda or Neisseria meningitis. Preferably, in the method and microorganism of the invention, sialic acid (or N-acetyl neuraminate) synthase is selected from the group comprising: sialic acid synthase from Streptococcus agalatiae, Bacillus subtilis, Legionella pneumophilla, Campylobacter jejuni, Idiomarina loihiensis, Moritella viscosa, Aliivibrio salmonicida, Escherichia
Petition 870190058857, of 6/25/2019, p. 24/132
16/106 coll, Methanocaldococcus jannaschi, Clostridium sordellii, Butyrivibrio proteoclasticus, Micromonas commoda or Neisseria meningitis.
[0036] According to a preferred aspect, any one or more of the phosphatase, N-acetylmannosamine and sialic acid epimerase is overexpressed in the microorganism. According to an alternative preferred aspect, any one or more of the phosphatase, the Nacetylmannosamine epimerase and the sialic acid synthase is introduced and expressed in the microorganism.
[0037] According to another aspect, the microorganism lacks the genes encoding the following enzymes i) an N-acetylglucosamine-6 phosphate deacetylase, ii) an N-acetylglucosamine kinase and iii) an N-acetylneuraminate aldolase. According to another preferred aspect, the genes encode the following enzymes i) an N-acetylglycosamine-6-phosphate deacetylase, ii) an N-acetylglycosamine kinase and iii) an N-acetylneuraminate aldolase are reduced in activity, preferably said genes are eliminated or knocked out in the microorganism.
[0038] According to another preferred aspect, the microorganism also encodes a protein that facilitates the uptake of lactose and lacks enzymes that metabolize lactose. Methods for producing microorganisms that resist lactose death and the resulting microorganisms are described in WO2016 / 075243 which is included by reference in the present case.
[0039] According to a preferred aspect, the microorganisms of the invention and used in the method thereof
Petition 870190058857, of 6/25/2019, p. 25/132
17/106 also express a sialic acid-CMP synthase (EC 2.7.7.43) and a sialyl transferase (EC 2.4.99.1) in order to activate sialic acid. and transfer it to a desired compound.
[0040] According to a preferred aspect, N-acetylglycosamine-6-phosphate is obtained by introducing a glucosamine-phosphate Nacetyltransferase (EC 2.3.1.4) which uses intracellular glycosamine-6 phosphate as a substrate. In most microorganisms, glucosamine-6-phosphate is naturally present in the cell, but intracellular production may be elevated through the expression of an uninhibited L-glutamine: D-fructose-6-phosphate aminotransferase, obtained through engineering of proteins or by screening for natural enzymes, such as present in gram-positive bacteria (Deng et al., Metabolic Engineering 7 (2005), 201-214).
[0041] In the present invention, the expression of the genes to convert N-acetylglycosamine-6-phosphate to Nacetyl-neuraminate or sialic acid is improved in order to allow intracellular dephosphorylation of Nacetylglycosamine-6-phosphate, preventing the toxic accumulation of N- acetylglycosamine-6-phosphate and prevents the excretion of Nacetylglucosamine and / or N-acetylmannosamine. This improvement is the result of using the constitutive expression of genes in the production pathway. According to a preferred embodiment, the present invention prevents the excretion of at least 10%, 20%, 30%, 35%, 40%, 45%, 50% or 60% of the formed N-acetylglucosamine and / or N-acetylmannosamine . According to another preferred embodiment, the
Petition 870190058857, of 6/25/2019, p. 26/132
18/106 microorganism produces less extracellular N-acetylglucosamine and / or N-acetylmannosamine than the sialylated compound. More preferably, the microorganism produces less than 50%, 40%, 30%, 20%, 10%, 5%, 2% of extracellular N-acetylglucosamine and / or N-acetylmannosamine than the sialylated compound. According to another preferred embodiment of the present invention, the microorganism produces an extracellular sialylated compound equal to or greater than 50%, 60%, 70%, 80%, 90%, 95%, 98% in total extracellular carbohydrate.
[0042] According to a particular aspect, the invention relates to a method for the synthesis of sialylated compounds, without any addition of exogenous sialic acid to the culture medium.
[0043] The sialylated compound may be Nacetylneuramic acid, a sialylated oligosaccharide, a sialylated oligosaccharide, a sialylated lipid, sialylated glycolipids (such as, but not limited to, gangliosides, ceramides), a sialylated protein or a sialylated aglycone .
[0044] A sialylated oligosaccharide is an oligosaccharide that contains charged sialic acid, that is, an oligosaccharide with a sialic acid residue. It is endowed with an acidic nature. Some examples are comprised of 3-SL (3-sialillactose), 3-sialillactosamine, 6-SL (6-sialillactose or nacetylneuraminate alpha 2,6 galactosyl beta 1,4 Glucose), 6sialillactosamine, oligosaccharides comprising 6 sialyl lactose, SGG hexassaccharide (Neu 5Ac alpha-2,3Gal beta -1,3 GalNac beta -1,3Gala-1, 4Gal beta-1, 4Gal), sialylated tetrasaccharide (Neu 5Ac-alpha-2,3Gal beta
Petition 870190058857, of 6/25/2019, p. 27/132
19/106 l, 4GlcNAc beta -14GlcNAc), LASD pentasaccharide (Neu 5Ac alpha-2,3Gal beta-1, 4GlcNAc beta-1, 3Gal beta-1, 4Glc), sialylated, sialylated lacto-N- lacto-N-triosis tetraose, siallyl-N-neotetraose, monosiallyl-N-hexaose, disiallylate-N-hexaose I, mono-sialillato-N-neohexaose I, monosialylate-N-neohexaose II, disialylacto-N-neohexaose, disialylacto-N-tetraose, dysialylactoato N-hexaose II, siallyl-N-tetraose a, disialylate-N-hexaose I, siallylate-N-tetraose b, 3-sialyl-3-fucosylactose, disialomono fucosylate-N-neohexaose, monofucosyl monosialylate-N-octaose (sialyl Lea ), siallylate-Nfucohexaose II, disialylate-N-fucopentaose II, monofucosyldisialylate-N-tetraose and oligosaccharides with one or more residues of sialic acid, which includes, but is not limited to: portions of oligosaccharides from the selected gangliosides to from GM3 (3sialylactose, Neu 5Aca-2,3Gal beta-4Glc) and oligosaccharides comprising the motif GM3, GD3 Neu 5Aca-2,8N eu 5Aca-2,3Gal beta-1, 4Glc GT3 (Neu 5Aca-2,8 Neu 5Aca-2,8 Neu 5Aca-2,3Gal beta-1, 4Glc); GM2 GalNAc beta 1,4 (Neu 5Aca-2,3) Gal beta -l, 4Glc, GM1 Gal beta -l, 3GalNAc beta -1,4 (Neu 5Aca-2,3) Gal beta -l, 4Glc, GDla Neu 5Aca2,3Gal beta-1, 3GalNAc beta -1,4 (Neu 5Aca-2,3) Gal beta 1, 4Glc GTla Neu 5Aca-2,8Neu 5Aca-2,3Gal beta -l, 3GalNAc beta -1,4 (Neu 5Aca-2,3) Gal beta -l, 4Glc GD2 GalNAc beta 1,4 (Neu 5Aca-2,8Neu 5Aca2,3) Gal beta -l, 4Glc GT2 GspalNAc beta -1,4 (Neu 5Aca-2,8Neu 5Aca -2,8Neu 5Aca2,3) Gal beta l, 4Glc GDlb, Gal beta -l, 3GalNAc beta -1,4 (Neu 5Aca-2,8Neu 5Aca2,3) Gal beta -l, 4Glc GTlb Neu 5Aca-2,3Gal beta -1.3 GalNAc beta -1.4 (Neu 5Aca-2.8Neu 5Aca2.3) Gal beta-l, 4Glc
Petition 870190058857, of 6/25/2019, p. 28/132
10/20
GQlb Neu 5Aca-2,8 Neu 5Aca-2,3Gal beta -l, 3GalNAc beta 1,4 (Neu 5Aca-2,8Neu 5Aca2,3) Gal beta -l, 4Glc GTlc Gal beta -l, 3GalNAc beta -1, 4 (Neu 5Aca-2,8Neu 5Aca-2,8Neu 5Aca2,3) Gal beta -l, 4Glc GQlc, Neu 5Aca-2,3Gal beta l, 3GalNAc beta -1,4 (Neu 5Aca-2,8Neu 5Aca-2 , 8Neu 5Aca2,3) Gal beta -l, 4Glc GPlc Neu 5Aca-2,8Neu 5Aca-2,3Gal beta 1, 3GalNAc beta -1,4 (Neu 5Aca-2,8Neu 5Aca-2,8Neu 5Aca2,3) Gal beta-l, 4Glc GDla Neu 5Aca-2,3Gal beta -1,3 (Neu 5Aca2,6) GalNAc beta -l, 4Gal beta -l, 4Glc Fucosyl-GMl Fucal, 2Gal beta -l, 3GalNAc beta -1,4 (Neu 5Aca-2,3) Gal beta 1, 4Glc; which can all be extended to produce the corresponding gangliosides, by reacting the aforementioned oligosaccharide portions with ceramide or synthesizing the aforementioned oligosaccharides in a ceramide.
[0045] The term microorganism or organism or cell as indicated above refers to a microorganism selected from the list comprising a bacterium, yeast or fungus, or, it refers to a plant or animal cell. The last bacterium preferably belongs to the phylum of Proteobacteria or the phylum of Firmicutes or phylum of Cyanobacteria or the phylum Deinococcus-Thermus. The last bacterium belonging to the phylum Proteobacteria preferably belongs to the family Enterobacteriaceae, preferably to the species Escherichia coli. The latter bacterium preferably refers to any strain belonging to the species Escherichia coli such as, but not limited to Escherichia coli B, Escherichia coli C, Escherichia coli W, Escherichia coli K12, Escherichia coli Nissle. More specifically, the latter term refers to strains of Escherichia coli grown Petition 870190058857, dated 06/25/2019, p. 29/132
10/21
designated how strains in E. coli K12 - that are good adapted to the environment laboratory and, to contrary of strains of type wild, They lost The your capacity in
thrive in the gut. Well-known examples of the E. coli K12 strains are wild type K12, W3110, MG1655, M182, MC1000, MC1060, MC1061, MC4100, JM101, NZN111 and AA200. For that reason, the present invention relates specifically to a mutated and / or transformed Escherichia coli strain as indicated above, wherein said E. coli strain is a K12 strain. More specifically, the present invention relates to a mutated and / or transformed Escherichia coli strain as previously indicated in which said K12 strain is comprised of E. coli MG1655. This last bacterium belonging to the phylum Firmicutes preferably belongs to Bacilli, preferably Lactobacilliales, with members such as Lactobacillus lactis, Leuconostoc mesenteroid.es, or Bacillales with members such as Bacillus, Bacillus subtilis or B. amyloliquefaciens. This last bacterium belongs to the bacterial actin, preferably belonging to the family of Corynebacteriaceae, with members Corynebacterium glutamicum or C. afermentans, or belonging to the family of Streptomycetaceae with members Streptomyces griseus or S. fradiae. The latter yeast preferably belongs to the phylum of the Ascomycota or the phylum of the Basidiomycota or the phylum of the Deuteromycota or the phylum of the zygomycetes. The latter yeast belongs preferably to the genus Saccharomyces, Pichia, Hansenula, Kluyveromyces, Yarrowia or Starmerella. The latter fungus preferably belongs to the genera Rhizopus, Dictyostelium,
Petition 870190058857, of 6/25/2019, p. 30/132
10/22
Penicillium, Mucor or Aspergillus.
[0046] The culture medium for the production host can optionally comprise an exogenous precursor or this precursor can be produced by the strain itself, such as a glycan such as lactose, lactosamine, lacto-N-triose, lacto-N-tetraose , lacto-N neotetraose; an oligosaccharide; a peptide; a lipid or an aglycone. According to a particular aspect, the process of the invention is based on the active absorption of an exogenous precursor, such as, for example, a mono-, di- or tri-saccharide, more particularly an exogenous precursor selected from lactose, N- acetylactosamine, lactoN -biosis, galactose, beta-galactoside and alpha-galactoside, such as, but not limited to, globotriose (Gal-alpha1,4Gal-beta-1, 4Glc), while microorganisms are growing on an inexpensive substrate of carbon, such as disaccharide such as sucrose or maltose. In addition, these microorganisms are also capable of growing in glucose, fructose or glycerol. The expression exogenous precursor is intended to mean a compound involved in the biosynthetic pathway of the product according to the invention that is internalized by the microorganism.
[0047] According to one aspect, the invention provides the method for the production of sialylated forms of lacto-N-triose, lacto-N-tetraose or lacto-N-neotetraose. Any of these three molecules is synthesized by the microorganism through the activity of a galactosyltransferase (EC 2.4.1.38), preferably from the group comprising Homo sapiens, Bos
Petition 870190058857, of 6/25/2019, p. 31/132
23/106 taurus, Mus mulatta, Gallus gallus, Danio rerio, Helicobacter pylori and Haemophilus ducrey and / or a Nacetylglycosaminyltransferase (EC 2.4.1.90) originating preferably from the group comprising Bos Taurus, Homo Sapiens and Mus Mususus. To enhance the formation of these oligosaccharides, the genes that encode UDP-sugar-hydrolase and galactose-1-phosphatouridylyltransferase are missing, reducing in activity or knocked out in the microorganism.
[0048] According to another aspect there is provided a method for producing a sialylated oligosaccharide in which the method comprises cultivating a microorganism as previously described in the present case and in which the microorganism produces internally, activated Nacetylneuraminate as a donor substrate for a sialyltransferase; and wherein the method further comprises culturing the microorganism in a culture medium comprising an exogenous precursor selected from the group consisting of lactose, N-acetylactosamine, lacto-Nbiose, galactose, beta-galactoside and alpha-galactoside, such as, being that it is not limited to the same lobotriosis (Gal-alpha-1,4Gal-beta-1, 4Glc) galactose. The exogenous precursor is actively absorbed in the microorganism and the exogenous precursor is the accepting substrate of sialyltransferase for the production of sialylated oligosaccharide.
[0049] According to yet another aspect, the method according to the invention provides for the production of 3 sialylactose or 6 sialylactose. In this method, the microorganism is grown in high cell density in a
Petition 870190058857, of 6/25/2019, p. 32/132
24/106 carbon substrate, such as glucose or glycerol, and fed with lactose. Lactose is internalized by lactose-permease and sialylated by recombinant sialyltransferase using CMP-N-acetyl-neuraminate generated endogenously from N-acetylglycosamine.
[0050] The microorganism or cell of the invention is capable of growing in a monosaccharide, disaccharide, oligosaccharide, polysaccharide, polyol, a complex medium or a mixture of these as the main source of carbon. The main term means the most important carbon source for the formation of biomass, formation of carbon dioxide and / or by-products (such as acids and / or alcohols, such as acetate, lactate and / or ethanol), that is , 20, 30, 40, 50, 60, 70, 75, 80, 85, 90, 95, 98, 99% of all required carbon is derived from the carbon source indicated above. According to one embodiment of the invention, said carbon source is the only carbon source for said organism, that is, 100% of all required carbon is derived from the carbon source indicated above in the present case.
[0051] According to a preferred embodiment, the microorganism or cell of the invention uses a split metabolism that is endowed with a production pathway and a biomass pathway as described in document W02012 / 007481, which is included in this context by reference. Said organism can, for example, be genetically modified to accumulate fructose-6-phosphate by altering the genes selected from the phosphoglycoisomerase gene, phosphofrutokinase gene, fructose-6-phosphate aldolase gene, fructose isomerase gene and / or
Petition 870190058857, of 6/25/2019, p. 33/132
25/106 fructose: PEP phosphotransferase gene.
[0052] With the term monosaccharide is meant a sugar that is not decomposable into simpler sugars by hydrolysis, is classed as either an aldose or ketose, and contains one or more hydroxyl groups per molecule. Examples are glucose, fructose, galactose, mannose, ribose and / or arabinose.
[0053] With the term disaccharide is meant a sugar that is composed of two monosaccharides that are chemically linked. Examples are maltose, sucrose, lactose, trehalose, cellobiosis and / or chitobiosis.
[0054] The term oligosaccharide means a sugar that is composed of three to ten monosaccharides that are chemically linked. Examples are: maltotriose, fructooligosaccharides, galactooligosaccharides, mannan oligosaccharides, isomaltooligosaccharides, human milk oligosaccharides, and / or glycooligosaccharides.
[0055] The term polyol is understood to mean an alcohol containing multiple hydroxyl groups. For example, glycerol, sorbitol, or mannitol.
[0056] The term complex means a medium for which the exact constitution is not determined. Examples are comprised of molasses, corn steeping liquor, peptone, tryptone or yeast extract.
[0057] The production of sialylated compounds can be increased by adding precursors to the medium, such as N-acetylglusosamine, N-acetylmannosamine, glutamine, glutamate, phosphoenolpyruvate and / or pyruvate.
[0058] The sialylated compounds produced in the method of the invention as described above can
Petition 870190058857, of 6/25/2019, p. 34/132
26/106 can be recovered using various methods, or a combination of them, as are known in the art. Depending on the sialylated compound produced, the compound is available in the extracellular fraction or retained in the cells. When the produced sialylated compound is retained in the cells, the sialylated compound will first be released from the cells by cell disruption. Again, depending on the sialylated compound produced, cells can be separated from the extracellular fraction. In the other case, the cells are disrupted without first separating the extracellular fraction, in which the cells are disrupted by techniques such as, but not limited to, heating, freezing, thawing and / or shear stress through sonication, mixing and / or press French. The extracellular and / or intracellular fraction can be separated from cells and / or cellular debris by means of centrifugation, filtration, microfiltration and nanofiltration. Flocculating agents can be used to assist in product separation. The sialylated compounds in the extracellular or intracellular fraction can be extracted by means of ion exchange, ultra or nanofiltration or electrodialysis, chromatography such as exclusion by dimension, ion chromatography and simulated moving bed. Another example of filtration of the sialylated compounds of the liquid phase is understood by filtration using a deep bed filter with cotton and activated carbon or carbon filter, where after the permeate it is passed through a carbon polisher followed for example, by a 0.2 micron microfiltration membrane system to remove color, microorganisms and suspended carbon particles. In
Petition 870190058857, of 6/25/2019, p. 35/132
27/106 then, the sialylated compound can be concentrated in a vacuum evaporator to obtain a concentrate. The concentrate can be precipitated and / or subjected to drying by heating drying, spray drying and / or lyophilization to obtain a high purity sialylated compound. An amorphous powder can then be obtained. This amorphous powder can further be crystallized to obtain a crystalline sialylated compound.
[0059] In the exemplary embodiment, the sialylated compounds can be isolated from the culture medium using modalities known in the art for fermentations. For example, cells can be removed from the culture medium by means of centrifugation, filtration, flocculation, decantation or the like. Then, the sialylated compounds can be isolated from the extracellular fraction using methods such as ion exchange. Further purification of said sialylated compounds can be achieved, for example, by nanofiltration or ultrafiltration or ion exchange to remove any DNA, protein, LPS (endotoxins) or other remaining impurities.
[0060] According to another exemplary embodiment, Sialylactose can be isolated from the culture medium using methods known in the art for fermentations. For example, cells can be removed from the culture medium by centrifugation, filtration, flocculation, decantation or the like. Then, sialylactose can be isolated from the extracellular fraction using methods such as ion exchange. Further purification of the said sialyl-lactose can
Petition 870190058857, of 6/25/2019, p. 36/132
28/106 can be achieved, for example, by nanofiltration or ultrafiltration or ion exchange to remove any DNA, protein, LPS (endotoxins) or other remaining impurity. Another stage of purification and formulation is carried out by crystallization or precipitation of the product. Another step of the formulation is to spray dry or lyophilize the sialyl-lactose.
[0061] The sialylated compound may contain a counterion, such as a monovalent ion, such as a proton, sodium, potassium ion, a divalent ion, such as calcium magnesium, iron or a trivalent ion such as iron, or a combination of ions.
[0062] Throughout the presentation of this report, the terms sialic acid, N-acetyl neuraminate and N-acetyl neuraminic acid are used interchangeably.
[0063] As used in the present case, the term intracellular or intracellular in for example, intracellular conversion, intracellular production, intracellularly expressed, formed intracellular should be understood as meaning within the cell of the microorganism. The term extracellular should be understood as meaning outside the cell.
[0064] Other definitions are used throughout this report.
Homologue (s) [0065] Homologues of a protein include peptides, oligopeptides, polypeptides, proteins and enzymes that are endowed with substitutions, deletions and / or insertions of amino acids in relation to the unmodified protein in question and having biological activity and
Petition 870190058857, of 6/25/2019, p. 37/132
29/106 functional similar to that of the unmodified protein from which they are derived.
[0066] A deletion refers to the removal of I, or, z amino acids from a protein.
[0067] An insertion refers to one or more amino acid residues that are introduced at a predetermined site on a protein. The inserts can comprise N-terminal and / or C-terminal fusions, as well as intra-sequential insertions of single or multiple amino acids. In general, insertions within the amino acid sequence will be smaller than N or C-terminal fusions, on the order of about 1 to 10 residues. Examples of N- or Cterminal fusion proteins or peptides include the binding domain or activation domain of a transcription activator as used in the yeast two hybrid system, phage coat proteins, (histidine) -6-markers, glutathione-S-transferase-tag, protein A, maltose-binding proteins, dihydrofolate reductase, 100-tag epitope, c-mic epitope, FLAG (R) epitope, lacZ, CMP (calmodulin-binding peptide) , HA epitope, protein C epitope and VSV epitope.
[0068] A substitution refers to the replacement of peotein amino acids by other amino acids that are endowed with similar properties (such as similar hydrophobicity, hydrophilia, antigenicity, propensity to form or break helical structures or structures of beta leaves). Amino acid substitutions are typically from single residues, but can be grouped depending on the functional restrictions placed on the
Petition 870190058857, of 6/25/2019, p. 38/132
30/106 polypeptide and can vary from 1 to 10 amino acids; insertions will generally be on the order of about 1 to 10 amino acid residues. Amino acid substitutions are preferably conservative amino acid substitutions. Conservative substitution tables are well known in the art (see, for example, Creighton (1984) Proteins. W. H. Freeman and Company (Eds) and Table 1 below).
Table 1: Examples of conserved amino acid substitutions
Residue SubstitutionsConservatives Residue SubstitutionsConservatives Allah To be Read Ile; Go Arg Lys Lys Arg; Gin Asn Gin; His Met Read; Ile Asp Glu Phe Met; Read; Tyr Gin At, To be Thr; Gly Cys To be Thr To be; Go Glu Asp Trp Tyr Gly Pro Tyr Trp; Phe His Asn; Gin Go Ile; Read Ile Read; Go
[0069] Amino acid substitutions, deletions and / or insertions can be carried out promptly using synthetic peptide techniques widely known in the art, such as synthesis of solid phase and similar paptides, or by manipulation of recombinant DNA. Methods for manipulating DNA sequences to produce variants of substitution, insertion or deletion of a protein are well known in the art. For example, techniques for making substitution mutations at predetermined locations in DNA are well known to those skilled in the art and include M13 mutagenesis,
Petition 870190058857, of 6/25/2019, p. 39/132
31/106 17-Gen mutagenesis in vitro (USB, Cleveland, OH), mutagenesis by QuickChange Site Directed (Stratagene, San Diego). , CA), site-directed mutagenesis mediated by PCR or other mutagenesis protocols.
Derivatives [0070] Derivatives include peptides, oligopeptides, polypeptides that can, in comparison with the amino acid sequence of the naturally occurring form of the protein, such as the protein of interest, comprise substitutions of amino acids for non-naturally occurring amino acid residues, or additions of non-naturally occurring amino acid residues. Derivatives of a protein also include peptides, oligopeptides, polypeptides that comprise naturally occurring residues (glycosylated, acylated, prenylated, phosphorylated, myristoylated, sulfated, and so on) or unnaturally altered amino acid residues compared to the amino acid sequence of a naturally occurring form of the polypeptide. A derivative may also comprise one or more non-amino acid substituents or additions compared to the amino acid sequence from which, for example, a reporter molecule or other ligand, covalently or non-covalently linked to the amino acid sequence, such as a reporter molecule is derived which is linked to facilitate its detection, and non-naturally occurring amino acid residues in relation to the amino acid sequence of a naturally occurring protein. In addition, derivatives also include fusions of the naturally occurring form of the protein with tagging peptides such as FLAG, HIS6 or thioredoxin (for a review of peptides from
Petition 870190058857, of 6/25/2019, p. 40/132
32/106 marking), see Terpe, Appl. Microbiol. Biotechnol. 60, 523-533, 2003).
Orthologist (s) / Paralog (s) [0071] Orthologists and parallels cover evolutionary concepts used to describe the ancestral relationships of genes. Parallels are genes within the same species that originated by duplicating an ancestral gene; orthologists are genes from different organisms that originated through speciation, and are also derived from a common ancestral gene.
Domain, Reason / Consensus Sequence / Signature [0072] The term domain refers to a set of amino acids conserved in specific positions along an alignment of evolutionarily related protein sequences. Although amino acids in other positions may vary between homologues, amino acids that are highly conserved in specific positions indicate amino acids that are likely to be essential in the structure, stability or function of a protein. Identified by their high degree of conservation in aligned sequences of a family of protein homologues, they can be used as identifiers to determine whether any polypeptide in question belongs to a family of previously identified polypeptides.
[0073] The term motif or consensus or signature sequence refers to a short region conserved in the sequence of evolutionarily related proteins. The grounds are often highly conserved parts of domains, but they can also include only part of the domain or be located outside
Petition 870190058857, of 6/25/2019, p. 41/132
33/106 conserved domain (if all amino acids in the motif are outside a defined domain) _.
[0074] There are specialized databases for the identification of domains, for example, SMART (Schultz et al. (1998) Proc. Natl. Acad. Sci. USA 95, 58575864; Letunic et al. (2002) Res 30 nucleic acid , 242244), InterPro (Mulder et al., (2003) Nucl. Acids. Res. 31, 315-318), Prosite (Bucher and Bairoch (1994). A generalized profile syntax for biomolecular sequences and their role in automatic interpretation (In) ISMB94; Proceedings 2nd International Conference on Intelligent Systems for Molecular Biology. Altman R., Brutlag D., Karp P., Lathrop R., Searls D., Eds., pp53-61, AAAI Press, Menlo Park; Hulo et al., Nucl. Acids. Res. 32: D134-D137, (2004)), or Pfam (Bateman et al., Nucleic acid Research 30 (1): 276-280 (2002)). A set of tools for silicon analysis of protein sequences is available on the proteomics server ExPASy (Swiss Institute of Bioinformatics (Gasteiger et al., ExPASy: the proteomic server for knowledge and analysis of proteins in depth, Nucleic Acids).
[0075] Res. 31: 3784-3788 (2003)). Domains or motifs can also be identified using routine techniques, such as, such as through sequence alignment.
[0076] Methods for aligning sequences for comparison are well known in the art, such methods include GAP, BESTFIT, BLAST, FASTA and TFASTA. The GAP uses the Needleman and Wunsch ((1970) J Mol Biol 48: 443-453) algorithm to find the global alignment (ie
Petition 870190058857, of 6/25/2019, p. 42/132
34/106 is, covering the complete strings) of two strings that maximizes the number of matches and minimizes the number of intervals. The BLAST algorithm (Altschul et al. (1990) J Mol Biol 215: 403-10) calculates the percentage of the sequence identity and performs a statistical analysis of the similarity between the two sequences. The software to perform the BLAST analysis is publicly available through the National Biotechnology Information Center (NCBI). Homologues can be readily identified using, for example, the ClustalW multi-sequence alignment algorithm (version 1.83), with standard paired alignment parameters, and a percentage scoring method. The overall percentages of similarity and identity can also be determined using one of the methods available in the MatGAT software package (Campanella et al., BMC Bioinf ormática. 2003 Jul 10; 4: 29. MatGAT: an application that generates matrices of similarity / identity using protein or DNA sequences. Minor manual editing can be performed to optimize the alignment between conserved motifs, as would be evident to a person skilled in the art. In addition, instead of using entire sequences to identify counterparts, specific domains can also be used The sequence identity values can be etherminated throughout the nucleic lipid or amino acid sequence or in selected domains or conserved motif (s), using the programs mentioned above in the present case using defective parameters For local alignments, the Smith-Waterman algorithm is particularly useful (Smith TF,
Petition 870190058857, of 6/25/2019, p. 43/132
10/35
Waterman MS (1981) J. Mol. Biol 147 (1); 195-7).
Reciprocal BLAST [0077] Typically, this involves a first BLAST involving BLASTing a query string (for example, using any of the strings listed in Table A of the examples section) against any string database, such as the database NCBI data publicly available. BLASTN or TBLASTX (using default values) are generally used when starting from a nucleotide sequence, and BLASTP or TBLASTN (using default values) when starting from a protein sequence. BLAST results can optionally be filtered. The complete sequences of the filtered or unfiltered results are then BLASTed back (according to BLAST) against sequences from the organism from which the query string is derived. The results of the first and second BLASTs are then compared. A parallel is identified if a high-level attack from the first burst is of the same species from which the query string is derived, a BLAST at that time ideally results in the query string between the largest hits; an orthologist is identified if a high-level occurrence in the first BLAST is not the same species from which the query string is derived, and preferably results in BLAST back in the query string being among the highest results.
[0078] High-level hits are those that have a low E value. The lower the E-value, the more significant the score (or, in other words, the less the chance that the hit was found by chance). O
Petition 870190058857, of 6/25/2019, p. 44/132
36/106 E value calculation is well known in the art field. In addition to the E values, comparisons are also scored by percentage identity. Percent identity refers to the number of identical nucleotides (or amino acids) between the two nucleic acid sequences (or polypeptides) compared over a given length. In the case of large families, ClustalW, followed by a neighboring union tree, can be used to help visualize the grouping of related genes and to identify orthologists and parallels. ^
Construction [0079] Additional regulatory elements may include transcriptional as well as translational enhancers. Those skilled in the art will be aware of the termination and enhancer sequences that may be suitable for use in carrying out the invention. An intron sequence can also be added to the untranslated region 5 (RTU) or to the coding sequence to increase the amount of mature message that accumulates in the cytosol, as described in the definitions section. Other control sequences (in addition to promoter, enhancer, silencer, intron sequences, 3UTR and / or 5UTR regions) can be protein and / or RNA stabilizing elements. Such sequences would be known or can be readily obtained by a person skilled in the art.
[0080] The genetic constructs of the invention may further include a sequence of origin of replication that is necessary for maintenance and / or replication in a specific cell type. An example is when it is necessary
Petition 870190058857, of 6/25/2019, p. 45/132
37/106 that a genetic construct is maintained in a bacterial cell as an episomic genetic element (for example, plasmid molecule or cosmid).
[0081] For the detection of successful transfer of nucleic acid sequences, as used in the methods of the invention and / or selection of transgenic microorganisms that comprise these nucleic acids, it is advantageous to use marker genes (or reporter genes). For this reason, the genetic construct can optionally comprise a selectable marker gene. The marker genes can be removed or removed from the transgenic cell, since they are no longer needed. Techniques for removing markers are known in the art field, useful techniques are described previously in the definitions section.
Regulatory element / Control sequence / Promoter [0082] The terms regulatory element, control sequence and promoter are all used interchangeably in the present case and should be considered in a broad context to refer to regulatory nucleic acid sequences capable of effecting the expression of the strings to which they are linked. The term promoter typically refers to a nucleic acid control sequence located upstream of the start of transcription of a gene and which is involved in the recognition and binding of RNA polymerase and other proteins, thereby directing the transcription of a nucleic acid operationally connected. Covered by the aforementioned terms are transcriptional regulatory sequences derived from a eukaryotic genomic gene
Petition 870190058857, of 6/25/2019, p. 46/132
38/106 classic (including the TATA box that is needed for the precise start of transcription, with or without a CCAAT box sequence) and additional regulatory elements (i.e., activator sequences, enhancers and silencers) that alter gene expression in response to developmental and / or external stimuli, or in a tissue-specific manner. Also included in the term is a transcriptional regulatory sequence for a classic prokaryotic gene, in which case it may include a -35 box sequence and / or -10 transcriptional box regulatory sequences. The term regulatory element also encompasses a synthetic or derivative fusion molecule that confers, activates
or increases the expression of an acid molecule nucleic in one cell, tissue or organ. District Attorney const itut ivo [0083] A constitutive promoter refers to The a promoter who is transcriptionally active during The most, but not necessarily all, of phases in
growth and development and in most environmental conditions, in at least one cell, tissue or organ.
Transgenic / Transgene / Recombinant [0084] For the purposes of the invention, it means transgenic, transgene or recombinant with respect to, for example, a nucleic acid sequence, an expression cassette, gene construct or a vector comprising the nucleic acid sequence or an organism transformed with the nucleic acid sequences, expression cassettes or vectors according to the invention, all constructions caused by recombinant methods in which
Petition 870190058857, of 6/25/2019, p. 47/132
39/106 (a) the nucleic acid sequences encode proteins useful in the methods of the invention, or
(b) sequence (s) in genetic control which is connected (s) operationally with The sequence of acid nucleic according to the invention, per example one district Attorney, or (c) a) and b) no They are located in your environment natural genetic or have been modified by
recombinant modalities, it being possible that the modification takes the form of, for example, a substitution, addition, elimination, inversion or insertion of one or more nucleotide residues. The natural genetic environment is understood to mean the natural genomic or chromosomal site in the original microorganism or the presence in a genomic library. In the case of a genomic library, the natural genetic environment of the nucleic acid sequence is preferably retained, at least in part. The environment flanks the nucleic acid sequence on at least one side and has a sequence length of at least 50 bp, preferably at least 500 bp, especially preferably at least 1000 bp, more preferably at least 5000 bp. A naturally occurring expression cassette - for example, the natural combination of the natural promoter of the nucleic acid sequences with the corresponding nucleic acid sequence encoding a polypeptide of utility in the embodiments of the present invention, as defined above - becomes a cassette of transgenic expression. The expression cassette is modified using unnatural synthetic (artificial) methods, such as, for example, treatment
Petition 870190058857, of 6/25/2019, p. 48/132
40/106 mutagenic. Suitable methods are described, for example, in US patent 5,565,350 or WO 00/15815.
[0085] A transgenic microorganism for the purposes of the invention is understood to mean, as previously exposed, that the nucleic acids used in the method of the invention are not present, or originate in the genome of said microorganism, or are present in the genome. of said microorganism, but not in its natural location in the genome of said microorganism, it being possible that nucleic acids are expressed in a homologous or heterologous manner. Non-observer, as mentioned, transgenic also means that, while the nucleic acids according to the invention or used in the inventive method are in their natural position in the genome of a microorganism, the sequence has been modified in relation to the natural sequence, and / or that the regulatory sequences of the natural sequences have been modified. The transgenic is preferably understood to mean the expression of the nucleic acids according to the invention at an unnatural site in the genome, that is, homologous or, preferably, heterologous expression of the nucleic acids occurs. Preferred transgenic microorganisms are mentioned in the present case.
[0086] It should also be noted that, in the context of the present invention, the term isolated nucleic acid or isolated polypeptide can, in some cases, be considered synonymous with recombinant nucleic acid or recombinant polypeptide, respectively. and refers to a nucleic acid or
Petition 870190058857, of 6/25/2019, p. 49/132
41/106 polypeptide that is not located in its natural genetic environment and / or that has been modified by recombinant methods.
Modulation [0087] The term modulation means in relation to gene expression or expression, a process in which the level of expression is altered by the expression of the gene compared to the control microorganism, the level of expression can be increased or decreased. The original, unmodulated expression can be any type of expression of a structural RNA (rRNA, tRNA) or mRNA with subsequent translation. For the purposes of this invention, the original unmodulated expression can also be the absence of any expression. The term activity modulation means any change in the expression of the nucleic acid or encoded protein sequences of the invention, which leads to an increase in production yield and / or an increase in the growth of microorganisms. The expression can increase from zero (absence of, or immeasurable expression) to a certain amount, or it can decrease from a certain amount to small immeasurable amounts or zero.
Expression [0088] 0 expression term or expression genetics means The transcription of a gene specific or specific genes or construction genetics specific. 0 expression term or expression of gene in particular
means the transcription of a gene or genes or genetic construction into structural RNA (rRNA, tRNA) or mRNA, with or without
Petition 870190058857, of 6/25/2019, p. 50/132
42/106 subsequent translation of the latter into a protein. The process includes transcribing DNA and processing the resulting mRNA product.
Increased expression / overexpression [0089] As used in the present case, the term ieexpression increased or overexpression means any form of expression that is additional to the level of expression of the original (common) wild type. For the purposes of this invention, the original level of wild-type expression can also be zero, that is, absence of expression or immeasurable expression.
[0090] Methods for increasing the expression of genes or genetic products are well documented in the art and include, for example, overexpression conducted by appropriate promoters, the use of transcription enhancers or translation enhancers. Isolated nucleic acids that serve as promoter or enhancer elements can be introduced into an appropriate position (typically upstream) in a nonheterologous form of a polynucleotide, in order to upregulate the expression of a nucleic acid encoding the polypeptide of interest. For example, endogenous promoters can be altered in vivo by mutation, deletion and / or substitution (see, Kmiec, US 5,565,350; Zarling et al., W09322443), or isolated promoters can be introduced into a microorganism cell in the orientation appropriate distance to a gene of the present invention in order to control expression of the gene.
[0091] If expression of the polypeptide is desired, it is generally desirable to include a region
Petition 870190058857, of 6/25/2019, p. 51/132
43/106 of polyadenylation at the 3 'end of a polynucleotide coding region. The polyadenylation region can be derived from the natural gene, from a strain of other microorganism genes or from T-DNA.
[0092] In addition, the present invention relates to the following specific embodiments:
1. Method for the production of sialylated compounds, the method comprising: - cultivating a microorganism in a culture medium, the said culture medium optionally comprising an exogenous precursor,
- wherein said microorganism converts N-acetylglucosamine-6-phosphate intracellularly to Nacetylglucosamine, said N-acetylglucosamine to Nacetylmannosamine and said N-acetylmannosamine to N-acetylneuraminate; and
- wherein said microorganism is unable to convert to i) converting N-acetylglucosamine-6-P to glycosamine-6-P, ii) converting N-acetyl-glucosamine to Nacetyl-glucosamine-6-P, and iii) converting N -acetylneuraminate for N-acetyl mannosamine.
2. Method according to embodiment 1 where:
i) said conversion of N-acetylglucosamine-6 phosphate parfa N-acetylglucosamine is obtained by the action of a phosphatase expressed intracellularly, ii) said conversion of N-acetylglucosamine to N-acetylmannosamine is carried out by means of an intracellular Nacetylmannosamine epimerase; and
Petition 870190058857, of 6/25/2019, p. 52/132
44/106 iii) the intracellular ad sialic synthase converts the N-acetylmannosamine tape to Nacetyl-neuraminate.
3. Method according to any of embodiments 1 or 2, wherein said organism is unable to produce the following enzymes i) N-acetylglycosamine-6 phosphate deacetylase, ii) an N-acetylglycosamine kinase, and iii) N-acetylneuraminate aldolase.
4. Method in wake up with Any of them of embodiments 1 to 3, in that all at said conversions are catalyzed through in enzymes coded through in
constitutively expressed genes.
5. Method according to embodiment 2, in which the phosphatase is selected from the HAD superfamily or from the HAD- -like phosphatase family, preferably said phosphatase is selected from the group comprising: i) enzymes expressed by yqaB, inhX, yniC, ybiV, yidA, ybjl, yigL or cof genes from Escherichia coli, ii) Blastocladiella emersonii phosphatase and iii) other phosphatase families, more preferably said phosphatase is comprised of a phosphatase polypeptide similar to HAD-as defined in the claims.
6. Method according to any of embodiments 2, 3, 4 or 5, in which N-acetylmannosamine-2-epimerase is selected from the group comprising i) N-acetylmannosamine-2-epimerase from cyanobacteria, more in particularly from Acaryochloris marina, Anabaena variabilis, Anabaena marina, Nostoc punctiforme, species Acaryochloris, species Anabaena, species Nostoc and
Petition 870190058857, of 6/25/2019, p. 53/132
45/106 species Synechocystis; ίί) N-acetylmannosamine-2-epimerase from Bacteroides species, more particularly from Bacteroides ovatus, Bacteroides thetaiotaomicron, Capnocytophaga canimorsus and Mobiluncus mulieris; iii) Nacetyl-D-glycosmin-2-epimerase from Glycin max, Mus musculus, Homo sapiens, Rattus norvegicus, Bos Taurus, Sus scrofa or Canis lupus.
. Method according to any of embodiments 2, 3, 4, 5 or 6, in which the sialic acid synthase is selected from the group comprising: sialic acid synthase from Streptococcus agalatiae, Bacillus subtilis, Legionella pneumophilla, Campylobacter jejuni, Idiomarina loihiensis, Moritella viscosa, Aliivibrio salmonicida, Escherichia coli, Methanocaldococcus jannaschi, Clostridium sordellii, Butyrivibrio proteoclasticus, Micromonas commoda or Neisseria meningitis.
. Method according to any of the preceding embodiments in which said sialylated compound is selected from the group consisting of Nacetylneuramic acid, sialylated oligosaccharide, sialylated lipids, sialylated protein, sialylated aglycon.
9. Method according to the preceding embodiment, wherein said sialylated compound is comprised of a sialylated oligosaccharide.
10. Method according to embodiment 9, wherein said sialylated oligosaccharide is comprised of sialillactose, preferably any of 3-SL or 6-SL.
11. Method according to embodiment 9, wherein said sialylated oligosaccharide is comprised of
Petition 870190058857, of 6/25/2019, p. 54/132
46/106 disialyl lacto-N-tetraose.
12. Method according to embodiment 8, wherein said sialylated compound is comprised of Nacetylneuraminic acid.
13. Method according to any of embodiments 1 to 10 wherein said sialylated compound is comprised of a sialylated lacto-N-triose, lacto-Ntetraose or a lacto-N-neotetraose, and wherein said microorganism further comprises the activity of a galactosyltransferase (EC 2.4.1.38), preferably said galactosyltransferase originates from the group comprising Homo sapiens, Bos taurus, Mus mulatta, Gallus gallus, Danio rerio, Helicobacter pylori and Haemophilus ducrey; and / or said microorganism comprises the activity of an N-acetylglycosaminyltransferase (EC 2.4.1.90), preferably said N-acetylglycosaminyltransferase originated from the group comprising Bos taurus, Homo sapiens and Mus musculus.
14. Method according to embodiment 13 wherein said microorganism is unable to express the genes encoding UDP sugar hydrolase and galactose-1-phosphate uridylyl transferase.
15. Method according to any of embodiments 1 to 14, wherein said microorganism produces less than 50%, 40%, 30%, 20%, 10%, 5%, 2% extracellular Nacetylglycosamine and / or N -acetylmannosamine than the sialylated compound and / or said microorganism produces equal to or more than 50%, 60%, 70%, 80%, 90%, 95%, 98% of sialylated compound in the total carbohydrate.
16. Method for producing an oligosaccharide
Petition 870190058857, of 6/25/2019, p. 55/132
47/106 sialylate, which comprises:
a) to cultivate a microorganism according to the method of any k, that of embodiments 1 to 7, 14 and 15, and in which said microorganism produces internally, activated Nacetylneuraminate as donor substrate for a sialyltransferase; and
b) cultivating said microorganism in a culture medium comprising an exogenous precursor selected from the group consisting of lactose, N-acetylactosamine, lacto-Nbiose, galactose, beta-galactoside and alpha-galactoside, such as, but not limited to globotriose (Gal-alpha-1,4Galbeta-1, 4Glc) galactose, in which active uptake occurs in the microorganism of said exogenous precursor and in which said exogenous precursor is the acceptor substrate for said siallytransferase for the production of the sialylated oligosaccharide.
17. Method according to embodiment 2, wherein any one or more of said phosphatase, Nacetylmannosamine epimerase and sialic acid synthase is overexpressed in the microorganism.
18. Method according to embodiment 2, wherein any one or more of said phosphatase, Nacetylmannosamine epimerase and sialic acid synthase is introduced and expressed in the microorganism.
19. Method according to embodiment 3, wherein said microorganism is devoid of genes encoding the following enzymes i) an N-acetylglycosamine6-phosphate deacetylase, ii) an N-acetylglycosamine kinase, and iii) the N-acetylneuraminate aldolase .
20. Method according to embodiment 3, in
Petition 870190058857, of 6/25/2019, p. 56/132
48/106 that in said microorganism the genes encoding the following enzymes i) an N-acetylglycosamine-6-phosphate deacetylase, ii) an N-acetylglycosamine kinase, and iii) an N-acetylneuraminate aldolase are reduced in activity, preferably said genes are suppressed or knocked down.
21. Method according to any one of embodiments 1 to 20, wherein said microorganism further encodes a protein that facilitates the absorption of lactose and lack of enzymes that metabolize lactose.
22. Method according to any one of embodiments 1 to 21, wherein said microorganism is comprised of a bacterium, preferably an Escherichia coli strain, more preferably a scherichia coli strain which is a K12 strain, even more preferably the Escherichia coli K12 variety is Escherichia coli MG1655.
23. Method in wake up with at any one of achievements 1 to 21, on what O said microorganism is comprised of a yeast. 24. Method in wake up with at any one of achievements 1 to 23, on what O exogenous precursor is selected a from the group what comprises lactose,
galactose, beta-galactoside, and alpha-galactoside, such as globotriose (Gal-alpha-1,4Gal-beta-1, 4Glc).
25. Microorganism for the production of sialylated compounds, said microorganism - converts N-acetylglucosamine-6-phosphate intracellularly to N-acetylglucosamine, said N-acetylglucosamine to N-acetylmannosamine and said N-acetylmannosamine to Nacetyl-neuraminate; and
Petition 870190058857, of 6/25/2019, p. 57/132
49/106
- it is Table N-acetylglycosamine-6-P to glycosamine-6-P, ii) convert N-acetyl-glucosamine to Nacetyl-glycosamine-6-P, and Ui) convert N-acetylneuraminate to N-acetyl-mannosamine.
26. Microorganism for the production of a sialylated compound, said micro-organism as being defined in any of embodiments 2 to 24.
27. Cell culture medium comprising lactose as a precursor and the microorganism of either embodiment 25 or 26.
28. Method according to any one of embodiments 1 to 24, for the production of 3 sialylactose or 6 sialylactose, in which the microorganism is grown in high cell density on a carbon substrate, such as glucose or glycerol, and fed with lactose which is internalized by lactose permease and sialylated by said recombinant sialyltransferase using CMP- Nacetyl-neuraminate endogenously generated from Nacetylglycosamine.
29. Method according to any one of embodiments 1 to 24, wherein said sialylated compound is isolated from said culture medium by means of a unit operation selected from the group centrifugation, filtration, microfiltration, ultrafiltration, nanofiltration, ion exchange, electrodialysis, chromatography, simulated moving bed, evaporation, precipitation, crystallization, lyophilization and / or spray drying.
30. Sialylated compound produced according to the method described in any of embodiments 1 to 24, wherein said sialylated compound is purified by means of
Petition 870190058857, of 6/25/2019, p. 58/132
50/106 centrifugation and / or filtration, ion exchange, concentration through evaporation or nanofiltration, formulation through crystallization or spray drying or lyophilization.
31. Sialylated compound produced according to the method described in any of embodiments 1 to 24, wherein said sialylated compound is added to the food formulation, feed formulation, pharmaceutical formulation, cosmetic formulation or agrochemical formulation ..
. Method according to any of embodiments 1 to 24, wherein said culture medium comprises any one or more of the following: a monosaccharide, disaccharide, oligosaccharide, polysaccharide, polyol, a complex medium in the form of the main carbon source.
33. Method according to embodiment 32, wherein said main carbon source provides at least 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90% , 95%, 98%, 99% or 100% of the total carbon necessary for the growth of said microorganism.
34. Method according to embodiment 32, wherein said monosaccharide is selected from the group comprising glucose, fructose, galactose, mannose, ribose or arabinose.
35. Method according to embodiment 32, wherein said disaccharide is selected from the group comprising maltose, sucrose, lactose, trehalose, cellobiosis or chitobiosis.
36. Method according to embodiment 32, wherein said oligosaccharide is selected from the group
Petition 870190058857, of 6/25/2019, p. 59/132
51/106 comprising maltotriosis, fructo-oligosaccharides, galacto-oligosaccharides, mann oligosaccharides, isomaltooligosaccharides or glycooligosaccharides.
37. Method according to embodiment 32, wherein said polyol is selected from the group comprising glycerol.
38. Method according to embodiment 32, wherein said complex medium is selected from the group comprising molasses, corn steeping liquor, peptone, tryptone or yeast extract.
[0094] According to a preferred aspect, the present invention relates to the following specific preferred embodiments:
1. Method for the production of a sialylated compound in a microorganism, the method comprising: cultivating a microorganism in a culture medium, said culture medium optionally comprising an exogenous precursor, in which said microorganism comprises at least one nucleic acid encoding a phosphatase, at least one nucleic acid encoding an N-acetylmannosamine epimerase; and at least one nucleic acid encoding a sialic acid synthase, and wherein said microorganism is Table Nacetylglycosamine-6-P to glucosamine-6-P, ii) converting N-acetyl-glucosamine to N-acetyl-glucosamine-6 -P, and iii) converting N-acetyl-neuraminate to N-acetyl-mannosamine; and
- modulate the expression of said microorganism from a nucleic acid encoding a phosphatase polypeptide
Petition 870190058857, of 6/25/2019, p. 60/132
52/106 similar to HAD, wherein said HAD-like phosphatase polypeptide comprises:
- at least one of the following reasons:
Reason 1: hDxDx [TV] (SEQ ID NO: 73), or
Reason 2: [GSTDE] [DSEN] x (1-2) [hP] x (l-2) [DGTS]
(SEQ ID NOs: 74, 75, 76, 77) on what H means a hydrophobic amino acid (A, I, L, M, F, V, P, G) and x can be any amino acid distinct; - or a counterpart or derivative in Any of them
of SEQ ID NOs: 43 , 44, 45, 47, 48, 50, 51, 52, 54, 55 or 57 by having at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88% , 89% , 90%, 91%, 92%, 93%, 94%, 95%, 96% , 97% 98 %, or 99% in identity in total sequence with O said
polypeptide.
2. Method according to the preferred embodiment
1, wherein said HAD- -like polypeptide comprises any of SEQ ID NOs: 43, 44, 45, 47, 48, 50, 51, 52, 54, 55, 57.
3. Method according to the preferred embodiment
1, in which the modulated expression is effected by the introduction and expression in a microorganism of a nucleic acid encoding a HAD-like polypeptide.
4. Method according to the preferred embodiment
1, wherein said modulated expression is effected by the action of a constitutive promoter.
5. Method according to any of the previous preferred embodiments, wherein said sialylated compound is selected from the group consisting of N-acetylneuramic acid, sialylated oligosaccharide, sialylated lipids, sialylated protein, aglycon
Petition 870190058857, of 6/25/2019, p. 61/132
53/106 sialylated.
6. Method according to the previous preferred embodiment, wherein said sialylated compound is comprised of a sialylated oligosaccharide.
7. Method according to preferred embodiment 8, wherein said sialylated oligosaccharide is comprised of sialylactose.
8. Method according to preferred embodiment 8, wherein said sialylated oligosaccharide is comprised of disialyl lacto-N-tetraose.
9. Method according to preferred embodiment 7, wherein said sialylated compound is comprised of N-acetylneuraminic acid.
10. Method according to any of the preferred embodiments 1 to 9, wherein said sialylated compound is comprised of a sialylated lacto-N-triosis, lacto-N-tetraose or a lacto-N-neotetraose, and wherein said microorganism it also comprises the activity of a galactosyltransferase (EC 2.4.1.38), preferably said galactosyltransferase originates from the group comprising Homo sapiens, Bos taurus, Mus mulatta, Gallus gallus, Danio rerio, Helicobacter pylori and Haemophilus ducrey; and / or said microorganism comprises the activity of a Nacetylglycosaminyltransferase (EC 2.4.1.90), preferably said N-acetylglycosaminyltransferase originates from
do group what comprises Bos taurus, Homo sapiens and Mus musculus. 11. Method in according to concretization preferred 12 on what O said microorganism is unable to express the genes that encode UDP sugar hydrolase and
Petition 870190058857, of 6/25/2019, p. 62/132
54/106 galactose-1-phosphate uridylyltransferase.
12. Method according to any of the preferred embodiments 1 to 13, wherein said microorganism produces less than 50%, 40%, 30%, 20%, 10%, 5%, 2% extracellular N-acetylglycosamine and / or Nacetylmannosamine than the sialylated compound and / or said microorganism produces equal to or greater than 50%, 60%, 70%, 80%, 90%, 95%, 98% of sialylated compound in the total carbohydrate. 13. Method for producing a sialylated oligosaccharide, which comprises:
a) cultivating a microorganism according to the method of any of the preferred embodiments 1 to 12, and wherein said microorganism internally produces activated N-acetylneuraminate as a donor substrate for a sialyltransferase; and
b) cultivating said microorganism comprising an exogenous precursor selected from the group consisting of lactose, N-acetylactosamine, lacto-N-biose, galactose, beta-galactoside and alpha-galactoside, such as, but not limited to, globotriosis (Gal -alpha-1,4Gal-betal, 4Glc) galactose, in which active uptake occurs in the microorganism of said exogenous precursor and in which said exogenous precursor is the accepting substrate of said sialyltransferase for the production of the sialylated oligosaccharide.
14. Method according to preferred embodiment 1, wherein any one or more of said Nacetylmannosamine epimerase and sialic acid synthase is overexpressed in the microorganism.
15. Method according to the embodiment
Petition 870190058857, of 6/25/2019, p. 63/132
55/106 preferred 1, wherein any one or more of said nacetylmannosamine epimerase and sialic acid synthase is introduced and expressed in the microorganism.
16. Method according to preferred embodiment 1, wherein said microorganism lacks the genes encoding the following enzymes i) a Nacetylglycosamine-6-phosphate deacetylase, ii) a Nacetylglycosamine kinase, and iii) an N-acetylneuraminate aldolase.
17. Method according to preferred embodiment 1, wherein in said microorganism the genes encoding the following enzymes i) an N-acetylglycosamine6-phosphate deacetylase, ii) an N-acetylglycosamine kinase, and iii) an N-acetylneuraminate aldolase reduced in activity, preferably said genes are deleted or dropped.
18. Method of wake up with Any of them of achievements favorite 1 to 17, in that the said microorganism further encodes a protein that facilitates the capture lactose and is devoid of enzymes what metabolize lactose.19. Method of wake up with Any of them of achievements favorite 1 to 18, in that the said microorganism is understood per an bacterium, in preference a strain Escherichia coli, with bigger preferably an Escherichia strain coli what is a strain K12,
even more preferably, the Escherichia coli K12 strain is comprised of Escherichia coli MG1655.
20. Method according to any of the preferred embodiments 1 to 18, wherein said
Petition 870190058857, of 6/25/2019, p. 64/132
56/106 microorganism is comprised of a yeast.
21. Method according to any of the preferred embodiments 1 to 20, wherein the exogenous precursor is selected from the group comprising lactose, galactose, beta-galactoside and alpha-galactoside, such as globotriosis (Gal-alpha-1, 4Gal-beta-l, 4Glc).
22. Microorganism, capable of being obtained by a method according to any one of embodiments 1 to 21, wherein said microorganism comprises a recombinant nucleic acid according to a polypeptide similar to HAD.
23. Microorganism for the production of sialylated compounds in which said microorganism comprises at least one nucleic acid encoding a phosphatase, at least one nucleic acid encoding a Nacetylmannosamine epimerase; and at least one nucleic acid encoding a sialic acid synthase, and wherein said microorganism is Table N-acetylglycosamine-6-P to glycosamine-6-P, ii) converting N-acetyl-glucosamine to Nacetyl-glycosamine-6 -P, and iii) converting N-acetylneuraminate to N-acetyl mannosamine; characterized in that said microorganism comprises a modulated expression of a nucleic acid encoding a HAD-like phosphatase polypeptide as defined in preferred embodiment 1.
24. Construction comprising:
(i) nucleic acid encoding a HAD-like polypeptide as defined in preferred embodiment 1 or 2;
(ii) one or more control sequences capable of triggering
Petition 870190058857, of 6/25/2019, p. 65/132
57/106 the expression of the nucleic acid sequence of (i); and optionally (iii) a transcription termination sequence.
25. Construction according to preferred embodiment 24, wherein one of said control sequences is a constitutive promoter.
26. Use and construction according to preferred embodiment 24 or 25 in a method for the production of sialylated compounds.
27. Sialylated compound produced according to the method described in any of the preferred embodiments 1 to 21, wherein said sialylated compound is added to food formulation, feed formulation, pharmaceutical formulation, cosmetic formulation, or agrochemical formulation.
28. Microorganism for the production of a sialylated compound, said microorganism being defined in any of embodiments 2 to 21.
29. Cell culture medium comprising lactose as a precursor and the microorganism of any of embodiments 22, 23 or 28.
30. Method according to any of embodiments 1 to 21, for the production of 3 sialillactose or 6 sialillactose, in which the microorganism is grown in high cell density on a carbon substrate, such as glucose or glycerol or sucrose, and fed with lactose which it is internalized by lactose permease and sialylated by said recombinant sialyltransferase using CMP-Nacetyl-neuraminate generated endogenously from Nacetylglycosamine.
Petition 870190058857, of 6/25/2019, p. 66/132
58/106
31. Method according to any one of embodiments 1 to 21, wherein said sialylated compound is isolated from said culture medium by means of a unitary operation selected from the group centrifugation, filtration, microfiltration, ultrafiltration, nanofiltration, ion exchange, electrodialysis, chromatography, simulated moving bed, evaporation, precipitation, crystallization, lyophilization and / or spray drying.
32. Sialylated compound produced according to the method described in any of embodiments 1 to 21, wherein said sialylated compound is purified by means of centrifugation and / or filtration, ion exchange, concentration through evaporation or nanofiltration, formulation through crystallization or spray drying or lyophilization.
33. Sialylated compound produced according to the method described in any of embodiments 1 to 21, wherein said sialylated compound is added to food formulation, feed formulation, pharmaceutical formulation, cosmetic formulation, or agrochemical formulation.
34. Method according to any of embodiments 1 to 21, wherein said culture medium comprises any one or more of the following: a monosaccharide, disaccharide, oligosaccharide, polysaccharide, polyol, a complex medium such as the main carbon source .
35. Method according to embodiment 34, wherein said main carbon source provides at least
Petition 870190058857, of 6/25/2019, p. 67/132
59/106 minus 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% of all required carbon for the growth of said microorganism.
36. Method according to embodiment 34, wherein said monosaccharide is selected from the group comprising glucose, fructose, galactose, mannose, ribose or arabinose.
37. Method according to embodiment 34, wherein said disacaeid is selected from the group comprising maltose, sucrose, lactose, trehalose, cellobiosis or chitobiosis.
38. Method according to embodiment 34, wherein said oligosaccharide is selected from the group comprising malotriose, fructo-oligosaccharides, galactooligosaccharides, mann oligosaccharides, isomaltooligosaccharides or glycooligosaccharides.
39. Method according to embodiment 34, wherein said polyol is selected from the group comprising glycerol.
40. Method according to embodiment 34, wherein said complex medium is selected from the group comprising molasses, corn steeping liquor, peptone, tryptone or yeast extract.
[0095] The drawings and examples set out below will serve to better illustrate and clarify the present invention and are not intended to be limiting.
Basic description of the drawings [0096] Figure 1 shows an exemplary path as used in example 2 for the production of sialic acid according to the present invention. THE
Petition 870190058857, of 6/25/2019, p. 68/132
60/106
Figure IA shows the path without all the KO and signs of overexpression. Figure 1B shows the path as used in example 2 with the knock-out indicated with a cross and overexpression with a rising arrow next to the indicated enzyme.
[0097] Figure 2 shows the results of production of the strain of Escherichia coli capable of producing sialic acid, as described in example 2.
[0098] Figure 3 shows examples of different sialylated compounds that can be produced in the method of the present invention.
[0099] Figure 4 shows the optical density and production of sialic acid from strains supplemented with the indicated phosphatases.
[00100] THE Figure 5 shows the fees in growth of strains supplemented with phosphatases indicated.[00101] THE Figure 6 shows the parts of one
alignment of the phosphatases tested in the examples.
Example 1: Materials and Methods
Escherichia coli method and materials
Means [00102] Three different media were used, namely, a rich Luria Broth (LB), a minimum medium for the shake flask (MMsf) and a minimum medium for fermentation (MMf). All two minimal media use a combination of trace elements.
[00103] The mix of trace elements consisted of 3.6 g / L FeCl2.4H20, 5 g / L CaCl2.2H20, 1.3 g / L
MnCl2.2H20, 0.38 g / L CuCl2.2H20, 0.5 g / L CoCl2.6H20, 0.94
Petition 870190058857, of 6/25/2019, p. 69/132
61/106 g / L ZnCl2, 0.0311 g / L H3B04, 0.4 g / L Na2EDTA.2H20 and 1.01 g / L thiamine.HCI. the molybdate solution contained 0.967 g / L Na2MoO4.2H20. The selenium solution contained 42 g / L of Se02.
[00104] Caldo Luria medium (LB) consisted of 1% triptone peptone (Difco, Erembodegem, Belgium), yeast extract at 0.5% (Difco) and sodium chloride at 0.5% (VWR, Leuven, Belgium).
[00105] Luria Broth agar (LBA) plates consisted of LB medium, with 12 g / L agar (Difco, Erembodegem, Belgium).
[00106] The minimum medium for shaking flask experiments (MMsf) contained 2.00 g / L of NH4C1, 5.00 g / L (NH4) 2S04, 2.993 g / L of KH2P04, 7.315 g / L of K2HP04, 8.372 g / L MOPS, 0.5 g / L NaCI, 0.5 g / L MgS04.7H20 minimum medium for shaking bottle experiments (MMsf) contained 2.00 g / L NH4CI, 5.00 g / L (NH4) 2S04, 2.993 g / L KH2P04, 7.315 g / L K2HP04, 8.372 g / L MOPS, 0.5 g / L NaCI, 0.5 g / L MgS04.7H20. A chosen carbon source was used, but not limited to glucose, fructose, maltose, glycerol and maltotriose. The concentration was standard 15 g / L, but this was subject to change depending on the experiment. Mixture of trace element 1 mL / L, molybdate solution 100 pL / L and selenium solution 1 mL / L. The medium was adjusted to a pH of 7 with 1M KOH. Depending on the experience, lactose can be added as a precursor.
[00107] The minimum medium for fermentations contained 6.75 g / L of NH4C1, 1.25 g / L (NH4) 2S04, 1.15 g / L of KH2P04 (low phosphate medium) or 2.93 g / L KH2P04 and 7.31g / L KH2P04 (high phosphate medium), 0.5 g / L NaCI, 0.5g / L MgS04.7H20, a carbon source including, but not limited to,
Petition 870190058857, of 6/25/2019, p. 70/132
62/106 limiting to, glucose, sucrose, fructose, maltose, glycerol and maltotriose, 1 mL / L of mixture of trace elements, 100pL / L of molybdate solution and 1 mL / L selenium solution with the same composition previously described in the present case.
[00108] Complex medium, for example, LB, was
sterilized by autoclaving (121 ° C, 21) and Midle Minimum (MMsf and MMf) per filtration (0.22 pm Sartorius). If necessary, the half gone school by addition on one antibiotic (for example example, ampicillin (100 mg / 1), chloramphenicol (20 mg / 1), carbenicillin (100 mg / 1), spectinomycin (40 mg / 1) and / or kanamycin (5 0 mg / 1)) • Strains[00109] Obtained Escherichia coli MG1655
[lambda, F, rph-1] from Coli Genetic Stock Center (US), CGSC Strain #: 7740 in March 2007. Mutant strains were constructed using homologous recombination, as described by Datsenko and Wanner (PNAS 97 (2000), 66406645).
Plasmids [00110] pKD46 (Red helper plasmid, Ampicillin resistance), pKD3 (contains a chloramphenicol resistance flanked by FRT (cat) gene), pKD4 (contains a kanamycin resistance gene flanked by FRT (kan)), and pCP20 ( expressed FLP recombinase activity) were obtained from Prof. R. Cunin (Vrije Universiteit Brussel, Belgium in 2007).
[00111] The plasmid pCX-CjneuB was constructed using the Gibson assembly. The CjneuBl gene was expressed using the expression vector as described by Aerts et al. al (Eng. Life Sci. 2011, 11, η ° 1, 10-19.
Petition 870190058857, of 6/25/2019, p. 71/132
63/106 [00112] The plasmid pCX-CjneuB-NmneuA-Pdbst was constructed using the Gibson assembly. The CjneuBl, NmneuA and Pdbst genes were expressed using the expression vector described by Aerts et al (Eng. Life Sci. 2011, 11, No. 1, 10-19).
[00113] Plasmids for phosphatase expression were constructed using the Golden Gate assembly. Phosphatases (EcAphA, EcCof, EcHisB, EcOtsB, EcSurE, EcYaed, EcYcjU, EcYedP, EcYfbT, EcYidA, EcYigB, EcYihX, EcYniC, EcYqaB, EcYrbL and PsMupP) were expressed with our two other two companies. UTR1 AATTCGCCGGAGGGATATTAAAAtgaatggaaaattgAAACATCTTAATCATGCTAAGG AGGTTTTCTAATG (SEQ ID NO: 41). All promoters and RTUs except UTR1 are described by Mutalik et al (Nat. Methods 2013, No. 10, 354-360). Also the phosphatases EcAppA, EcGph, EcSerB, EcNagD, EcYbhA, EcYbiV, EcYbjL, EcYfbR, EcYieH, EcYjgL, Ec YjjG, EcYrfG, EcYbiU, ScDOGl and BsAraL are expressed using the same promoters and UR.
[00114] Plasmid pBR322-NmneuB was constructed using a vector pBR322 via Golden Gate assembly. The promoter and RTU used for NmNeuB expression are the apFAB299 promoter and the galE_SD2junction_BCD12 promoter. The plasmid pSClOl-NmneuA-Pdbst was constructed using a vector pSClOl by mounting the Golden Gate. The promoters and RTUs used for NmneuA expression are the apFAB37 promoter and the galE_SD2-junction_BCD18 promoter. The promoters and RTUs used for Pdbst expression are the apFAB339 promoter and the galE_SD2-junction_BCD12 promoter. All promoters and RTUs are
Petition 870190058857, of 6/25/2019, p. 72/132
64/106 described by Mutalik et al (Nat. Methods 2013, No. 10,
354-360).
[00115] Plasmids were maintained in the host E. coli DH5alfa (F-, ph80dlacZdeltaM15, delta
(lacZYA-argF) U169, deoR, recAl, endAl, hsdR17 (rk-, mk +), phoA, supE44, lambda-, 1, gyrA96, relAl). Purchased from Invitrogen. Interruptions of gene[00116] gene interruptions, as well as
gene introductions were performed using the technique published by Datsenko and Wanner (PNAS 97 (2000), 66406645). This technique is based on the selection of antibiotics after homologous recombination performed by lambda Red recombinase. The subsequent catalysis of a flippase recombinase ensures the removal of the antibiotic selection cassette in the final production strain.
[00117] Table A lists the necessary preparers for the construction of the gene interruption cassette.
[00118] Table A: Lists of preparers to build rupture cassette for the target gene.
Target gene Fw Trainer RV Trainer lacZYA GCTGAACTTGTAGGCCTGATAAGCGCAGCGTATCAGGCAATTTTTATA ATCTTCATTTAAATGGCGCGC(SEQ ID NO: 1) GCGCAACGCAATTAATGTGAGTT AGCTCACTCATTAGGCACCCCAG GCTTCGCCTACCTGTGACGGAAG (SEQ ID NO: 2) nagABCDAND CGCTTAAAGATGCCTAATCCGCCAACGGCTTACATTTTACTTATTGAG GTGAATAGTGTAGGCTGGAGCTGC TTC (SEQ ID NO: 3) GGCGTTTGTCATCAGAGCCAACC ACGTCCGCAGACGTGGTTGCTAT CATAT GAATAT CCTCCTTAG (SEQ ID NO: 4)
Petition 870190058857, of 6/25/2019, p. 73/132
65/106
nanATEK TAATGCGCCGCCAGTAAATCAACA TGAAATGCCGCTGGCTCCGTGTAG GCTGGAGCTGCTTC (SEQ ID NO: 5) CCAACAACAAGCACTGGATAAAG CGAGTCTGCGTCGCCTGGTTCAG TTCACATAT GAATAT CCTCCTTAG (SEQ ID NO: 6) manXYZ AAAATACATCTGGCACGTTGAGGT GTTAACGATAATAAAGGAGGTAGC AAGTGTAGGCTGGAGCTGCTTC (SEQ ID NO: 7) CCTCCAGATAAAAAAACGGGGCCAAAAGGCCCCGGTAGTGTACAAC AGTCCATATGAATATCCTCCTTA G (SEQ ID NO: 8)
[00119] For the genomic integration of the necessary genes in the genome of production hosts based on the same technique used for the rupture of the gene, discussed previously, with specific changes in the rupture cassette. Between a homology site and the FRT site of the rupture cassette, the one built to be integrated is located. This allows an elegant integration of the built in the region dictated by the homology sites.
[00120] Using this workflow, direct genetic disruption and genomic integration is possible. The preparers that were used for target integration at specific locations are listed in Table B.
[00121] Table B: Preparers used for genomic integration
Place of integration Fw Trainer RV Trainer nagABCDE GTTTGGCGTTTGTCATCAGAGCCAACCACGTCCGCAGACGTG GTTGCTATGTGTAGGCTGGAG CTGCTTC (SEQ ID NO: 9) TTGTCATTGTTGGATGCGACGC TCAAGCGTCGCATCAGGCATAA AGCAGACTTAAGCGACTTCATT CACC (SEQ ID NO: 10) nanATEK CATGGCGGTAATGCGCCGCCA GTAAATCAACATGAAATGCCG CTGGCTCCGTGTAGGCTGGAG CTGCTTC (SEQ ID NO: 11) CCAACAACAAGCACTGGATAAA GCGAGTCTGCGTCGCCTGGTTC AGTTCACTTAAGCGACTTCATT CACC (SEQ ID NO: 12) manXYZ AAAATACATCTGGCACGTTGA CCTCCAGATAAAAAAACGGGGC
Petition 870190058857, of 6/25/2019, p. 74/132
66/106
GGTGTTAACGATAATAAAGGA GGTAGCAAGTGTAGGCTGGAG CTGCTTC (SEQ ID NO: 13) CAAAAGGCCCCGGTAGTGTACAACAGTCCTTAAGCGACTTCATT CACC (SEQ ID NO: 14) lacZYA GCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACC CCAGGCTTGTGTAGGCTGGAG CTGCTTC (SEQ ID NO: 15) GCTGAACTTGTAGGCCTGATAAGCGCAGCGTATCAGGCAATTTT TATAATCTTAAGCGACTTCATT CACC (SEQ ID NO: 16) atpI-gidB CAAAAAGCGGTCAAATTATAC GGTGCGCCCCCGTGATTTCAA ACAATAAGGTGTAGGCTGGAG CTGCTTC (SEQ ID NO: 17) ATAACGTGGCTTTTTTTGGTAA GCAGAAAATAAGTCATTAGTGA AAATATCTTAAGCGACTTCATT CACC (SEQ ID NO: 18)
[00122] The clones carrying the temperature-sensitive helper plasmid pKD46 were cultured in 10 ml of LB medium with ampicillin (100 mg / L) and L-arabinose (10 mM) under 30 ° C to an ODgoonm of 0.6. The cells were made electrically competent by sequential washing, once with 50 ml and once with 1 ml of ice cold deionized water. Then, the cells were resuspended in 50 pL of ice water. Finally, 10-100 ng of rupture / integration cassette was added to 50 µl of the washed cell solution for electroporation. Electroporation was performed using a Gene Pulser (registered trademark of BioRad) (600 Ohm 25 pFD and 250 V).
[00123] After electroporation, the cells were resuspended in 1 ml of LB medium for 1 h at 37 ° C and finally plated on LB-agar containing 25 mg / L of chloramphenicol or 50 mg / L of kanamycin to select resistant transformants antibiotics. The selected mutants were verified by PCR with primers upstream and downstream of the modified region and were subsequently cultured on LB-agar at 42 for the loss of
Petition 870190058857, of 6/25/2019, p. 75/132
67/106 the helper plasmid pKD46. The mutants were finally tested for sensitivity to ampicillin.
[00124] The selected mutants (resistant to chloramphenicol or kanamycin) were transformed with plasmid pCP20, which is a plasmid resistant to ampicillin and chloramphenicol that presents temperature sensitive replication and thermal induction of FLP synthesis. Ampicillin-resistant transformants were selected under 30 ° C, after which some were purified by LB colonies under 42 ° C and then tested for loss of all antibiotic resistance and thus also of the auxiliary plasmid FLP. Gene interruptions and / or genetic integration are checked with control preparers and sequenced. These preparers are listed in Table C.
[00125] Table C: Preparers to validate gene disruption and / or genomic integration for specific genetic targets.
Genetic targets Fw Trainer RV Trainer lacZYA CAGGTTTCCCGACTGGAAAG(SEQ ID NO: 19) TGTGCGTCGTTGGGCTGATG(SEQ ID NO: 20) nagABCDE CGCTTGTCATTGTTGGATGC(SEQ ID NO: 21) GCTGACAAAGTGCGATTTGTTC(SEQ ID NO: 22) nanATEK GTCGCCCTGTAATTCGTAAC(SEQ ID NO: 23) CTTTCGGTCAGACCACCAAC(SEQ ID NO: 24) manXYZ ACGCCTCTGATTTGGCAAAG(SEQ ID NO: 25) AGCCAGTGCGCTTAATAACC(SEQ ID NO: 26) atpI-gidB GCTGAACAGCAATCCACTTG(SEQ ID NO: 27) TGAACGATATGGTGAGCTGG(SEQ ID NO: 28)
Heterologous and homologous expression [00125] The genes that needed to be expressed, whether from a plasmid or the genome, were synthesized
Petition 870190058857, of 6/25/2019, p. 76/132
68/106 synthetically with one of the following companies: DNA2.0, Gen9 or IDT.
[00126] Genes native to Escherichia coli, such as, for example, phosphatases, were harvested from the E. coli K-12 MG1655 genome. The origin of other genes is indicated in the relevant table.
[00127] Expression can be further facilitated by optimizing the use of codons for the use of codons from the expression host. Genes were optimized using the supplier's tools.
Cultivation conditions [00128] A preculture of 96 well micro-titration plate experiments was started from a single colony on an LB plate, at 175 pL and was incubated for 8 h under 37 ° C on an orbital shaker under 800 rpm. This culture was used as an inoculum for a 96-well microtiter plate, with 175 pL of MMsf medium by 300x dilution. These cultures, in turn, were used as a pre-culture for the final experiment in a 96-well plate, again diluting 300x. The 96-well plate can be the microtiter plate, with a culture volume of 175 pL, or a 24-well deep plate with a culture volume of 3 ml.
[00129] A pre-culture for shaking flask experiments was started from a single colony on an LB plate, in 5 mL of LB medium and was incubated for 8 hours under 37 ° C on an orbital shaker at 200 rpm. From this culture, 1 ml was transferred to 100 ml of mini-medium (MMsf) in a 500 ml shaking flask and incubated at 37 ° C on an orbital shaker under 200 rpm. It is
Petition 870190058857, of 6/25/2019, p. 77/132
69/106 configuration is used for flask shaking experiments.
[00130] A shake bottle experiment grown for 16 hours can also be used as an inoculum for a bioreactor. 4% of this cell solution was to inoculate a Biostat Dcu-B 2L with a 4 L workload, controlled by the MFCS control software (Sartorius Stedim Biotech, Melsungen, Germany). The culture condition was adjusted to 37 ° C, agitation at 800 rpm and a gas flow of 1.5 L / min. The pH was controlled to 7 using 0.5 M H2S04 and 25% NH4OH. The exhaust gas has been cooled. A 10% solution of silicone antifoaming agent was added when foaming increased during fermentation (approximately 10 6 L). The use of an inducer is not necessary, since all genes are expressed constitutively.
Material and methods Saccharomyces cerevisae
Means [00131] The strains are grown in Synthetic yeast medium Defined with Complete Mix of Supplement (SD CSM) or CSM drop (SD CSM-Ura) containing 6.7g / L of Yeast Nitrogen Base without amino acids (YNB without AA, Disc), 20 g / L agar (Difco) (solid cultures), 22 g / 1 glucose monohydrate or 20 g / 1 lactose and 0.79 g / l CSM or 0.77 g / 1 CSM-Ura (MP Biomedicals).
Strains [00132] Saccharomyces cerevislae BY4742 created by Bachmann et al. (Yeast (1998) 14: 115-32) was used available in the Euroscarf culture collection. All mutant strains were created by homologous recombination or
Petition 870190058857, of 6/25/2019, p. 78/132
70/106 plasmid transformation using the Gietz modality (Yeast 11: 355-360, 1995). Kluyveromyces marxianus lactis is available in the LMG culture collection (Ghent, Belgium).
Plasmids [00133] The yeast expression plasmid p2a_2p_sia_GFAl (Chan 2013 (Plasmid 70 (2013) 2-17)) was used for the expression of foreign genes in Saccharomyces cerevisiae. This plasmid contains an ampicillin resistance gene and a bacterial origin of replication to allow selection and maintenance in E. coli. The plasmid also contains the yeast ori 2 u and the selection marker Ura3 for selection and maintenance in yeast. Finally, the plasmid can contain a beta-galactosidase expression cassette. Then, this plasmid also contains an N-acetylglycosamine-2-epimerase (for example, from Bacteroides ovatus (BoAGE)) and a syntactic acid synthase (for example, from Campylobacter jejuni (CjneuB)). Finally, it also contains Saccharomyces cerevisiae fructose-6-P-aminotransferase, ScGFAl.
[00134] The yeast expression plasmid p2a_2p_sia_glmS is based on p2a_2p sai, but modified in a way that is also expressed in glmS * 54 (Escherichia coli fructose-6-Paminotransferase).
[00135] The yeast expression plasmid p2a_2p_sia_glmS_phospha is based on p2a_2p_sia_glmS, but modified in such a way that they are also expressed
EcAphA (SEQ ID AT THE: 42), EcCof (SEQ ID AT THE: 43), EcHisB (SEQ ID NO: 44), EcOtsB (SEQ ID NO: 45), EcSurE (SEQ ID NO: 46), EcYaed (SEQ ID AT THE: 47), EcYcjU (SEQ ID AT THE: 48), EcYedP (SEQ
Petition 870190058857, of 6/25/2019, p. 79/132
71/106
ID NO: 49), EcYfbT (SEQ ID NO: 50), EcYidA (SEQ ID NO: 51), EcYigB (SEQ ID NO: 52), EcYihX (SEQ ID NO: 53), EcYniC (SEQ ID NO: 54), EcYqaB (SEQ ID NO: 55), EcYrbL (SEQ ID NO: 56), PsMupP (SEQ ID NO: 57), EcAppA (SEQ ID NO: 58), EcGph (SEQ ID NO: 59), EcSerB (SEQ ID NO: 60), EcNagD (SEQ ID NO: 61), EcYbhA (SEQ ID NO: 62), EcYbiV (SEQ ID NO: 63), EcYbjL (SEQ ID NO: 64), EcYfbR (SEQ ID NO: 65), EcYieH (SEQ ID NO: 66), EcYjgL (SEQ ID NO : 67) , Ec YjjG (SEQ ID AT THE: 68), EcYrfG (SEQ ID AT THE: 69), EcYbiU (SEQ ID AT THE: 70), ScDOGl (SEQ ID AT THE: 71) and BsAral .. (SEQ: ID NO : 72).
[00136] The yeast expression plasmid p2a_2p_SL-glmS is based on p2a_2p_sia, but modified in a way that K1LAC12 (lactose permease from Kluyveromyces lactis), NmneuA (CMP syntactic acid synthase and Neisseria meningitis') are also expressed (Photobacterium damselae sialyltransferase).
[00137] Plasmids were maintained in the host E. coli DH5alfa (F-, phi80dlacZdeltaM15, delta (lacZYA-argF) U169, deoR, recAl, endAl, hsdR17 (rk-, mk +), phoA, supE44, lambda-, ti -1, gyrA96, relal). Purchased from Invitrogen.
Gene expression promoters [00138] Genes are expressed using synthetic constitutive promoters, as described by Blazeck in (Biotechnology and Bioengineering, Vol. 109, No. 11, 2012).
Heterologous and homologous expression [00139] The genes that needed to be expressed, from a plasmid or the genome, were synthesized synthetically with one of the following companies: DNA2.0,
Petition 870190058857, of 6/25/2019, p. 80/132
72/106
Gen9 or IDT.
[00140] Expression can be further facilitated by optimizing the use of codons for the use of codons from the expression host. Genes were optimized using the supplier's tools.
Cultivation conditions [00141] In general, yeast strains were initially cultured on SD CSM plates to obtain individual colonies. These plates were grown for 2-3 days at 30 ° C.
[00142] From a single colony, the pre-culture was grown overnight in 5 mL at 30 ° C, shaking at 200 rpm. Subsequent shaking experiments of 500 mL were inoculated with 2% of this pre-culture, in 100 mL of medium. These shake flasks were incubated at 30 ° C with 200 rpm orbital shaking. The use of an inducer is not necessary, since all genes are expressed constitutively.
Material and methods Bacillus subtilis
Means [00143] Two different means are used, namely a rich Luria Broth (LB), a minimal means to shake the bottle (MMsf). The minimum medium uses a mix of trace elements.
[00144] Mixture of the trace element of 0.735 g / L of CaC12.2H20, 0.1 g / L of MnCl2.2H20, 0.033 g / L of CuCl2.2H20, 0.06 g / L of CoC12.6H20, 0 , 17 g / L of ZnCl2, XX g / L of H3B04, XX g / L of Na2EDTA.2H20 and Na2Mo04 0.06 g / L. The Fe-citrate solution contained 0. 135 g / L of
Petition 870190058857, of 6/25/2019, p. 81/132
73/106
FeC13.6H20, 1 g / L Na-Citrate (Hoch 1973 PMC1212887).
[00145] The Luria Broth (LB) medium consisted of 1% tryptone peptone (Difco, Erembodegem, Belgium), 0.5% yeast extract (Difco) and 0.5% sodium chloride (VWR, Leuven, Belgium).
[00146] The Luria Broth agar (LBA) plates consisted of the LB medium, with 12 g / L of agar (Difco, Erembodegem, Belgium) added.
[00147] The minimum medium for shaken flask experiments (MMsf) contains 2 g / L (NH4) 2S04, 7.5 g / L KH2P04, 17.5 K / L K2HP04, 1.25 g / L Na-Citrate, 0.25 g / L MgSO4.7H20, 0.05 g / LL tryptophan, 10 to 30 g / L glucose or other carbon source including, but not limited to, glucose, fructose, maltose, glycerol and maltotriose, 10 mL / L of mixture of trace elements and 10mL / L of Fe-citrate solution. The medium was adjusted to pH 7 with 1M KOH.
[00148] Complex medium, for example, LB, was sterilized by autoclave (121 ° C, 21) and minimum medium (MMsf) by filtration (0.22 pm Sartorius). If necessary, the medium was made selective by adding an antibiotic (eg, zeocin (20 mg / 1)).
Strains [00149] Bacillus subtilis 168, available from the Bacillus Genetic Stock Center (Ohio, USA).
Plasmids and gene overexpression [00150] Plasmids for gene deletion via Cre / lox are constructed as described by Yan et al. (Applial & microbial environment, sept 2008, p5556-5562).
[00151] Expression vectors can be
Petition 870190058857, of 6/25/2019, p. 82/132
74/106 found in Mobitec (Germany), or ATCC (ATCC® number 87056). The BsglmS, ScGNAl and CjneuB genes are cloned into these expression vectors. A promoter suitable for expression can be derived from the part repository (iGem): sequence id: BBa_K143012, BBa_K823000, BBa_K823002 or BBa_K823003. Cloning can be performed using the Gibson set, Golden Gate assembly, Cliva assembly, LCR or restriction bond.
[00152] Plasmids are maintained in the host E. coll DH5alpha (F, phi 8OdlacZdeltaMl5, delta (lacZYAargF) E16y, deoR, recAl, endAl, hsdR17 (rk, mk ⁺ ), phoA, supE44, lambda, thi-1, gyrA96 relAl). Bought from Invitrogen.
Disruptions of the gene [00153] The disruption of genes is done through homologous recombination with linear DNA and transformation through electroporation as described by Xue et al. (J. microb Meth. 34 (1999) 183-191). The method of genetic cutting is described by Liu et al. (Metab. Engine 24 (2014) 61-69). This method uses 1000 bp homologies upstream and downstream of the target gene. The homologies to be used in this invention are listed in table D. After the modification, the mutants are checked using primers upstream and downstream of the modified region. These primers are shown in table E. Then, the modification is confirmed by sequencing (performed at LGC Genomics (LGC group, Germany)).
Petition 870190058857, of 6/25/2019, p. 83/132
75/106 [00154] Table D
Gene to be disrupted Homology to montabte Downstream homology nagAnagB Gactgcaagatttcggcctgggcg gacgggaatcgtcagttttgtaat ttctgtatcaatgattttcatggt ctcttcctcaagtccgagccggtc gtattgcttgccctgctcccagag ttcaagattcatgacaatcgtgat tcgtttattgcttctgaccgcgcc agcgccaaatagcgtcatcacatt gataatgccaaggcccctgatctc aagaaggtgctcaattaattccgg agcgtttcccacaagagtatcctg atcctcctgccgtatttcaacgca atcatcggcaacaaggcgatgccc tcttttcacaagctctagcgctgt ttcgctttttccgacgccgctttt tcctgtgatcagcacgccgacacc atatatatcgacaagaacgccatg aattgctgtggtaggcgccagcct gctctcaaggaagttggttaaacg gcttgacagtcttgtcgttttcag cggcgatctgaggacaggcacccc atttttctcggaggcgtcaatcag ctcctgcgggatgggcatatctct agaaagaataatagctggtgttac atcagtgcacagagaatccattcg ctgctttttctcctcttcaggaag ctgttcaaagaaagaaagctctgt ttttccgagaagctgcacgcgctc cctcgggtaatatgtaaaatatcc ggcaatttcaatacctggtcttga taggtcactcattgtaatcgggcg gttaattccttcttctccgctgat taattccaaattgaactgttccat tacgtcttttgtgcgaacctttgc cacgatatgttcctcctgttccgg gctgccccgagcttgctcacaata ctttcattttatcactttcgggct tgaacctaaaacagattttataaa aggggggaaaacacctcagctggt ctagatcactagtctgaaaaagag Aaggaacatgctgacttatgaata tcaataaacaatcgcctattccga tttactatcagattatggagcaat taaaaacccaaattaagaacggag agctgcagccggatatgcctcttc cttctgagcgcgaatatgccgaac aattcgggatcagccggatgacag ttcgccaggcgctttctaatttag ttaatgaaggcttgctctatcgcc tgaaagggcggggcacctttgtca gcaagccaaaaatggaacaagcac ttcaagggctgacaagctttaccg aggatatgaaaagccgcgggatga caccgggcagcaggctcattgatt atcagcttattgattcaactgagg agctcgcggctatattaggctgcg ggcacccctcctctatccataaaa tcactcgggtgcggctggcaaatg atattccgatggcgattgagtcct cacatattccgtttgagcttgcgg gtgaattgaacgaatcgcattttc agtcgtcgatctatgatcatattg aaaggtacaacagcataccgattt cccgtgcaaaacaggagcttgagc caagcgctgccaccacggaagaag cgaatattcttggtattcaaaagg gagcgcctgtcctattaattaaac gaacaacatatctgcagaacggaa ctgcttttgagcatgcaaaatccg tatacagaggcgaccgttatacat ttgtccactatatggatcgtcttt cataaaaaaagcctccaacccttt ttaaggattggagacatggcgaaa atcaaactggtctggtgccggacg atatgtttcttttttcgtcttgaa cttccagatcggtgatttcgtttt gccgttaaaactgtcttccactat aatgtaccaataataaacagactg cggttcaagatgatcccagcggaa ttcagctgtgtccccgctcttcac
Petition 870190058857, of 6/25/2019, p. 84/132
76/106
taaaataaaggtattcaaattcca gaaaggcggatcatct (SEQ ID NO: 33) ttgctcccgttttccgagctcttc attggtatatacgtta (SEQ ID NO: 34) gamma Tggcggacatggaataaatcacaa acgacaaagatgacgccggcaaga atagagttaatcaaatagagcacg ggcgcaacgaacaagaaagaaaac tcaaccggttctgtaattccggtc agcatagatgtgagcgccgcagaa atcatcacgccggagatcattttt ttcttttccggacgcgcggtatgg ataatggcaagagcaacggccggc agacagaaaatcatgtaagggaaa tcccccatcataaagcgcccggct gtcgggtctcccgcgaaaaacctt gtcaggtcgccggttacggtgttg cctgttgatgggtctgtgtattct cccatcataaaatagaaaggcgta taaaaaatatgatgcaggccaaaa ggaatcagcaaacgatagatcgtt gcataaaagaacaggccgactgtt gaatcggcaattaaactgctggct gcgttaattccgttttggatcagc ggccaaacgaatgagaaaatgacg ccgatcaccaatgaactgacggaa gtaatgatcgggacaaagcgtttt ccagagaaaaatccaaggaccgga tgcagctcgattgatgaaaatcgc ttatataaataggcggcgagaagc ccgataatgattcctccgaaaacc cccatatcaatcaggtgctcggct ccttcatacggaggctgaaggccg agtaattttcccatattgtcgagg gtgacggttaaaattaagtatccg atgacagcggcaagtccggctaca ccttctccgccggctaatccgatc gcgacccccacggcgaaaatcagc ggaaggttatcgaatacaacgccg cccgcatcctttataatagggatg ttcagtaaatccttgtctccgaaa cggagcaaaagacctgctgccggc aggacggcaaccggagtcatcaac gcgcggccaagctgctgcagaatt tgaaatgcctttttaaacatgaca Gtgacaccccctcaaagagataga caagcaccatatttgttatgacca atttatgatacttgtcattacgaa tttagcaccgcccttatcaaactg tcaatattaatttctgaaaatttg ttataaaagaaggatacaaatctt tcatattgggagggcaaatggtat tatggtctcaatgaaaaagaacgg attgcatacagaatggggagaatg aaatgacagctttatattctgtta tcaagtttaaaatcattgagttaa ttaaatcgggcaaatatcaggcga atgatcagctgccgacggagagtg agttttgcgaacaatatgatgtca gcagaacaactgtgagactggctc tgcagcagctagagcttgagggat atattaaaagaattcaaggaaaag ggacatttgtatcggcggccaaaa tacaaacgccgattccgcataaga ttacgagctttgcagaacaaatga gaggacttcgttctgaatcaaaag tgcttgagcttgtggtgattcctg ccgatcattccatcgccgagcttt tgaaaatgaaagagaatgaacctg tcaacaagcttgtcagagtcagat acgccgagggggaacctttgcagt atcatacctcatatattccctgga aggcggcaccggggctggcgcagg aggaatgcaccggctcgctgtttg aattgttaaggacaaaatacaata ttgaaatcagcaggggcacggaat cgatcgaaccgattttaacggatg aaacgatcagcggacacttattaa ccaatgtcggagcgcctgcgtttt tatcagaatcccttacctatgata aaaatgaagaagtggtggaatatg cgcaaattattacacggggagacc gaacgaaattcaccgtagaacagt catatcattcataaagcaatgtgt tttaagaagggaatggtggttcta tgtttttatttacgaatggaaaag
Petition 870190058857, of 6/25/2019, p. 85/132
77/106
gtctccttttattgtg (SEQ ID NO: 35) tgctgtggggagcagt (SEQ ID NO: 36)
[00155] Table Ε
Target gene Fw Trainer RV Trainer nagA-nagB Tgtaatcgggcggttaattc(SEQ ID NO: 37) Gccctttcaggcgatagag(SEQ ID NO: 38) gamma Acggcgaaaatcagcggaag(SEQ ID NO: 39) Tcactctccgtcggcagctg(SEQ ID NO: 40)
Heterologous and homologous expression [00156] The genes that needed to be expressed, from a plasmid or the genome, were synthesized synthetically with one of the following companies: DNA2.0, Gen9 or IDT.
[00157] Expression can be further facilitated by optimizing the use of codons for the use of codons from the expression host. Genes were optimized using the supplier's tools.
Cultivation conditions [00158] A pre-culture, from a single colony to LB-plate, in 5 mL of LB medium was incubated for 8 h at 37 ° C in an orbital shaker at 200 rpm. From this culture, 1 ml was transferred to 100 ml of minimal medium (MMsf) in a 500 ml shaking flask and incubated under 37 ° C on an orbital shaker at 200 rpm. This setting is used for shake flask experiments. The use of an inducer is not necessary, since all genes are expressed constitutively.
Petition 870190058857, of 6/25/2019, p. 86/132
78/106
Analytical methods
Optical density [00159] The cell density of the culture was monitored by measuring the optical density at 600 nm (Implen Nanophotometer NP80, Westburg, Belgium). Cell dry weight was obtained by centrifugation (10 min, 5000 g, Legend X1R Thermo Scientific, Belgium) of 20 g of reactor broth in pre-dried and weighted falcons. The pellets were then washed once with 20 ml of saline (9 g / 1 NaCl) and dried at 70 ° C to a constant weight. To be able to convert 0D6oonm to the biomass concentrations, a correlation curve from OD6oo nm to the biomass concentration was created.
Cell dry weight measurement [00160] From a broth sample, 4 x 10 g were transferred to centrifugation tubes, the cells were centrifuged (5000g, 4 ° C, 5 min.) And the cells were washed twice with 0.9% NaCl solution. The centrifugation tubes containing the cell granules were dried in an oven at 70 ° C for 48 h until constant weight. The dry cell weight was obtained gravimetrically; The tubes were cooled in a desiccator before weighing.
Liquid chromatography [00161] The concentration of carbohydrates as, but not limited to, glucose, fructose and lactose was determined with a Waters Acquity UPLC class H system with an ELSD detector, using an UPLC BEH amide from Acquity, 130 A, 1.7 pm, 2.1 mm x 50 mm was heated to 35 ° C using a 75/25 acetonitrile / water solution with
Petition 870190058857, of 6/25/2019, p. 87/132
79/106
0.2% triethylamine (0.130 ml / min.) As a mobile phase.
[00162] Sialylactose was quantified in the same machine, with the same column. However, the eluent was modified to 75/25 of acetonitrile / water solution with 1% formic acid. The flow rate was adjusted to 0.130 ml / min. and the column temperature at 35 ° C.
[00163] Sialic acid was quantified in the same machine, using the REZEX ROA column (300 x 7.8 mm ID). The eluent is 0.08% acetic acid in water. The flow rate was adjusted to 0.5 ml / min. and the column temperature to 65 ° C. GlcNAc and ManNAc were also measured using this method.
Growth rate measurement [00164] The maximum growth rate (pMax) was calculated based on the optical densities observed at 600 nm using the R grofit package
Example 2: sialic acid production in Escherichia coli
[00165] a first example provides an strain from Escherichia coli able to to produce N- acetylneuraminate (sialic acid) (see Figure 1B). [00166] An strain cape z to accumulate glucosamine-
6-phosphate using sucrose as a carbon source was later modified to allow the production of Nacetylneuraminate. The base strain overexpresses Bifidobacterium adolescentis sucrose phosphorylase (BaSP), Zymomonas mobilis fructocinase (Zmfrk), mutant fructose-6-Paminotransferase (EcglmS * 54, as described by Deng et al. (Biochimie 88, 419- 429 (2006))). To allow the production of sialic acid from the gene, the operons nagABCDE, nanatek and manXYZ were stopped. BaSP and
Petition 870190058857, of 6/25/2019, p. 88/132
80/106
Zmfrk were introduced at the nagABCDE site and EcglmS * 54 was introduced at the nanatek site. These modifications were made as described in example 1 and are based on the principle of Datsenko & Wanner (PNAS USA 97, 6640-6645 (2000)).
[00167] In this strain, the biosynthetic pathway for the production of sialic acid, as described in this invention, was implemented by the overexpression of Saccharomyces cerevisiae glycosamine-6-Paminotransferase (ScGNAl), for N-acetylglycosamine-2-Bacteroides epimerase ovatus (BoAGE) and a syntactic acid synthase from Campylobacter jejuni (CjneuB). ScGNAl and BoAGE were expressed at nagABCDE and manXYZ, respectively. CjneuB was expressed using the high copy number plasmid pCXCjneuB.
[00168] The strain was grown as described in example 1 (materials and methods). Briefly, 5 ml of a LB pre-culture was inoculated and grown overnight at 37 ° C. This culture was used as an inoculum in a shaking flask experiment with 100 mL of medium containing 10 g / L of sucrose and was done as described in example 1. Regular samples were collected and analyzed as described in 1. The evolution of the concentrations of biomass, sucrose and sialic acid are easily followed and a final concentration of 0.22 g / L of N-acetylneuraminate was produced extracellularly, as can be seen in figure 2.
[00169] The same organism also produces Nacetylneuraminate based on glucose, maltose or glycerol as a carbon source.
Petition 870190058857, of 6/25/2019, p. 89/132
81/106
Example 3: 6-sialylactose production in Escherichia coli [00170] Another example according to the invention is the use of the method and strains for the production of 6-sialylactose.
[00171] The strain of example 3 is a daughter strain of the strain used in example 2. The strain is further modified by over-expression for Escherichia coli lactase permease (as described and demonstrated in example 1 of WO 2016/075243 which it is also included in the present case by reference), to CMP-sialic acid synthase of Neisseria meningitides (NmneuA) and to sialyltransferase of Photobacterium damselae (Pdbst). In addition, lacZ is stopped.
[00172] The NmneuA and Pdbst genes are expressed from a plasmid, together with CjneuB. This plasmid is comprised of pCX-CjneuB-NmneuA-Pdbst and is made as described in example 1.
[00173] Said strain is inoculated as a pre-culture consisting of 5 ml of LB medium as described in example 1. After growing overnight at 37 ° C in an incubator, 1% of this pre-culture is inoculated in a shaking bottle containing 100 ml of medium (MMsf) containing 10 g / l of sucrose as a carbon source and 10 g / 1 of lactose as a precursor. The strain is grown for 300 h at 37 ° C.
[00174] This strain produces amounts of 6 sialillactose.
Example 4: production of sialic acid in Saccharomyces cerevisiae ____ using ____ fructose-6-P-aminotrans heterologous erase
Petition 870190058857, of 6/25/2019, p. 90/132
82/106 [00175] Another example provides the use of a eukaryotic organism, in the form of Saccharomyces cerevisae, for the invention. This method using the route of the invention will be obtained in Saccharomyces cerevisiae by introducing and expressing N-acetylglucosamine-2-epimerase (for example Bacteroides ovatus (BoAGE)) and synaptic acid synapses (for example Campylobacter jejuni (CjneuB)) ).
[00176] As a starting point, a strain with increased metabolic flow for Nacetylglycosamine-6-phosphate is needed. This is achieved by overexpression of the Escherichia coli fructose-6-P-aminotransferase mutant (EcglmS * 54).
[00177] To create a Saccharomyces cerevisiae-producing N-acetylneuraminate according to this invention, the genes were introduced via a 2 micron plasmid (Chan 2013 (Plasmid 70 (2013) 2-17)) and the genes are expressed using if synthetic constitutive promoters (Blazeck 2012 (Biotechnology and Bioengineering,
Vol. 109, Νϊ ^ 11)) well as described in example 1. 0 plasmid specific used in this concretization is p2a_2p_sia_ _glmS. This one plasmid is introduced in Saccharomyces cerevisae using the technique in
transformation described by Gietz and Woods (2002, PMID 12073338) and a mutant strain is obtained.
[00178] Said strain is capable of converting fructose-6-phosphate to glucosamine-6-phosphate, followed by conversion of glucosamine-6-phosphate to N-acetylglycosamine6-phosphate. This portion of N-acetylglucosamine-6-phosphate is further converted to N-acetylglucosamine, said N
Petition 870190058857, of 6/25/2019, p. 91/132
83/106 acetylglucosamine in N-acetyl-manamine and finally this Nacetylmannosamine is converted into N-acetylneuraminate.
[00179] A pre-culture of said strain is performed in 5 ml of the defined synthetic medium SD-CSM containing 22 g / 1 of glucose and grown at 30 ° C as described in example 1. This pre-culture is inoculated in 100 ml of medium in a stirring with 10 g / 1 of carbon source sucrose and grown at 30 ° C. Regular samples are taken and the production of N-acetylneuraminate is measured as described in 1. This strain and method produces amounts of N-acetylneuraminate.
[00180] The same organism also produces Nacetylneuraminate based on glucose, maltose or glycerol as a carbon source.
Example 5: Production of 6-sialylactose in Saccharomyces cerevisiae [00181] Another example provides the use of a eukaryotic organism, in the form of Saccharomyces cerevisae, for the invention. This method using the route of the invention will be obtained in Saccharomyces cerevisiae by introducing and expressing N-acetylglucosamine-2-epimerase (for example Bacteroides ovatus (BoAGE)) and synaptic acid synapses (for example Campylobacter jejuni (CjneuB)) [00182] In addition, other modifications are made to produce 6sillylactose. These modifications include the addition of a lactose permease, CMP syntactic acid synthase and sialyltransferase. The preferred lactose permease is the K1LAC12 gene from Kluyveromyces lactis (WO 2016/075243). The preferred CMP synthase of sic acid and
Petition 870190058857, of 6/25/2019, p. 92/132
84/106 sialyltransferase are Neisseria meningitides NmneuA and Photobacterium damselae Pdbst, respectively, as described in example 3.
[00183] As a starting point, a strain with increased metabolic flow for Nacetylglycosamine-6-phosphate is needed. This is achieved by overexpression of the Escherichia coli fructose-6-P-aminotransferase mutant (EcglmS * 54).
[00184] To create a Saccharomyces cerevisiae-producing N-acetylneuraminate according to this invention, the genes were introduced via a 2 micron plasmid (Chan 2013 (Plasmid 70 (2013) 2-17)) and the genes are expressed using if synthetic constitutive promoters (Blazeck 2012 (Biotechnology and Bioengineering, Vol. 109, Νϊ ^ Ή 11)) as well as described in example 1. The specific plasmid used in this embodiment is comprised of p2a_2p_sia_glmS. This plasmid is introduced into Saccharomyces cerevisae using the transformation technique described by Gietz and Woods (2002) and a mutant strain is obtained.
[00185] Said strain is capable of converting fructose-6-phosphate to glucosamine-6-phosphate, said glucosamine-6-phosphate to N-acetylglycosamine-6-phosphate, said N-acetylglycosamine-6-phosphate to Nacetylglycosamine , said N-acetylglycosamine. in Nacetylmannosamine and finally said N-acetylmannosamine in N-acetylneuraminate. Said N-acetyl-manamine is then converted to sialic acid-CMP and transferred to lactose to obtain 6-silylactose.
[00186] A pre-culture of the said strain is
Petition 870190058857, of 6/25/2019, p. 93/132
85/106 performed in 5 mL of the defined SD-CSM synthetic medium containing 22 g / 1 of glucose and grown at 30 ° C as described in example 1. This preculture is inoculated into 100 mL of medium in a 10 g agitation / 1 sucrose carbon source and grown at 30 ° C. Regular samples are taken and the production of N-acetylneuraminate is measured as described:
1 . This strain and method produce quantities in ilosilylactose. ^ [00187] The same organism also produces N-
glucose, maltose or glycerol acetylneuraminate as a carbon source.
Example 6: production of sialic acid in Saccharomyces cerevisiae ____ using ____ autologous fructose-6-P-aminotransferase [00188] Another example provides the use of a eukaryotic organism, in the form of Saccharomyces cerevisae, for the invention. This method using the route of the invention will be obtained in Saccharomyces cerevisiae by introducing and expressing N-acetylglycosamine-2-epimerase (for example, Bacteroides ovatus (BoAGE)) and synaptic acid synapses (for example, Campylobacter jejuni (CjneuB) ).
[00189] As a starting point, a strain with increased metabolic flow for Nacetylglycosamine-6-phosphate is needed. This is achieved by overexpression of native ScGFAl fructose-6-P-aminotransferase.
[00190] To create a Saccharomyces cerevisiae-producing N-acetylneuraminate according to this invention, the genes were introduced via plasmid
Petition 870190058857, of 6/25/2019, p. 94/132
86/106 of 2 microns (Chan 2013 (Plasmid 70 (2013) 2-17)) and genes are expressed using synthetic constitutive promoters (Blazeck 2012 (Biotechnology and Bioengineering, Vol. 109, No. 11)), as well as described in example 1. The specific plasmid used in this embodiment is comprised of p2a_2p_sia_GFAl. This plasmid is introduced into Saccharomyces cerevisae using the transformation technique described by Gietz and Woods (2002) and a mutant strain is obtained.
[00191] Said strain is capable of converting fructose-6-phosphate to glucosamine-6-phosphate, said glucosamine-6-phosphate to N-acetylglycosamine-6-phosphate, said N-acetylglycosamine-6-phosphate to Nacetylglycosamine. N-acetylglucosamine in Nacetylmannosamine and finally said N-acetylmannosamine in N-acetylneuraminate.
[00192] A pre-culture of said strain is performed in 5mL of the defined synthetic medium SD-CSM containing 22 g / 1 of glucose and developed at 30 ° C as described in example 1. This pre-culture is inoculated in 100 ml of medium in a stirring with 10 g / 1 of carbon source sucrose and grown at 30 ° C. Regular samples are taken and the production of N-acetylneuraminate is measured as described in 1. This strain and method produces amounts of Nacetylneuraminate.
[00193] The same organism also produces Nacetylneuraminate based on glucose, maltose or glycerol as a carbon source.
Petition 870190058857, of 6/25/2019, p. 95/132
87/106
Example 7: production of sialylactoses and other sialylated compounds [00194] In an alternative embodiment of example 3, the sialyltransferase is changed to another sialyltransferase with different activity. This can be an alpha-2,3-sialyltransferase alpha-2,6-sialyltransferase, an alpha-2,8-sialyltransferase or a combination of these. These sialyltransferases are widely available in nature and are well noted.
In this way, the production of different sialylates such as, for example, 6 sialylactose, 3-sialylactose or a mixture thereof can be obtained.
[00196] Strains are grown as shown in example 1 and example 3.
[00197] The pathways created in examples 2 to 7 can also be combined with other pathways for the synthesis of larger oligosaccharides, e.g. sialyl-lacto-N-triose, sialylact-N-tetraose, dysiallllactose-N-tetraose, siallyl-N-neotetraose and dysiallllactose-N-neotetraose. To this end, transferases to synthesize these glycosidic bonds are co-expressed with genes in the pathway to form CMP-sialic acid and transferase (as described previously in the present case) to sialyate said oligosaccharide.
[00198] Examples of such sialyltransferases are comprised of ST6GalI, ST6GalII, ST3GalI until VI, ST6GalNAc I until VI and ST8Sia I through VI, as described by Datta (Current Drug Targets, 2009, 10, 483-498) and Harduin-Lepers ( Biochimie 83 (2001) 727-737). Other examples from marine organisms are described
Petition 870190058857, of 6/25/2019, p. 96/132
88/106 by Yamamoto (Mar. Drugs 2010, 8, 2781-2794).
Example 8: production of sialylated lacto-N-neotetraose [00199] The purpose of this experiment was to demonstrate the functionality of the present invention in the production of other sialylated oligosaccharides, in this case lacto-N-neotetraose sialylate.
[00200] A lacto-Nneotetraose producing strain was developed following the protocol described in example 1. For production, the expression of a Nacetylglucosaminyl transferase and a galactosyl transferase are necessary, this is achieved by the introduction of the NmlgtA and NmlgtB genes respectively, both from Neisseria, meningitis. Next, the lactose importer EclacY from Escherichia coli is (as described and demonstrated in example 1 of WO 2016/075243 which is also included in this context by reference). Finally, the ushA and galT genes are eliminated. In this way, a lacto-N-neotetraose producing strain is obtained.
[00201] To be able to grow in lactose and produce N-acetylglycosamine-6-phosphate, Bifidobacterium adolescentis sacarosphosphorylase (BaSP), Zymomonas mobilis fructokinase (frk) and mutant fructose-6-Paminotransferase (EcglmS * 54, as described by Deng et al. (Biochimie 88, 419-429 (2006))) were overexpressed as described in example 1.
[00202] In this strain, the method for producing sialic acid, as described in this invention, was accomplished through the overexpression of Saccharomyces cerevisiae glycosamine-6-Paminotransferase (ScGNAl) to N-acetylglycosamine-2-epimerase from Bacteroides ovatus
Petition 870190058857, of 6/25/2019, p. 97/132
89/106 (BoAGE) and Synaptic acid synthase of Campylobacter jejuni (CjneuB). ScGNAl and BoAGE are expressed at the nagABCDE and manXYZ locations, respectively. CjneuB is expressed from plasmid pCX-CjneuB-NmneuA-Pdbst.
[00203] The sialylation of the lacto-Nneotetraose portion is carried out by converting sialic acid to CMP salicylic acid by a CMP sialic acid synthase, p. Neisseria meningtides NmneuA, subsequently followed by a sialyltransferase, p. Pdbst, from Photobacterium damselae. These genes (NmneuA and Pdbst) are expressed from the high copy plasmid pCX-CjneuB-NmneuA-Pdbst.
[00204] The strain is grown as described in example 1 (materials and methods). Briefly, 5mL of LB pre-culture is inoculated and grown overnight at 37 ° C. This culture was used as an inoculum in a shaking flask experiment with 100 mL of medium containing 10 g / L of sucrose as a source of carbon and energy, 10g / L of lactose as a precursor and was performed according to the description in example 1. Regular samples are collected and analyzed. This strain produces amounts of sialylated lacto-Nneotetraose.
[00205] Alternative glycosyltransferases are possible. If EcWgbO (from Escherichia coli 055: H7) is expressed instead of NmlgtB, for example, the production of sialylated lacto-N-tetraose is obtained.
Example 9: Production of sialic acid with Bacillus subtilis [00206] According to another embodiment, this invention can be used for the production of Nacetylneuraminate in Bacillus subtilis, yet another
Petition 870190058857, of 6/25/2019, p. 98/132
90/106 host of bacterial production.
[00207] A Nacetylneuraminate producing strain is obtained through this invention, starting from a strain capable of overproducing glucosamine-6-phosphate intracellularly. For this, native fructose-6-paminotransferase (BsglmS) is overexpressed. The following enzymatic activities are interrupted by the elimination of the nagA, nagB and gamA genes: Nacetylglycosamine-6-phosphate deacetylase and glycosamine-6 phosphate isomerase.
[00208] In this strain, the method for the production of sialic acid, as described in this invention, is accomplished by the overexpression of Saccharomyces cerevisiae glycosamine-6-P-aminotransferase (ScGNAl), N-acetylglycosamine-2epimerase of Bacteroides ovatus (BoAGE) and Synaptic acid synthase of Campylobacter jejuni (CjneuB). These genes were introduced through a plasmid, as described in example 1.
[00209] The strain is grown as described in example 1 (materials and methods). Briefly, 5 ml of LB pre-culture is inoculated and grown overnight at 30 ° C. This culture is used as an inoculum in a shaking flask experiment with 100 ml of medium containing 10 g / L of sucrose and is prepared according to the description in example 1. This strain produces amounts of Nacetylneuraminic acid.
Example 10: Fermentation of the 6 sialylactose producing strain without excretion of GlcNAc, ManNAc or sialic acid [00210] Another example, according to a
Petition 870190058857, of 6/25/2019, p. 99/132
91/106 present invention, provides the use of the method and strains for the production of 6-sialyl-lactose.
[00211] An Escherichia coli strain capable of accumulating glucosamine-6-phosphate using sucrose as a carbon source was further designed to allow the production of N-acetylneuraminate. This base strain overexpresses Bifidobacterium adolescent is sucrose phosphorylase (BaSP), Zymomonas mobilis fructocinase (Zmfrk), mutant fructose-6-P-aminotransferase (EcglmS * 54, as described by Deng et al. (Biochimie 88, 419 - 429 (2006).) To allow the production of 6-sialylactose, the operons nagABCDE, nanatek and manXYZ were interrupted BaSP and Zmfrk were introduced at the nagABCDE site, EcglmS * 54 were introduced at the nanATEK location described in example 1 and are based on the Datsenko & Wanner principle (PNAS USA 97, 6640-6645 (2000)).
[00212] In this strain, the biosynthetic pathway for the production of 6-sialylactose, as described in this invention, was accomplished by the overexpression of Saccharomyces cerevisiae glycosamine-6-P-aminotransferase (ScGNAl), for N-acetylglycosamine-2- Bacteroid ovatus epimerase (BoAGE) and a syntactic acid synthase from Neisseria meningitides (NmneuB). ScGNAl and BoAGE were expressed at nagABCDE and manXYZ, respectively. NmNeuB was expressed using the high copy plasmid pBR322-NmNeuB. The strain is further modified by overexpression for lactose permease EclacY from Escherichia coli (as described and demonstrated in example 1 of WO 2016/075243 which is included by reference), for CMP-sialic acid
Petition 870190058857, of 6/25/2019, p. 100/132
92/106 Neisseria meningitides synthase (NmNeuA) and a Photobacterium damselae sialyltransferase (Pdbst). In addition, lacZ is stopped. NmNeuA and Pdbst were expressed using the low copy number plasmid pSClOlNmneuA-Pdbst m, the biosynthetic pathway for the production of 6sylylactose, as described in this invention, was implemented by the overexpression of Saccharomyces cerevisiae glycosamine-6-Paminotransferase (ScNAl) , for Bacteroides ovatus N-acetylglycosamine-2-epimerase (BoAGE) and a syntactic acid synthase from Neisseria meningitides (NmneuB). ScGNAl and BoAGE were expressed at nagABCDE and manXYZ, respectively. NmNeuB was expressed using the high copy plasmid pBR322-NmNeuB. The strain is further modified by overexpression for lactose permease EclacY from Escherichia coli (as described and demonstrated in example 1 of WO 2016/075243 which is included in the present case by reference), for CMP-sialic acid synthase of Neisseria meningitides ( NmNeuA) and a Photobacterium damselae sialyltransferase (Pdbst). In addition, lacZ is stopped. NmNeuA and Pdbst were expressed using the low copy number plasmid pSClOl-NmneuA-Pdbst.
[00213] The strain was grown in a bioreactor as described in example 1 (materials and methods). Briefly, the 5 ml LB pre-culture was inoculated and grown overnight at 37 ° C. This culture was used as an inoculum in a shaking flask experiment with 500 mL of medium containing 10 g / L of sucrose and was prepared as described in 1. This culture was used as an inoculum in a bioreactor experiment.
Petition 870190058857, of 6/25/2019, p. 101/132
93/106
L. Regular samples were taken and analyzed as described in example 1. The final concentration of 6siallylactose was 30.5 g / 1. Non-extracellular GlcNAc, Mannac and sialic acid were detected during fermentation and in the final broth.
[00214] The same organism also produces 6sialylactose based on glucose, maltose or glycerol as a carbon source.
Example 11: Effect of phosphatase on the growth and production of sialic acid [00215] Another example provides results of growth and production of sialic acid from various strains of Escherichia coli capable of producing N-acetylneuraminate (sialic acid) in which the strains express a extra phosphatase as indicated below.
[00216] The base strain overexpresses a mutant 6-P-aminotransferase fructose (EcglmS * 54, as described by Deng et al. (Biochimie 88, 419-429 (2006)), for Saccharomyces glycosamine-6-P-aminotransferase cerevisiae (ScGNAl), Bacteroides ovatus N-acetylglycosamine-2-epimerase (BoAGE) and Campylobacter jejuni syntactic acid silica (CjneuB) To allow the production of sialic acid from the operon nagABCDE and nanATEK genes The operon lacYZA was replaced by only a single gene operon, the native lacY, which is required for the production of sialylactose as described in 10. These changes were made as described in example 1 and are based on the principle of Datsenko & Wanner (PNAS USA 97, 6640-6645 (2000)).
Petition 870190058857, of 6/25/2019, p. 102/132
94/106 [00217]
This base strain was then supplemented with different plasmids containing phosphatase to compare the effect of phosphatase on sialic acid growth and production. The base strain was used as white in the comparison. These plasmids consisted, in addition to phosphatase and a promoter, directing phosphatase expression, pSClOl ori and a spectomycin resistance marker. The following phosphatases were expressed: EcAphA (SEQ ID NO: 42), EcCof (SEQ ID NO: 43), EcHisB (SEQ ID NO: 44), EcOtsB (SEQ ID NO: 45), EcSurE (SEQ ID NO: 46) , EcYaed (SEQ ID NO: 47), EcYcjU (SEQ ID NO: 48), EcYedP (SEQ ID NO: 49), EcYfbT (SEQ ID NO: 50), EcYidA (SEQ ID NO: 51), EcYigB (SEQ ID NO: 51) NO: 52), EcYihX (SEQ ID NO: 53), EcYniC (SEQ ID NO: 54), EcYqaB (SEQ ID NO: 55), EcYrbL (SEQ ID NO: 56) and PsMupP (SEQ ID NO: 57). Other phosphatases that are expressed are comprised of EcAppA (SEQ ID NO: 58), EcGph (SEQ ID NO: 59), EcSerB (SEQ ID NO: 60), EcNagD (SEQ ID NO: 61), EcYbhA (SEQ ID NO: 62), EcYbiV (SEQ ID NO: 63), EcYbjL (SEQ ID NO: 64), EcYfbR (SEQ ID NO: 65), EcYieH (SEQ ID NO: 66), EcYjgL (SEQ ID NO: 67), Ec YjjG (SEQ ID NO: 68), EcYrfG (SEQ ID NO: 69), EcYbiU (SEQ ID NO: 70), ScDOGl (SEQ ID NO: 71) and BsAraL (SEQ ID NO: 72).
[00218]
In a first experiment, a subset of the strains described above was used in the present case. In a second experiment, a second subset of the strains described above was tested.
[00219]
Each strain was grown as described in example 1 (materials and methods). Briefly, the workflow consists of 3 growth stages: first growth in LB, followed by growth in MMsf with 15 g
Petition 870190058857, of 6/25/2019, p. 103/132
95/106 / L of glycerol and finally in the growth phase using 15 g / L of glycerol MMsf. The first step was performed in a 96-well plate, using 175 pL of LB per well, and incubated overnight at 37 ° C. The second step was performed in a 96-well plate using 175 pL of medium, incubated for 24 hours at 37 ° C. The final growth stage was performed in: i) in a 96-well plate using 175 pL of medium, incubated at 37 ° C to determine the pMax for the first experiment (see figure 5) and ii) in 24-well plates deep cavities using 3 mL sialic acid production and optical densities for the second experiment (see figure 4).
[00220] Reference table for Figures 4 and 5:
tag phosphatase SEQ ID NO District Attorney blank AT AT AT 1 EcAphA 42 apFAB346 2 EcAphA 42 apFAB87 3 EcCof 43 apFAB87 4 EcCof 43 apFAB346 5 EcHisB 44 apFAB346 6 EcOtsB 45 apFAB346 7 EcSurE 46 apFAB346 8 EcSurE 46 apFAB87 9 EcYaed 47 apFAB346 10 EcYaed 47 apFAB87 11 EcYcjU 48 apFAB87 12 EcYedP 49 apFAB87 13 EcYfbT 50 apFAB87 14 EcYidA 51 apFAB346 15 EcYidA 51 apFAB87 16 EcYigB 52 apFAB346 17 EcYihX 53 apFAB346 18 EcYihX 53 apFAB87 19 EcYniC 54 apFAB346 20 EcYniC 54 apFAB87
Petition 870190058857, of 6/25/2019, p. 104/132
96/106
21 EcYqaB 55 apFAB87 22 EcYqaB 55 apFAB346 23 EcYrbL 56 apFAB87 24 PsMupP 57 apFAB87
[00221] Based on Figures 4 and 5, the phosphatases that allow the strains to grow better than the white strain (without crippled growth) and produce more sialic acid than the blank strain, can be chosen.
[00222] Based on the above, it has been found that the phosphatases comprising at least Motif 1 and Motif 2 provide a strain that is not crippled and produces more sialic acid than the blank strain.
Example 12: Identification of other phosphatase-related sequences used in the methods of the invention [00223] Sequences (polypeptides) related to SEQ ID NOs: 43, 44, 45, 47, 48, 49, 50, 51, 52, 54, 55 and 57 were identified in the database between Nucleotides at the National Center for Biotechnology Information. (NCBI) using sequoia search tools from databases, such as the Basic Local Alignment Tool (BLAST) (Altschul et al. (1990) J. Mol. Biol. 215: 403-410; and Altschul et al. (1997) Nucleic acid Res 25: 3389-3402). The program is used to find regions of local similarity between sequences, comparing sequences of nude acids or polypeptides with sequence databases and calculating the statistical significance of matches. The analysis output was visualized by pairwise comparison, and classified according to the probability score (value
Petition 870190058857, of 6/25/2019, p. 105/132
97/106
E), where the score reflects the probability that a specific alignment will happen by chance (the lower the E value, the more significant the hit). In addition to the E-values, comparisons were also scored by percentage of identity. The percent identity refers to the number of identical amino acids between the two polypeptide sequences compared over a given length. In some cases, the standard parameters can be adjusted to modify the rigor of the search. For example, the E value can be increased to show less stringent matches. In this way, almost precise short starts can be identified.
[00224] Table IA at 1K provides a list of homologous polypeptide sequences related to SEQ ID NO: 43, 44, 45, 47, 48, 50, 51, 52, 54, 55 and 57, respectively.
polypeptides [00225]
Table IA: Examples of
related The Ec Cof (SEQ II D NO: 43), which mo identity of sequence for SEQ ID 43:% identity(matgat) short genbank identifier SEQAT THE 9 9.6ShigellaWP_095762248.1 flexneri 78 99, 3Shigella boydii WP_095785299.1 79 98.2EscherichiaWP_024256925.1 fergusonii 80 89, 3StaphylococcusWP_094409981.1 aureus 81 89EscherichiaWP_000113024.1 albertii 82 81, 6CitrobacterWP_046476411.1 amalonaticus 83 81, 6SalmonellaWP_023234244.1 enterica 84
ID stra a
Petition 870190058857, of 6/25/2019, p. 106/132
98/106
80.5
Escherichia
WP_088543831.1 coli 85 [00226] Table IB: Examples of Ec HisB-related polypeptides (SEQ ID NO: 44), which shows the sequence identity for SEQ ID 44:
% identity short genbank identifier SEQ ID
(matgat) AT THEShigella flexneri K-31599, 4 EIQ21345.186Escherichia albertii 87 99, 2 WP_059217413.1 Shigella flexneri 88 98, 9 WP_094085559.1 98, 6 Shigella sonnei WP_077125326.1 89Escherichia coli 90 98, 6 WP_088129012.1 Shigella dysenteriae 91 98 WP_0 00080078.1 Escherichia marmot 92 98 WP_038355110.1 Salmonella bongori 93 94, 6 WP_000080052.1
[00227] Table 1C: Examples of Ec OtsB-related polypeptides (SEQ ID NO: 45), which shows the sequence identity for SEQ ID 45:
% identity short genbank identifier SEQ ID
(matgat) AT THE 9 9.6 Shigella sonnei WP_077124555.1 94Escherichia coli 95 9 9.6 WP_032172688.1 Shigella flexneri 96 99, 2 WP_064198868.1 Escherichia albertii 97 85.7 WP_059227241.1 Escherichia fergusonii 98 83, 1 WP_000165652.1
[00228] Table ID: Examples of polypeptides
Petition 870190058857, of 6/25/2019, p. 107/132
99/106 related to Ec Yaed (SEQ ID NO: 47), which shows the sequence identity for SEQ ID 47:
% identity short genbank identifier SEQ ID
(matgat) Escherichia fergusonii AT THE99 99.5 WP_0 01140180.1 99.5 Shigella sonnei WP_047565591.1 100Escherichia coli 101 99 WP_061103769.1 Escherichia albertii 102 95, 8 WP_0 01140171.1 Kluyvera intermedia 103 93, 2 WP_047371746.1 Citrobacter koseri 104 93, 2 WP_047458784.1 Kosakonia arachidis 105 89 WP_090122712.1 Kluyvera106 85, 9 cryocrescensWP_ 061282459.1 Leclercia adecarboxylata 107 85, 9 WP_039030283.1
[00229] Table 1E: Examples of Ec YcjUB-related polypeptides (SEQ ID NO: 48), which shows the sequence identity for SEQ ID NO: 48:
% identity short genbank identifier SEQ ID NO
(matgat) Shigella sonnei 108 99.5 WP_094313132.1 Escherichia coli 109 97.7 WP_000775764.1 Escherichia coli 110 95, 4 WP_032302947.1 92.7 Shigella flexneri QUZ88260.1 111
[00230] Table 1F: Examples of polypeptides related to Ec YfbT (SEQ ID NO: 50), which shows the sequence identity for SEQ ID NO: 50:
Petition 870190058857, of 6/25/2019, p. 108/132
100/106
% identity(matgat)99, 1 short genbank identifier SEQ IDAT THEShigella sonnei WP_094323443.1 112Citrobacter werkmanii NBRC 113 87.5 105721 GAL43238.1Citrobacter freundii 114 86.6 KGZ33467.1Citrobacter amalonaticus Y19 115 86.6 AKE59306.1Salmonella enterica 116 85.6 WP_080095242.1Escherichia fergusonii 117 85.6 WP_001203376.1Salmonella enterica subsp. 118enterica serovar Hadar 85.6 KKD79316.1
[00231] Table 1G: Examples of polypeptides related to Ec YidA (SEQ ID NO: 51), which shows the sequence identity for SEQ ID NO: 51:
% identity short genbank identifier SEQ ID
(matgat) Escherichia coli AT THE119 9 9.6 WP_053263719.1 Escherichia fergusonii 120 99, 3 WP_000985562.1 99, 3 Shigella sonnei WP_0 94337696.1 121Trabulsiella guamensis 122 94.4 WP_038161262.1 Citrobacter amalonaticus 123 94.1 WP_061075826.1 Klebsiella pneumoniae 124 93.7 WP_048288968.1 Trabulsiella odontotermitis 125 93.3 WP_054178096.1 Enterobacter kobei 126 90 WP_088221256.1
[00232] Table 1H: Examples of Ec YigB-related polypeptides (SEQ ID NO: 52), which shows the sequence identity for SEQ ID NO: 52:
Petition 870190058857, of 6/25/2019, p. 109/132
101/106
O. 0 identity identifier short genbank SEQ ID (matgat) AT THE Shigella sonnei 127 99, 6 WP_094322240.1 Shigella sonnei 128 93, 7 WP_052962467.1 Salmonella enterica 129 87WP_079797638.1 Citrobacter braakii 130 85, 7 WP_080625916.1 Enterobacter hormaechei 131 81, 9 WP_047737367.1 Lelliottia amnigene 132 81, 1 WP_059180726.1 Leclercia adecarboxylata 133 80, 3 WP_039031210.1
[00233] Table II: Examples of polypeptides
related Ec YniC (SEQ ID NO: 54), which show the identity of string for SEQ ID NO: 54:% identity short genbank identifier SEQ ID (matgat) AT THEShigella flexneri 1235-66 134 85.6 EIQ75633.1 Kosakonia sacchari 135 85, 1 WP_074780431.1 Enterobacter mori 136 85, 1 WP_089599104.1 Lelliottia amnigene 137 84.7 WP_064325804.1 Enterobacter sp. 638 138 84.7 WP_012017112.1 Kosakonia radicincitans 139 84.2 WP_071920671.1 Salmonella enterica subsp. 140enterica serovar Newport str.
84.2 CDC 2010K-2159 AKD18194.1 [00234] Table 1J: Examples of Ec YqaB-related polypeptides (SEQ ID NO: 55), which shows the sequence identity for SEQ ID NO: 55:
Petition 870190058857, of 6/25/2019, p. 110/132
102/106
O. 0 identity identifier genbank I enjoy SEQ ID (matgat) AT THE Shigella flexneri K-315 141 97, 9 EIQ18779.1Escherichiaalbertii 142 93, 6 WP_059215906.1Salmonellaenterica 143 88, 3 WP_079949947.1Kluyveraintermedia 144 85, 6 WP_085006827.1Trabulsiella odontotermitis 145 85, 1 WP_054177678.1Yokenella regensburgei 146 84, 6 WP_006817298.1Raoultellaterrigena 147 84, 6 WP_045857711.1Klebsiellapneumoniae 148 83, 5 WP_064190334.1
[00235] Table 1K: Examples of polypeptides
related Ps MupP (SEQ ID NO: 57), which show the identity of sequence for SEQ ID NO: 57:% identity genbank identifier I enjoy SEQ ID (matgat) AT THEPseudomonas putida group 149 94, 6 WP_062573193.1 Pseudomonas sp. GM8 4 150 94, 6 WP_008090372.1 93.3 Pseudomonas entomophila 151Pseudomonas vranovensis 152 92.4 WP_028943668.1 Pseudomonascannabina 153 83, 9 WP_055000929.1 Pseudomonasmonteilii 154 93.3 WP_060480519.1
[00236] The sequences were provisionally assembled and publicly released by research institutions, such as the Genomic Research Institute (TIGR, starting with TA). The Ekaryotic Gene Orthologs database
Petition 870190058857, of 6/25/2019, p. 111/132
103/106 (EGO) can be used to identify such sequences, either by keyword search or using the BLAST algorithm with the nucleic acid sequence or polypeptide sequence of interest. Special nucleic acid sequence databases have been created for specific organisms, such as the Joint Genome Institute.
Example 13: Identification of domains and motifs comprised in polypeptide sequences useful in carrying out the modalities of the invention [00237] The Integrated Protein Families, Domains and Sites (InterPro) database is an integrated interface for subscription databases commonly used for text and string based searches. The InterPro database combines these databases, which use different methods and different degrees of biological information about well-defined proteins to derive protein signatures. Collaborating databases include SWISS-PROT, PROSITE, TrEMBL, PRINTS, ProDom and Pfam, Smart and TIGRFAMs. Pfam is a large collection of multiple Markov hidden sequence alignments and models covering many common protein domains and families. Pfam is hosted at the Sanger Institute in the United Kingdom. Interpro is hosted at the European Bioinformatics Institute in the United Kingdom.
[00238] The results of the InterPro search for the polypeptide sequences represented by SEQ ID NOs: 43, 44, 45, 47, 48, 49, 50, 51, 52, 54 and 55 are shown in Table 2.
Petition 870190058857, of 6/25/2019, p. 112/132
104/106 [00239] Table 2: Results of the InterPro analysis (main accession numbers) of the polypeptide sequence, represented by SEQ ID NOs: 43, 44, 45, 47, 48, 49, 50, 51, 52, 54 and 55.
Data base Accessor number in Access name Interpro IPR023214 HAD superfamily
[00240] The phosphatase polypeptides tested were aligned and Figure 6 shows part of the alignment. Reason 1 and reason 2 are indicated by boxes. The alignment was done using clustalomega.
Example 14: Effect of phosphatase on sialic acid growth and production in Saccharomyces cerevisiae [00241] Another example of sialic acid production from various strains of Saccharomyces cerevisiae capable of producing N-acetylneuraminate (sialic acid) in which the strains express a phosphatase extra as indicated below.
[00242] The strain used in the present case is derived from the strain described in example 4. To increase the growth and production of sialic acid in Saccharomyces cerevisiae According to this invention, the phosphatase genes were introduced via a 2 micron plasmid (Chan 2013 (Plasmid 70 (2013)). 2-17)) and genes are expressed using synthetic constitutive promoters (Blazeck 2012 (Biotechnology and Bioengineering, Vol. 109, No. 11)) as described in example 1. Plasmids specifics used in this embodiment are p2a 2μ sia glmS-phosphate. This plasmid based on
Petition 870190058857, of 6/25/2019, p. 113/132
105/106 plasmid p2a_2p_sia_glmS is described in example 1. It is introduced into Saccharomyces cerevisae using the transformation technique described by Gietz and Woods (2002, PMID 12073338) and a mutant strain is obtained. The effect of phosphatase expression on the growth and production of these mutants is evaluated as described in example 11.
Example 15: Effect of phosphatase on sialic acid growth and production in Bacillus subtilis [00243] According to another embodiment, this invention can be used to increase sialic acid growth and production in Bacillus subtilis, yet another host of bacterial production .
[00244] The strain used in the present case is derived from the strain described in 9. In addition to the changes described in
example 9, the genes of EcAphA phosphatase (SEQ ID NO: 42), EcCof ( SEQ ID NO: 43), EcHisB (SEQ ID NO: 44), EcOtsB (SEQ ID NO: 45), EcSurE (SEQ ID NO: 46), EcYaed (SEQ ID NO: 47), EcYcjU (SEQ ID NO: 48), EcYedP (SEQ ID NO: 49), EcYfbT (SEQ ID NO: 50), EcYidA (SEQ ID NO: 51), EcYigB (SEQ ID NO: 52), EcYihX (SEQ ID NO: 53), EcYniC (SEQ ID NO: 54), EcYqaB (SEQ ID NO: 55), EcYrbL (SEQ ID NO: 56), PsMupP (SEQ ID NO: 57), EcAppA (SEQ ID NO: 58), EcGph (SEQ ID NO: 59), EcSerB (SEQ ID NO: 60), EcNagD (SEQ ID NO: 61), EcYbhA (SEQ ID NO: 62), EcYbiV (SEQ ID NO: 63), EcYbjL (SEQ ID NO: 64), EcYfbR (SEQ ID NO: 65), EcYieH (SEQ ID NO: 66), EcYjgL (SEQ ID NO: 67),
Ec YjjG (SEQ ID NO: 68), EcYrfG (SEQ ID NO: 69), EcYbiU (SEQ ID NO: 70), ScDOGl (SEQ ID NO: 71) and BsAraL (SEQ ID NO: 72) are overexpressed in a plasmid , as described in example 1. Subsequently, this plasmid is introduced
Petition 870190058857, of 6/25/2019, p. 114/132
106/106 in Bacillus subtilis. The effect of phosphatase expression on the growth and production of sialic acid of the mutants is evaluated as described in example 11.

权利要求:
Claims (21)
[1]
1. Method for the production of a sialylated compound in a microorganism, where the method comprises:
- cultivating a microorganism in a culture medium, said culture medium optionally comprising an exogenous precursor, wherein said microorganism comprises at least one nucleic acid encoding a phosphatase, at least one nucleic acid encoding an N-epimerase -acetylmannosamine; and at least one nucleic acid encoding a sialic acid synthase and in which said microorganism is unable to i) convert N-acetylglycosamine-6-P to glycosamine-6-P, ii) convert N-acetylglycosamine to N- acetyl-glucosamine-6P, and iii) converting N-acetyl-neuraminate to N-acetylmannosamine; and modulating the expression in said microorganism of a nucleic acid encoding a HAD- -like phosphatase polypeptide, wherein said HAD-like phosphatase polypeptide comprising:
at least one of the following reasons: Reason 1: hDxDx [TV] (SEQ ID NO: 73), or Reason 2: [GSTDE] [DSEN] x (1-2) [hP] x (12) [DGTS] (SEQ ID NOs: 74, 75, 76, 77) where h means a hydrophobic amino acid (A, I, L, M, F, V, P, G) and x can be any distinct amino acid;
- or a counterpart or derivative of any one
in SEQ ID NOs: 43, 44, 45, 47, 48, 50, 51 , 52, 54, 55 or 57 that has hair minus 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87 %, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98 %, or 99% of identity full sequence for the said
Petition 870190058857, of 6/25/2019, p. 116/132
[2]
2/5 polypeptide.
A method according to claim 1, wherein said HAD-like polypeptide comprises any of SEQ ID NOs: 43, 44, 45, 47, 48, 50, 51, 52, 54, 55 or 57.
[3]
A method according to claim 1, wherein said modulated expression is effected by introducing and expressing in a microorganism a nucleic acid encoding a HAD-like polypeptide.
[4]
A method according to claim 1, wherein said modulated expression is effected by the action of a constitutive promoter.
[5]
A method according to any of the preceding claims, wherein said sialylated compound is selected from the group consisting of Nacetylneuramic acid, sialylated oligosaccharide, sialylated lipid, sialylated protein, sialylated aflicon.
[6]
A method according to the preceding claim, wherein said sialylated compound is comprised of a sialylated oligosaccharide.
[7]
A method according to claim 6, wherein said sialylated oligosaccharide is comprised of sialylactose.
[8]
A method according to claim 6, wherein said sialylated oligosaccharide is comprised of disialyl lacto-N-tetraose.
9. Method of wake up with claim 5, in what said sialylated compound is understood by acid Ν’- acetylneuramine. 10. Method in according to any an of
Petition 870190058857, of 6/25/2019, p. 117/132
3/5 claims 1 to 9, wherein said sialylated compound is comprised of a sialylated lacto-N-triosis, lacto-Ntetraose or a lacto-N-neotetraose, and wherein said microorganism further comprises the activity of a galactosyltransferase (EC 2.4.1.38).
[9]
A method according to claim 10, wherein said microorganism is unable to express the genes encoding hydrolysis of UDP sugar and galactose-1-phosphate uridylyl transferase.
[10]
A method according to any one of claims 1 to 11, wherein said microorganism produces less than 50%, 40%, 30%, 20%, 10%, 5%, 2% extracellular Nacetylglucosamine than the compound sialylate.
[11]
13. Method for producing a sialylated oligosaccharide, which comprises:
a) cultivating a microorganism according to any one of claims 1 to 12, wherein said microorganism internally produces activated N-acetylneuraminate as a donor substrate for a sialyltransferase; and
b) cultivating said microorganism in a culture medium comprising an exogenous precursor selected from the group consisting of lactose, N-acetylactosamine, lacto-Nbiose, galactose, beta-galactoside and alpha-galactoside, such as, but not limited to globotriose (Gal-alpha-1,4Galbeta-1, 4Glc) galactose, in which active uptake occurs in the microorganism of said exogenous precursor and in which said exogenous precursor is the acceptor substrate for said siallytransferase for the production of the sialylated oligosaccharide.
Petition 870190058857, of 6/25/2019, p. 118/132
4/5
[12]
A method according to claim 1, wherein any one or more of said Nacetylmannosamine epimerase and sialic acid synthase is overexpressed in the microorganism.
[13]
A method according to claim 1, wherein any one or more of said Nacetylmannosamine epimerase and sialic acid synthase is introduced and expressed in the microorganism.
[14]
A method according to any one of claims 1 to 15, wherein said microorganism is comprised of a bacterium, preferably an Escherichia coli strain, more preferably an Escherichia coli strain which is a K12 strain, even more preferably a strain K12 Escherichia coli is Escherichia coli MG1655.
[15]
A method according to any one of claims 1 to 15, wherein said microorganism is comprised of a yeast.
[16]
18. Microorganism, capable of being obtained by a method according to any one of claims 1 to 17, wherein said microorganism comprises a recombinant nucleic acid encoding a HAD-like polypeptide.
[17]
19. Microorganism for the production of sialylated compounds wherein said microorganism comprises at least one nucleic acid encoding a phosphatase, at least one nucleic acid encoding a Nacetylmannosamine epimerase; and at least one nucleic acid encoding a sialic acid synthase, and wherein said microorganism is unable to i) convert N
Petition 870190058857, of 6/25/2019, p. 119/132
5/5 acetylglycosamine-6-P to glycosamine-6-P, ii) convert Nacetyl glycosamine to N-acetyl glycosamine-6-P, and iii) convert N-acetylneuraminate to N-acetylmannosamine; characterized in that said microorganism comprises a modulated expression of a nucleic acid encoding a HAD-like phosphatase polypeptide, as defined in claim 1 or 2.
[18]
20. Construction comprising:
(i) nucleic acid encoding a HAD-like polypeptide as defined in claim 1 or 2;
(ii) one or more control sequences capable of directing the expression of the nucleic acid sequence of (a); and optionally (iii) a transcription termination sequence.
[19]
21. The construction of claim 20, wherein one of said control sequences is comprised of a constitutive promoter.
[20]
Use of a construction according to claim 20 or 21 in a method for producing sialylated compounds.
[21]
23. Sialylated compound produced according to the method described in any one of claims 1 to 17, wherein said sialylated compound is added to the food formulation, feed formulation, pharmaceutical formulation, cosmetic formulation or agrochemical formulation.

类似技术:

---

公开号 | 公开日 | 专利标题

---

BR112019013211A2|2019-12-10|in vivo synthesis of sialylated compounds

---

US20210017558A1|2021-01-21|Metabolically engineered organisms for the production of added value bio-products

---

JP2018526019A|2018-09-13|Production of human milk oligosaccharides in microbial hosts with modified uptake / excretion

---

US20200181665A1|2020-06-11|Fucosyltransferases and their use in producing fucosylated oligosaccharides

---

US20200332331A1|2020-10-22|Fermentative production of n-acetylneuraminic acid

---

JP2020528280A|2020-09-24|Its use in the production of sialyltransferases and sialylated oligosaccharides

---

EP3575404A1|2019-12-04|Fermentative production of sialylated saccharides

---

KR101123062B1|2012-03-15|Method of producing uridine 5'-diphospho-N-acetylgalactosamine

---

WO2021122708A1|2021-06-24|Lactose converting alpha-1,2-fucosyltransferase enzymes

---

NZ755558A|In vivo synthesis of sialylated compounds

---

US20220002773A1|2022-01-06|Production of 3-fucosyllactose and lactose converting alpha-1,3-fucosyltransferase enzymes

---

WO2021123113A1|2021-06-24|Production of sialylated oligosaccharide in host cells

---

Kajiwara et al.2011|A CMP-N-acetylneuraminic acid synthetase purified from a marine bacterium, Photobacterium leiognathi JT-SHIZ-145

---

WO2022034081A1|2022-02-17|Cellular production of di- and/or oligosaccharides

---

WO2022034073A1|2022-02-17|Production of fucosylated lactose structures by a cell

---

AU2020317557A1|2022-03-10|Production of fucosyllactose in host cells

---

WO2021013708A1|2021-01-28|Production of fucosyllactose in host cells

同族专利:

---

公开号 | 公开日

---

JP2020503066A|2020-01-30|

---

KR20190098246A|2019-08-21|

---

AU2017385601A1|2019-08-08|

---

US20190338328A1|2019-11-07|

---

CA3048521A1|2018-07-05|

---

WO2018122225A1|2018-07-05|

---

RU2019117393A3|2021-05-20|

---

RU2019117393A|2020-12-07|

---

CN110114469A|2019-08-09|

---

EP3562951A1|2019-11-06|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

DE69333955D1|1992-04-24|2006-02-02|Stanford Res Inst Int|TARGETING HOMOLOGOUS SEQUENCES IN EUKARYOTIC CELLS|

---

CN1048254C|1993-12-09|2000-01-12|托马斯杰弗逊大学|Compounds and methods for site-directed mutations in eukaryotic cells|

---

US6555732B1|1998-09-14|2003-04-29|Pioneer Hi-Bred International, Inc.|Rac-like genes and methods of use|

---

AU2003220850A1|2002-02-28|2003-09-09|Kyowa Hakko Kogyo Co., Ltd.|Process for producing n-acetylneuraminic acid|

---

CA2645141C|2006-03-09|2018-07-10|Centre National De La Recherche Scientifique |Method of producing sialylated oligosaccharides|

---

JP2010517509A|2006-09-26|2010-05-27|シラキュースユニバーシティ|E. coli metabolically engineered for enhanced production of sialic acid|

---

CN107603935A|2010-07-12|2018-01-19|因比奥斯公司|For producing the Metabolically engineered biology of added value biological product|

---

AT510299B1|2010-12-22|2012-03-15|Univ Wien Tech|METHOD AND AGENT FOR PRODUCING N-ACETYLNEURAMIC ACID |

---

CN103602627B|2013-11-25|2015-03-18|武汉中科光谷绿色生物技术有限公司|Novel N-acetylneuraminic acid-producing escherichia coli engineering bacteria as well as construction method and application thereof|

---

PL2927316T3|2014-03-31|2019-05-31|Jennewein Biotechnologie Gmbh|Total fermentation of oligosaccharides|

---

WO2016075243A1|2014-11-14|2016-05-19|Universiteit Gent|Mutant microorganisms resistant to lactose killing|

---

CN106190938B|2016-07-18|2019-05-14|南开大学|A kind of method of the recombination bacillus coli and biosynthesis 3 '-saliva lactose of building|CN109182201B|2018-09-30|2020-06-23|浙江工业大学|Enterobacter hesheng biological I type ZJB-17002 and application thereof|

---

CN110396532A|2019-08-23|2019-11-01|中国科学院合肥物质科学研究院|A method of preparing sialyl lactose|

---

EP3789495A1|2019-09-03|2021-03-10|Jennewein Biotechnologie GmbH|Production of sialylated oligosaccharides in bacillus cells|

---

WO2021102682A1|2019-11-26|2021-06-03|江南大学|Method for promoting synthesis of n-acetylglucosamine by using glcn6p sensing component|

---

WO2021123113A1|2019-12-18|2021-06-24|Inbiose N.V.|Production of sialylated oligosaccharide in host cells|

---

EP3848471A1|2020-01-10|2021-07-14|Chr. Hansen HMO GmbH|Sequential fermentative production of oligosaccharides|

---

WO2021160830A1|2020-02-14|2021-08-19|Inbiose N.V.|Glycominimized bacterial host cells|

---

WO2021160827A2|2020-02-14|2021-08-19|Inbiose N.V.|Production of glycosylated product in host cells|

---

CN111621437B|2020-06-04|2022-01-04|江西禾一生物科技有限公司|Otter escherichia coli LM-DK separated from oxidation pond of pig farm and application thereof|

---

WO2022034079A2|2020-08-10|2022-02-17|Inbiose N.V.|Process for purification of an oligosaccharide solution produced by cell cultivation or microbial fermentation|

---

EP3954769A1|2020-08-10|2022-02-16|Inbiose N.V.|Production of oligosaccharide mixtures by a cell|

---

WO2022034073A1|2020-08-10|2022-02-17|Inbiose N.V.|Production of fucosylated lactose structures by a cell|

---

WO2022034081A1|2020-08-10|2022-02-17|Inbiose N.V.|Cellular production of di- and/or oligosaccharides|

法律状态:
2021-10-13| B350| Update of information on the portal [chapter 15.35 patent gazette]|

优先权:

---

申请号 | 申请日 | 专利标题

---

EP16206916|2016-12-27|

---

PCT/EP2017/084593|WO2018122225A1|2016-12-27|2017-12-26|In vivo synthesis of sialylated compounds|

---