methods and systems for nucleic acid molecule analysis

专利摘要:
The invention provides methods for processing nucleic acid populations containing different forms (e.g., rna and dna, single stranded or double stranded), and / or modification extensions (e.g., cytosine methylation, protein association). These methods accommodate multiple forms and / or nucleic acid modifications in a sample, such that sequence information may be obtained in multiple forms. The methods also preserve the identity of multiple forms or modified states through processing and analysis, such that sequence analysis may be combined with epigenetic analysis.
公开号:BR112019012958A2
申请号:R112019012958
申请日:2017-12-22
公开日:2019-11-26
发明作者:Diana Abdueva；Helmy Eltoukhy；Andrew Kennedy；Stefanie Ann Ward Mortimer；Matthew Schultz；Amirali Talasaz
申请人:Guardant Health Inc；
IPC主号:

专利说明:

Descriptive Report of the Invention Patent for “METHODS AND SYSTEMS FOR ANALYSIS OF NUCLEIC ACID MOLECULES”.
REFERENCE TO RELATED PATENT APPLICATIONS [0001] This application claims the benefit of the priority dates of United States Provisional Patent Applications 62 / 438,240, filed on December 2, 2016; 62 / 512,936, deposited on May 31, 2017, and 62 / 550,540, deposited on August 25, 2017, all of which are incorporated by reference here in their entirety.
BACKGROUND [0002] Cancer is a major cause of disease around the world. Each year, ten million people are diagnosed with cancer around the world, and more than half eventually die from cancer. In many countries, cancer ranks as the second most common cause of death after cardiovascular disease. Early detection is associated with improved results for many cancers.
[0003] Cancer can be caused by the accumulation of genetic variations within individual normal cells, at least some of which result in improperly regulated cell division. Such variations commonly include copy number variations (CNVs), single nucleotide variations (SNVs), gene fusions, insertions and / or deletions (indels), epigenetic variations include cytosine 5-methylation (5-methylcytosine) and association of DNA with chromatin and transcription factors.
[0004] Cancers are often detected by tumor biopsies, followed by analysis of cells, markers, or DNA extracted from cells. But more recently it has been proposed that
Petition 870190078052, of 12/08/2019, p. 6/238
2/194 cancers can also be detected from free cell nucleic acids in body fluids, such as blood or urine. Such tests have the advantage that they are non-invasive, and can be performed without identifying suspicious cancer cells on the biopsy. However, such tests are complicated by the fact that the amount of nucleic acids in body fluids is very low, and which nucleic acids that are present are heterogeneous in form (for example, RNA and DNA, single-stranded and double-stranded, and several post-replication modification states and association with proteins, such as histones).
[0005] It is desirable to increase the sensitivity of liquid biopsy assays, while reducing the loss of circulation of nucleic acid (original material), or data in the process.
SUMMARY [0006] The disclosure provides methods, compositions and systems for analyzing a nucleic acid population comprising at least two forms of nucleic acid selected from double-stranded DNA, single-stranded DNA, and single-stranded RNA. In some embodiments, the method comprises (a) linking at least one of the nucleic acid forms with at least one labeled nucleic acid to distinguish the forms from each other, (b) amplifying the nucleic acid forms, at least one of which is linked to at least one nucleic acid tag, in which the nucleic acids and linked nucleic acid tag, if present, are amplified, to produce amplified nucleic acids, of which those amplified from at least one form are tagged; (c) testing amplified nucleic acid sequence data, at least some of which are tagged; and (d) decode labeled nucleic acid molecules from the amplified nucleic acids to reveal the forms of nucleic acids in the population providing an original model
Petition 870190078052, of 12/08/2019, p. 7/238
3/194 for the amplified nucleic acids attached to the label nucleic acid molecules for which sequence data was tested.
[0007] In some embodiments, the method further comprises enriching at least one of the forms relative to one or more of the other forms. In some embodiments, at least 70% of the molecules of each form of nucleic acid in the population are amplified in step (b). In some embodiments, at least three forms of nucleic acid are present in the population, and at least two of the forms are linked to different forms of label nucleic acid distinguishing each of the three forms from each other. In some embodiments, each of the at least three forms of nucleic acid in the population is linked to a different tag. In some embodiments, each molecule is similarly attached to a tag comprising the same information tag identification (for example, a tag with the same or comprising the same sequence). In some embodiments, molecules are similarly attached to different types of tags. In some embodiments, step (a) comprises: subjecting the population to reverse transcription with a labeled primer, in which the labeled primer is incorporated into the cDNA generated from the RNA in the population. In some embodiments, reverse transcription is sequence specific. In some embodiments, reverse transcription is random. In some embodiments, the method further comprises degrading RNA duplexed to the cDNA. In some embodiments, the method additionally comprises separating single-stranded DNA from double-stranded DNA, and linking nucleic acid tags to double-stranded DNA. In some embodiments, single-stranded DNA is hybridized to one or more capture probes. In some embodiments, the method additionally comprises differentially tagging single-stranded DNA with a single-stranded tag
Petition 870190078052, of 12/08/2019, p. 8/238
4/194 ca using a ligase that works on single-stranded nucleic acids, and double-stranded DNA with double-stranded adapters using ligase that works on double-stranded nucleic acids. In some embodiments, the method additionally comprises, prior to testing, pooling labeled nucleic acids comprising different forms of nucleic acid. In some embodiments, the method additionally comprises analyzing the DNA pools split separately in individual assays. The tests can be the same, substantially similar, equivalent, or different. [0008] In any of the above methods, the sequence data may indicate the presence of a somatic variant or germline variant, or a copy number variation, or a single nucleotide variation, or an indel, or gene fusion.
[0009] The disclosure further provides a method of analyzing a nucleic acid population comprising nucleic acids with different extensions of modification. In some examples, the disclosure provides methods for classifying characteristics (e.g., 5 'methylcytosine) associated with a disease. The method comprises contacting the nucleic acid population with an agent (such as a methyl binding domain or protein) that preferably binds to the nucleic acids that support the modification; separating a first pool of agent-bound nucleic acids from a second pool of non-agent-bound nucleic acids, in which the first pool of nucleic acids are overrepresented for the modification, and the nucleic acids in the second pool are underrepresented for the modification; linking the nucleic acids at the first meeting and / or the second meeting to one or more nucleic acid tags that distinguish the nucleic acids at the first meeting and the second meeting to produce a population of labeled nucleic acids; amplify the labeled nucleic acids, in which the
Petition 870190078052, of 12/08/2019, p. 9/238
5/194 nude acids and linked labels are amplified; test sequence data for amplified nude acids and Hgadas tags; decode the tags to reveal whether the nude acids for which the sequence data was tested were amplified from models at the first or second meeting.
[0010] In some embodiments, the modification is binding of nude acids to a protein. In some embodiments, the protein is a histone or transcription factor. In some embodiments, the nucleic acid modification is a post-replication modification to a nucleotide. In some embodiments, the post replication modification is 5-methylcytosine, and the extent of binding of the capture agent to nude acids increases with the extent of 5methyldtosines in the nucleic acid. In some embodiments, the post-replication modification is 5-hydroxymethylcytosine, and the extent of binding of the agent to nucleic acid increases with the extension of 5hydroxymethylcytosine in the nucleic acid. In some embodiments, the post-replication modification is 5-formylcytosine or 5-carboxylcytosine, and the extent of binding of the agent increases with the extension of 5formylcytosine or 5-carboxylcytosine in the nucleic acid. In some embodiments, the post-replication modification is N ⁶ -methyladenine. In some embodiments, the method additionally comprises washing the agent-linked nude acids, and collecting the wash as a third pool including nude acids with post-replication modification to an intermediate extent relative to the first and second pools. Some methods additionally comprise, prior to testing, bringing together labeled nude acids from the first and second meetings. In some embodiments, the agent comprises a methyl-binding domain or methyl-CpG (MBD) binding domain. MBD can be a protein, an antibody, or any other agent capable of specifically binding the modification
Petition 870190078052, of 12/08/2019, p. 10/238
6/194 tions of interest. Preferably, the MBD additionally comprises magnetic beads, streptavidin, or other binding domains for carrying out an affinity separation step.
[0011] The disclosure further provides a method for analyzing a nucleic acid population in which at least some of the nucleic acids include one or more modified cytosine residues. The method comprises linking capture fractions, for example, biotin, to nucleic acids in the population to serve as models for amplification; perform an amplification traction to produce amplification products for the models; separate models linked to capture fractions from amplification products; test sequence data for models linked to capture fractions by disulfide sequencing; and test sequence data for the amplification products.
[0012] In some embodiments, the capture fractions comprise biotin. In some embodiments, separation is accomplished by contacting the models with streptavidin spheres. In some embodiments, the modified cytosine residues are 5 methyl cytosine, 5-hydroxymethyl cytosine, 5-formyl cytosine, or 5 carboxyl cytosine. In some embodiments, the capture fractions comprise biotin bound to the nucleic acid tags including one or more modified residues. In some embodiments, the capture fractions are linked to nucleic acid in the population, via a divage bond. In some embodiments, the divider link is a photodivable link. In some embodiments, the cleavable link comprises a nucleotide uracil.
[0013] The disclosure further provides a method of analyzing a nucleic acid population comprising nucleic acids with extensions other than 5-methyldtosine. The method comprises (a) contacting the nucleic acid population with an agent
Petition 870190078052, of 12/08/2019, p. 11/238
7/194 which preferentially binds to 5-methylated nucleic acids; (b) separating a first pool of nucleic acids bound to the agent from a second pool of nucleic acids not bound to the agent, in which the first pools of nucleic acids are overrepresented by 5-methylcytosine, and the nucleic acids in the second pool are overrepresented by 5-methylation; (c) linking the nucleic acids at the first meeting and / or the second meeting to one or more nucleic acid tags that distinguish the nucleic acids at the first meeting and at the second meeting, in which the nucleic acid tags attached to nucleic acids at the first meeting comprise a capture fraction (eg biotin); (d) amplifying the labeled nucleic acids, in which the nucleic acids and the attached tags are amplified; (e) separating amplified nucleic acids that support the capture fraction from the amplified nucleic acids that do not support the capture fraction; and (f) testing separate amplified nucleic acid sequence data.
[0014] The disclosure further provides a method of analyzing a nucleic acid population comprising nucleic acids with different extensions of modification, comprising: contacting the nucleic acids in the population with adapters to produce a population of nucleic acids flanked by adapters comprising binding sites primer; amplifying nucleic acids flanked by adapters initiated from the primer binding sites; contacting the amplified nucleic acids with an agent that preferably binds to the nucleic acids that support the modification; separating a first pool of agent-bound nucleic acids from a second pool of non-agent-attached nucleic acids, in which the first pool of nucleic acids are overrepresented for the modification, and the nucleic acids in the second pool are overrepresented for the modification; accomplish
Petition 870190078052, of 12/08/2019, p. 12/238
8/194 a second stage of amplification of nucleic acids in the first and second meetings; and test amplified nucleic acid sequence data at the first and second meetings. The amplification of each meeting can occur separately in different reaction vessels. The use of specific meeting tags allows subsequent amplicons to be reunited before sequencing.
[0015] The disclosure further provides a method of analyzing a nucleic acid population in which at least some of the nucleic acids include one or more modified cytosine residue, comprising contacting the nucleic acid population with adapters comprising a primer binding site comprising at least one cytosine modified to form nucleic acids spun by the adapters; amplifying nucleic acids flanked by adapters initiated from the primer binding sites on adapters flanking a nucleic acid; dividing the amplified nucleic acids into first and second aliquots; test the sequence data on the nucleic acids of the first aliquot; contacting the nucleic acids of the second aliquot with bisulfite, which converts unmodified cytosines (C's) into uracis (U's); amplify the nucleic acids resulting from bisulfite treatment initiated from the primer binding sites that flank the nucleic acids, in which U's introduced by the bisulfite treatment are converted to T ^! s; test sequence data on nucleic acids amplified from the second aliquot; compare the nucleic acid sequence data in the first and second aliquots to identify which nucleotides in the nucleic acid population were modified cytosines.
[0016] In any of the above methods, the nucleic acid population can be from a sample of body fluid, such as blood, serum, or plasma. In some embodiments, the acid population
Petition 870190078052, of 12/08/2019, p. 13/238
Nucleic 9/194 is a cell-free nucleic acid population. In some embodiments, the body fluid sample is from an individual suspected of having cancer.
[0017] In one aspect provided herein, it is a method of analyzing a nucleic acid population comprising at least two forms of nucleic acid selected from double-stranded DNA, single-stranded DNA and single-stranded RNA, the method, in which each of the at least two forms comprises a plurality of molecules, comprising: linking at least one of the nucleic acid forms with at least one labeled nucleic acid to distinguish the forms from each other, amplifying the forms of the nucleic acid, at least one of which it is linked to at least one nucleic acid tag, in which the nucleic acids and linked nucleic acid tag, are amplified, to produce amplified nucleic acids, of which those amplified from at least one form are tagged; assay amplified nucleic acid sequence data at least some of which are labeled; in which the assay obtains sufficient sequence information to decode the labeled nucleic acid molecules from the amplified nucleic acids to reveal the nucleic acid forms in the population that provides an original model for the amplified nucleic acids attached to the labeled nucleic acid molecules for which sequence data was tested. In one embodiment, the method further comprises the step of decoding the labeled nucleic acid molecules from the amplified nucleic acids to reveal the nucleic acid forms in the population providing an original model for the amplified nucleic acids attached to the labeled nucleic acid molecules for which sequence data was tested. In another embodiment, the method additionally comprises enriching at least one of the forms relative to one or more of the other forms.
Petition 870190078052, of 12/08/2019, p. 14/238
10/194
In another embodiment, at least 70% of the molecules of each form of nucleic acid in the population are amplified. In another embodiment, at least three forms of nucleic acid are present in the population, and at least two of the forms are linked to the different forms of label nucleic acid that distinguish each of the three forms from each other. In another embodiment, each of the at least three forms of nucleic acid in the population is linked to a different tag. In another embodiment, each molecule is similarly attached to a tag comprising the same tag information. In another embodiment, molecules are similarly attached to different types of tags. In another embodiment, the method additionally comprises subjecting the population to reverse transcription with a tagged primer, in which the tagged primer is incorporated into the cDNA generated from the RNA in the population. In another embodiment, the reverse transcription is sequence specific. In another embodiment in which the reverse transcription is random. In another embodiment, the method further comprises degrading the RNA duplexed to the cDNA. In another embodiment, the method further comprises separating single-stranded DNA from double-stranded DNA, and attaching nucleic acid tag to double-stranded DNA. In another embodiment, the single-stranded DNA is hybridized to one or more capture probes. In another embodiment, the method further comprises circularizing the single-stranded DNA with a circligase, and attaching nucleic acid tags to the double-stranded DNA. In another embodiment, the method comprises, prior to testing, bringing together labeled nucleic acids comprising different forms of nucleic acid. In another embodiment, the nucleic acid population is from a sample of body fluid. In another embodiment, the body fluid sample is blood, serum, or plasma. In another embodiment, the nucleic acid population is a population of free nucleic acid
Petition 870190078052, of 12/08/2019, p. 15/238
11/194 cell. In another embodiment, the body fluid sample is from an individual suspected of having cancer. In another embodiment, the sequence data indicates the presence of a somatic variant or germline variant. In another embodiment, the sequence data indicates the presence of a copy number variation. In another embodiment, the sequence data indicates the presence of a single nucleotide variation (SNV), indel, or gene fusion. In another embodiment, the sequence data indicates the presence of a single nucleotide variation (SNV), indel, or gene fusion.
[0018] In another aspect, a method of analyzing a nucleic acid population comprising nucleic acids with different extensions of modification is provided herein, comprising: contacting the nucleic acid population with an agent that preferably binds to the nucleic acids that support the modification, separation of a first pool of agent-bound nucleic acids from a second pool of non-agent-bound nucleic acids, in which the first pool of nucleic acids is overrepresented for the modification, and the nucleic acids in the second pool are overrepresented for the modification; linking the nucleic acids at the first meeting and / or the second meeting to one or more nucleic acid tags that distinguish the nucleic acids at the first meeting and the second meeting to produce a population of labeled nucleic acids; amplifying the labeled nucleic acids, in which the nucleic acids and the attached tags are amplified; and, testing amplified nucleic acid sequence data and linked tags; in which the assay obtains sequence data for decoding the tags to reveal whether the nucleic acids for which sequence data was assayed were amplified from models at the first or second meeting. In one embodiment, the method comprises the step of decoding the tags to reveal whether the nucleic acids
Petition 870190078052, of 12/08/2019, p. 16/238
12/194 cos for which sequence data was tested were amplified from models in the first or second meeting. In another embodiment, the modification is to attach the nucleic acids to a protein. In another embodiment, the protein is a histone, or transcription factor. In another embodiment, the modification is a post-replication modification to a nucleotide. In another embodiment, the post-replication modification is 5-methyl cytosine, and the extent of binding of the agent to nucleic acids increases with the extent of 5-methyl cytosines in the nucleic acids. In another embodiment, the post replication modification is 5-hydroxymethyl-cytosine, and the extent of binding of the agent to nucleic acid increases with the extension of 5-hydroxymethyl-cytosine in the nucleic acid. In another embodiment, the post replication modification is 5-formyl-cytosine or 5-carboxyl-cytosine, and the extent of binding of the agent increases with the extension of 5-formyl-cytosine, or 5-carboxyl-cytosine, in the nucleic acid. In another embodiment, the method further comprises washing the agent-bound nucleic acids, and collecting the wash as a third pool including nucleic acids with the post-replication modification to an intermediate extent relative to the first and second pools. In another embodiment, the method comprises, prior to testing, pooling labeled nucleic acids from the first and second meetings. In another embodiment, the agent is magnetic spheres of 5-methyl binding domain. In another embodiment, the nucleic acid population is from a sample of body fluid. In another embodiment, the body fluid sample is blood, serum, or plasma. In another embodiment, the nucleic acid population is a cell-free nucleic acid population. In another embodiment, the body fluid sample is from an individual suspected of having cancer. In another embodiment, the sequence data indicates the presence of a somatic variant, or germline variant. In another embodiment, the sequence data
Petition 870190078052, of 12/08/2019, p. 17/238
13/194 cia indicates the presence of a variation in the number of copies. In another embodiment, the sequence data indicates the presence of a single nucleotide (SNV) variation, indelible, or gene fusion.
[0019] In another aspect, a method of analyzing a nucleic acid population is provided herein in which at least some of the nude acids include one or more modified cytosine residues, comprising linking capture fractions to nude acids in the population, whose acids Nudists serve as models for amplification; perform an amplification reaction to produce amplification products for the models; separate connected models to capture amplification product tags; test sequence data of linked models to capture tags by bisulfite sequencing; and test sequence data for the amplification products. In one embodiment, the capture fractions comprise biotin. In another embodiment, the separation is accomplished by contacting the models with streptavidin spheres. In another embodiment, the modified cytosine residues are 5-methylcytosine, 5-hydroxymethyl cytosine, 5formyl cytosine, or 5-carboxyl cytosine. In another embodiment, the capture fractions comprise biotin bound to the nucleic acid tags including one or more modified residues. In another embodiment, the capture fractions are linked to nucleic acid in the population, via a cleavable link. In another embodiment, the cleavable link is a photocleavable link. In another embodiment, the cleavable link comprises a uracil nucleotide. In another embodiment, the nucleic acid population is from a sample of body fluid. In another embodiment, the body fluid sample is blood, serum, or plasma. In another embodiment, the nucleic acid population is a cell-free nucleic acid population. In another embodiment, the body fluid sample is from an individual suspected of having cancer. In another embodiment, the sequence data indicates presence
Petition 870190078052, of 12/08/2019, p. 18/238
14/194 of a somatic variant, or germline variant. In another embodiment, the sequence data indicates the presence of a copy number variation. In another embodiment, the sequence data indicates the presence of a single nucleotide (SNV) variation, indelible, or gene fusion.
[0020] In another aspect, a method of analyzing a nucleic acid population comprising nucleic acids with different extensions of 5-methylation is provided herein, comprising: contacting the nucleic acid population with an agent that preferably binds to 5 nucleic acids metallated; separating a first pool of agent-bound nucleic acids from a second pool of non-agent-bound nucleic acids, in which the first pool of nucleic acids is overrepresented for 5-methylation, and the nucleic acids in the second pool are overrepresented for 5- methylation; linking the nucleic acids at the first meeting and / or the second meeting to one or more nucleic acid tags that distinguish the nucleic acids at the first meeting and the second meeting, in which the nucleic acid tags attached to the nucleic acids at the first meeting comprise a fraction capture (for example, biotin); amplifying the labeled nucleic acids, in which the nucleic acids and the attached tags are amplified; separating amplified nucleic acids that support the capture fraction from the amplified nucleic acids that do not support the capture fraction; and testing separate amplified nucleic acid sequence data.
[0021] In another aspect, a method of analyzing a nucleic acid population comprising nucleic acids with different extensions of modification is provided herein, comprising: contacting the nucleic acids in the population with adapters to produce a population of nucleic acids flanked by the adapters comprising primer binding sites; amplify acids
Petition 870190078052, of 12/08/2019, p. 19/238
15/194 nucleic flanked by the adapters initiated from the primer binding sites; contacting the amplified nucleic acids with an agent that preferably binds to the nucleic acids that support the modification; separating a first agent-linked nucleic acid pool from a second agent-unbound nucleic acid pool, in which the first nucleic acid pool is overrepresented for the modification, and the nucleic acids in the second pool are overrepresented for the modification; perform parallel amplifications of labeled nucleic acids in the first and second meetings; and test amplified nucleic acid sequence data at the first and second meetings. In another embodiment, the adapters are hair clip adapters.
[0022] In another aspect, a method of analyzing a nucleic acid population is provided herein in which at least some of the nucleic acids include one or more modified cytosine residues, comprising contacting the nucleic acid population with adapters comprising a site of primer binding comprising a cytosine modified to form nucleic acids flanked by adapters; amplifying nucleic acids flanked by adapters initiated from the primer binding sites on adapters flanking a nucleic acid; dividing the amplified nucleic acids into the first and second aliquots; test sequence data on the nucleic acids of the first aliquot; contacting the nucleic acids of the second aliquot with bisulfite, which converts unmodified Cs to U; amplifying nucleic acids resulting from bisulfite treatment initiated from the primer binding sites that flank the nucleic acids, in which U's introduced by bisulfite treatment are converted to Ts; and, testing the nucleic acid sequence data amplified from the second aliquot; in which the assay produces sequence data that can be used to compare
Petition 870190078052, of 12/08/2019, p. 20/238
16/194 the nucleic acid sequence data in the first and second aliquot to identify which nucleotides in the nucleic acid population were modified cytosines. In one embodiment, the method comprises comparing the nucleic acid sequence data in the first and second aliquots to identify which nucleotides in the nucleic acid population generate modified cytosines. In another embodiment, the adapters are hair clip adapters. [0023] In another aspect, a method is provided here, comprising: physically fractioning DNA molecules from a human sample to generate two or more divisions; apply differential molecular tags and NSG training adapters to each of the two or more divisions to generate molecular labeled divisions; to test the labeled molecular divisions in an NGS instrument to generate sequence data for sample devolution in the molecules that were differentially divided. In one embodiment, the method additionally comprises analyzing the sequence data by deconvolution of the sample in the molecules that have been differentially divided. In another embodiment, the DNA molecules are from extracted blood plasma. In another embodiment, physical fractionation comprises the fractionation of molecules based on varying degrees of methylation. In another embodiment, varying degrees of methylation comprise hypermethylation and hypomethylation. In another embodiment, physically fractionating comprises fractioning with methyl-binding domain protein spheres ("MBD") to stratify into varying degrees of methylation. In another embodiment, the differential molecular tags are different sets of molecular tags corresponding to a division of MBD. In another embodiment, physical fractionation comprises separating DNA molecules using immunoprecipitation. In another embodiment, the method additionally comprises recombining two or more fractions labeled molecule
Petition 870190078052, of 12/08/2019, p. 21/238
17/194 of the molecular labeled fractions generated. In another embodiment, the method further comprises enriching the recombined molecular labeled fractions or groups. In another embodiment, the one or more characteristics is methylation. In another embodiment, fractionation comprises separating methylated nucleic acids from non-methylated nucleic acids using proteins comprising a methyl binding domain to generate groups of nucleic acid molecules comprising varying degrees of methylation. In another embodiment, one of the groups comprises hypermethylated DNA. In another embodiment, at least one group is characterized by a degree of methylation. In another embodiment, the fractionation comprises isolating protein-bound nucleic acids. In another embodiment, the isolation comprises immunoprecipitation.
[0024] In another aspect, here is provided a method for identifying the molecular tag of MBD-fractionated sphere libraries through NGS, comprising: physical fractionation of a DNA sample extracted using a methyl protein-purification binding domain kit ball, saving all elutions for downstream processing; parallel application of differential molecular tags and sequences of NSG training adapter to each fraction or group; recombine all molecular tagged fractions or groups, and subsequent amplification using adapter-specific DNA primer sequences; (d) enrichment / hybridization of recombinant and total amplified library, targeting genomic regions of interest; re-amplification of the enriched total DNA library, attach a sample tag; and gather different samples, and rehearse them in multiplex on an NGS instrument; in which NGS sequence data produced by the instrument provides sequence of the molecular tags being used to identify unique molecules, and sequence data for deconvolution
Petition 870190078052, of 12/08/2019, p. 22/238
18/194 of the sample into molecules that were differentially divided by MBD. In one embodiment, the method comprises performing NGS data analysis, with the molecular tags being used to identify unique molecules, also deconvolution of the sample into molecules that have been differentially divided by MBD. In another embodiment, fractionation comprises physical fractionation. In another embodiment, the population of nucleic acid molecules is divided based on one or more characteristics selected from the group consisting of: methylation status, glycosylation status, histone modification, length and start / stop position. In another embodiment, the method further comprises bringing the nucleic acid molecules together. In another embodiment, fractionation comprises fractionation based on a difference in a mono-nucleosomal profile. In another embodiment, the fractionation is capable of generating different mononucleosomal profiles for at least one group of nucleic acid molecules when compared to a normal one. In another embodiment, the method additionally comprises fractionating at least one group of nucleic acid molecules based on a different characteristic. In another embodiment, the analysis comprises, in one or more locations, comparing a first characteristic corresponding to a first group of nucleic acid molecules to a second characteristic corresponding to a second group of nucleic acid molecules. In another embodiment, the nucleic acid molecules are circulating the tumor's DNA. In another embodiment, the nucleic acid molecules are free cell DNA ("each"). In another embodiment, tags are used to distinguish different molecules from the same sample. In another embodiment, the one or more characteristic is a cancer marker.
[0025] In another aspect, a method is provided here comprising: providing a population of nude acid molecules
Petition 870190078052, of 12/08/2019, p. 23/238
19/194 cleico obtained from a body sample of an individual; fractionating the population of nucleic acid molecules based on one or more characteristics to generate a plurality of groups of nucleic acid molecules, differentially labeling nucleic acid molecules in the plurality of groups to distinguish the nucleic acid molecules in each of the plurality of groups between itself based on one or more characteristics; sequencing the plurality of groups of nucleic acid molecules to generate sequence readings; contain sufficient data to generate relative information on nucleosome positioning, nucleosome modification, or protein binding-interaction DNA for each of the plurality of groups of nucleic acid molecules. In one embodiment, the method further comprises analyzing the sequence readings to generate relative information about nucleosome positioning, nucleosome modification, or DNA-protein interaction linkage for each of the plurality of groups of nucleic acid molecules. In another embodiment, the method additionally comprises using a trained classifier to classify the individual based on one or more characteristics. In another embodiment, the one or more features comprise a quantitative feature of the mapped readings. In another embodiment, fractionation comprises physical fractionation. In another embodiment, the method further comprises bringing the nucleic acid molecules together. In another embodiment, fractionation comprises fractionation based on a difference in a mono-nucleosome profile. In another embodiment, the fractionation is capable of generating different mononucleosomal profiles for at least one group of nucleic acid molecules when compared to a normal one. In another embodiment, the method additionally comprises the fractionation of at least one group of nucleic acid molecules based on a different characteristic. In another embodiment, the analysis comprises
Petition 870190078052, of 12/08/2019, p. 24/238
20/194 to compare, in one or more tocals, a first characteristic corresponding to a first group of nucleic acid molecules to a second characteristic corresponding to a second group of nucleic acid molecules. In another embodiment, the analysis comprises analyzing a characteristic of one or more characteristics in a group relative to a normal sample in one or more locations. In another embodiment, one or more characteristics are selected from the group consisting of: a frequency called the base at a base position in the reference sequence, a number of molecules that map to a base or sequence in the reference sequence, a number of molecules having a start location that maps to a base position in the reference sequence, and a number of molecules having a stop location that maps to a base portion in the reference sequence, and a length of one molecule that maps to a location in the reference sequence. In another embodiment, the method additionally comprises using a trained classifier to classify the individual based on one or more characteristics. In another embodiment, the trained classifier classifies one or more characteristics as associated with a tissue in the individual. In another embodiment, the trained classifier classifies one or more characteristics as associated with a type of cancer in the individual. In another embodiment, the one or more characteristics are indicative of gene expression or disease status. In another embodiment, the nucleic acid molecules are circulating the tumor's DNA. In another embodiment, the nucleic acid molecules are free cell DNA ("cfDNA"). In another embodiment, tags are used to distinguish different molecules in the same sample. In another embodiment, the one or more features is a cancer marker.
[0026] In another aspect, a method is provided here, with
Petition 870190078052, of 12/08/2019, p. 25/238
21/194 comprising: providing a population of nucleic acid molecules obtained from a body sample of an individual; fractionation of the population of nucleic acid molecules based on the methylation state to generate a plurality of groups of nucleic acid molecules; differentially label nucleic acid molecules in the plurality of groups to distinguish the nucleic acid molecules in each of the plurality of groups among themselves based on one or more characteristics; sequencing the plurality of groups of nucleic acid molecules to generate sequence readings; and analyzing sequence readings to detect one or more characteristics in one of the plurality of groups of nucleic acid molecules, in which the one or more characteristics is indicative of nucleosome positioning, nucleosome modification, or DNA-protein interaction. In another embodiment, the method additionally comprises using a trained classifier to classify the individual based on one or more characteristics. In another embodiment, the one or more characteristics comprise a quantitative characteristic of the mapped readings. In another embodiment, fractionation comprises physical fractionation. In another embodiment, the method further comprises bringing the nucleic acid molecules together. In another embodiment, fractionation comprises fractionation based on a difference in a mono-nucleosomal profile. In another embodiment, the fractionation is capable of generating different mononucleosomal profiles for at least one group of nucleic acid molecules when compared to a normal one. In another embodiment, the method additionally comprises the fractionation of at least one group of nucleic acid molecules based on a different characteristic. In another embodiment, the analysis comprises, in one or more locations, comparing a first characteristic corresponding to a first group of nucleic acid molecules to a second characteristic
Petition 870190078052, of 12/08/2019, p. 26/238
22/194 corresponding to a second group of nucleic acid molecules. In another embodiment, the analysis comprises analyzing a characteristic of one or more characteristics in a group relative to a normal sample in one or more locations. In another embodiment, one or more characteristics are selected from the group consisting of: a frequency called the base in a base portion in the reference sequence, a number of molecules that map to a base or sequence in the reference sequence, a number of molecules having a start site that maps to a base portion in the reference sequence, and a number of molecules having a stop site that maps to a base portion in the reference sequence, and a length of one molecule that maps to a location in the reference sequence. In another embodiment, the method additionally comprises using a trained classifier to classify the individual based on one or more characteristics. In another embodiment, the trained classifier classifies one or more characteristics as associated with a tissue in the individual. In another embodiment, the trained classifier classifies one or more characteristics as associated with a type of cancer in the individual. In another embodiment, the one or more characteristics are indicative of gene expression or disease status. In another embodiment, the nucleic acid molecules are circulating the tumor's DNA. In another embodiment, the nucleic acid molecules are free cell DNA ("cfDNA"). In another embodiment, tags are used to distinguish different molecules in the same sample. In another embodiment, the one or more characteristic is a cancer marker.
[0027] In another aspect, a method is provided herein, comprising: providing a population of nucleic acid molecules obtained from a body sample of an individual; fractionate the
Petition 870190078052, of 12/08/2019, p. 27/238
23/194 population of nucleic acid molecules to generate a plurality of groups of nucleic acid molecules comprising free cell nucleic acids bound to the protein: differentially label nucleic acid molecules in the plurality of groups to distinguish the nucleic acid molecules in each of the plurality of groups among themselves based on one or more characteristics; and sequencing the plurality of groups of nucleic acid molecules to generate sequence readings; in which the obtained sequence information is sufficient to map the sequence readings in one or more locations in a reference sequence; and for analyzing sequence readings to detect one or more characteristics in one of the plurality of groups of nucleic acid molecules, in which the one or more characteristics is indicative of nucleosome positioning, nucleosome modification, or DNA-protein interaction . In one embodiment, the method additionally comprises mapping the sequence readings to one or more locations in a reference sequence; and analyzing sequence readings to detect one or more characteristics in one of the plurality of groups of nucleic acid molecules, in which the one or more characteristics is indicative of nucleosome positioning, nucleosome modification, or DNA-protein interaction. In another embodiment, the method additionally comprises using a trained classifier to classify the individual based on one or more characteristics. In another embodiment, the one or more characteristics comprise a quantitative characteristic of the mapped readings. In another embodiment, fractionation comprises physical fractionation. In another embodiment, the population of nucleic acid molecules is divided based on one or more characteristics selected from the group consisting of: methylation status, histone modification glycosylation status, length and start / stop position. In another embodiment, the additional method
Petition 870190078052, of 12/08/2019, p. 28/238
24/194 it comprises assembling the nucleic acid molecules. In another embodiment, the one or more characteristics is methylation. In another embodiment, fractionation comprises separating methylated nucleic acids from non-methylated nucleic acids using proteins comprising a methyl binding domain to generate groups of nucleic acid molecules comprising varying degrees of methylation. In another embodiment, one of the groups comprises hypermethylated DNA. In another embodiment, at least one group is characterized by a degree of methylation. In another embodiment, fractionation comprises separating single-stranded DNA molecules and / or double-stranded DNA molecules. In another embodiment, the double-stranded DNA molecules are separated using hairpin adapters. In another embodiment, the fractionation comprises isolating protein-linked nucleic acids. In another embodiment, fractionation comprises fractionation based on a difference in a mono-nucleosomal profile. In another embodiment, the fractionation is capable of generating different mononucleosomal profiles for at least one group of nucleic acid molecules when compared to a normal one. In another embodiment, the isolation comprises immunoprecipitation. In another embodiment, the method additionally comprises fractionating at least one group of nucleic acid molecules based on a different characteristic. In another embodiment, the analysis comprises, in one or more locations, comparing a first characteristic corresponding to a first group of nucleic acid molecules to a second characteristic corresponding to a second group of nucleic acid molecules. In another embodiment, the analysis comprises analyzing a characteristic of one or more characteristics in a group relative to a normal sample in one or more locations. In another embodiment, the one or more characteristics are selected from the group consisting of: a
Petition 870190078052, of 12/08/2019, p. 29/238
25/194 frequency called base on a base portion in the reference sequence, a number of molecules that map to a base or sequence in the reference sequence, a number of molecules having a starting location that maps to a base portion on the reference sequence, and a number of molecules having a stop site that maps to a base portion in the reference sequence, and a length of a molecule that maps to a location in the reference sequence. In another embodiment, the method additionally comprises using a trained classifier to classify the individual based on one or more characteristics. In another embodiment, the trained classifier classifies one or more characteristics as associated with a tissue in the individual. In another embodiment, the trained classifier classifies one or more characteristics as associated with a type of cancer in the individual. In another embodiment, the one or more characteristics are indicative of gene expression or disease status. In another embodiment, the nucleic acid molecules are circulating the tumor's DNA. In another embodiment, the nucleic acid molecules are cell-free DNA ("cfDNA"). In another embodiment, tags are used to distinguish different molecules in the same sample.
[0028] In another aspect, a method is provided here comprising: providing a population of nucleic acid molecules obtained from a body sample of an individual; fractionating the population of nucleic acid molecules based on one or more characteristics to generate a plurality of groups of nucleic acid molecules; differentially label nucleic acid molecules in the plurality of groups to distinguish the nucleic acid molecules in each of the plurality of groups among themselves based on one or more characteristics; sequence the plurality of groups of nucleic acid molecules to generate sequence readings ;, in which the information
Petition 870190078052, of 12/08/2019, p. 30/238
26/194 of sequence obtained is sufficient to map the sequence readings in one or more locations in a reference sequence; and analyzing the sequence readings to detect one or more characteristics in one of the plurality of groups of nucleic acid molecules, in which the one or more characteristics are not capable of detection in a collection of sequence readings from the plurality of groups. In one embodiment, the method further comprises mapping the sequence readings to one or more locations in a reference sequence: and analyzing the sequence readings to detect one or more characteristics in one of the plurality of groups of nucleic acid molecules, in which the one or more characteristics are not capable of detection in a meeting of sequence readings from the plurality of groups. In another embodiment, fractionation comprises physical fractionation.
[0029] In another aspect, a method is provided herein, comprising: providing a population of nucleic acid molecules obtained from a body sample of an individual; fractioning the population of nucleic acid molecules based on one or more characteristics to generate plurality of groups of nucleic acid molecules, in which the nucleic acid molecules of each of the plurality of groups comprise distinct identifiers; bringing together the plurality of groups of nucleic acid molecules; sequencing the plurality of assembled groups of nucleic acid molecules to generate plurality of sets of sequence readings; and split the sequence readings based on the identifiers.
[0030] In another aspect a composition is provided herein, comprising a pool of nucleic acid molecules comprising differently labeled nucleic acid molecules, in which the pool comprises a plurality of sets of nucleic acid molecules that are differently labeled based on
Petition 870190078052, of 12/08/2019, p. 31/238
27/194 one or more characteristics selected from the group consisting of: methylation status, glycosylation status, histone modification, length and start / stop position, in which the meeting is derived from a biological sample. In one embodiment, the plurality of sets is any of 2, 3, 4, 5 or more than 5.
[0031] In another aspect, a method is provided herein, comprising: fractioning a population of nucleic acid molecules into a plurality of groups, the plurality of groups comprising nucleic acids that differ by one characteristic; labeling the nucleic acids in each of the plurality of groups with a set of tags that distinguishes the nucleic acids in each of the plurality of groups to produce a population of labeled nucleic acids, in which each of the labeled nucleic acids comprises one or more labels; sequencing the population of tagged nucleic acids to generate sequence readings; use one or more tags to group each group of sequence readings; and analyzing the sequence readings to detect a signal in at least one of the groups relative to a normal sample in a classifier. In one embodiment, the method further comprises normalizing the signal in at least one of the groups against another group, or a total genome sequence.
[0032] In another aspect, a method is provided herein comprising: providing a population of free cell DNA from a biological sample; fractionating the free cell DNA population based on a characteristic that is present at different levels in free cell DNA derived from cancer cells compared to non-cancer cells, thereby generating subpopulations of free cell DNA; amplification of at least one of the subpopulations of free cell DNA; and, sequencing at least one of the amplified subpopulations of free cell DNA. In one embodiment, the
Petition 870190078052, of 12/08/2019, p. 32/238
Characteristic 28/194 is: the level of methylation of free cell DNA; the level of glycosylation of free cell DNA; the length of the free cell DNA fragments; or the presence of single-strand breaks in free cell DNA.
[0033] In another aspect, a method is provided herein comprising: providing a population of free cell DNA from a biological sample; fractionating the free cell DNA population based on the methylation level of the free cell DNA, thereby generating subpopulations of free cell DNA; amplify at least one of the subpopulations of free cell DNA; and, sequencing at least one of the amplified subpopulations of free cell DNA.
[0034] In another aspect, a method is provided herein to determine the methylation status of free cell DNA comprising: providing a population of free cell DNA from a biological sample; fractionating the free cell DNA population based on the methylation level of the free cell DNA, thereby generating subpopulations of free cell DNA; sequencing at least one subpopulation of free cell DNA, thereby generating sequence readings; and, determination of a methylation state for each free cell DNA depending on the subpopulation of the corresponding sequence readings to occur.
[0035] In another aspect, here is provided a method of classifying an individual, in which the method comprises: providing a population of free cell DNA from a biological sample from the individual; fractionating the free cell DNA population based on the methylation level of the free cell DNA, thereby generating subpopulations of free cell DNA; sequencing the subpopulations of free cell DNA, thereby generating sequence readings; and, use a trained classifier to classify the individual depending on which sequence readings occur in that subpopulation
Petition 870190078052, of 12/08/2019, p. 33/238
29/194 lation. In another embodiment, the free cell DNA population is fractionated by one or more characteristics that provide a difference in signal between healthy and sick states. In another embodiment, the free cell DNA population is fractionated based on the methylation level of the free cell DNA. In another embodiment, determining the fragmentation pattern of free cell DNA further comprises analyzing the number of sequence readings that map to each base portion in the reference genome. In another embodiment, the method further comprises determining the fragmentation pattern of free cell DNA in each subpopulation by analyzing the number of sequence readings that map to each base portion in the reference genome.
[0036] In another aspect, a method is provided herein to analyze the fragmentation pattern of free cell DNA comprising: providing a population of free cell DNA from a biological sample; fractionate the free cell DNA population, thereby generating subpopulations of free cell DNA; sequencing at least one subpopulation of free cell DNA, thereby generating sequence readings; align sequence readings to a reference genome; and, determine the fragmentation pattern of free cell DNA in each subpopulation by analyzing any number of: length of each sequence reading that maps to each base portion in the reference genome; number of sequence readings that map to the base portion of the reference genome as a function of the length of the sequence readings; number of sequence readings starting at each base portion in the reference genome; or, number of sequence readings ending at each base portion in the reference genome. In another embodiment, the one or more characteristics comprise a chemical modification selected from the group consisting of: methylPetition 870190078052, of 12/08/2019, p. 34/238
30/194 tion, hydroxymethylation, formylation, acetylation, and glycosylation.
[0037] Any of the methods described here in which a ratio of DNA: sphere is 1: 100.
[0038] Any of the methods described here in which a ratio of DNA: sphere is 1:50 [0039] Any of the methods described here in which a ratio of DNA: sphere is 1:20 [0040] In one aspect, it is provided here the use of physical fractionation based on the degree of DNA methylation during analysis of circulating tumor DNA (ctDNA) to determine gene expression or disease status.
[0041] In one aspect, the use of a feature that provides a difference in signal between a normal state and a sick state to physically divide ctDNA during ctDNA analysis is provided here.
[0042] In one aspect, the use of a feature that provides a difference in signal between a normal state and a sick state to physically divide ctDNA is provided here.
[0043] In one aspect, the use of a feature that provides a difference in signal between a normal state and a sick state to physically divide ctDNA prior to sequencing and optional downstream analysis is provided here.
[0044] In one aspect, the use of a feature that provides a difference in signal between a normal state and a sick state to physically divide ctDNA for differential labeling / labeling is provided here. In one embodiment, the pattern of differential fragmentation is indicative of gene expression or disease status. In another embodiment, the pattern of differential fragmentation is characterized by one or more differences relative to a normal selected from the group consisting of: length of
Petition 870190078052, of 12/08/2019, p. 35/238
31/194 each sequence reading that maps to each base portion in the reference genome; number of sequence readings that maps to the base portion of the reference genome as a function of length of the sequence readings; number of sequence readings starting at each base portion in the reference genome; and number of sequence readings ending at each base portion in the reference genome.
[0045] In one aspect, the use of fractionation based on a pattern of differential fragmentation during ctDNA analysis is provided. In one embodiment, the pattern of differential fragmentation is indicative of gene expression or disease status. In another embodiment, the differential fragmentation pattern is characterized by one or more differences relative to a normal selected from the group consisting of: length of each sequence reading that maps to each base portion in the reference genome; number of sequence readings that map to the base portion of the reference genome as a function of length of the sequence readings; number of sequence readings starting at each base portion in the reference genome; and number of sequence readings ending at each base portion in the reference genome.
[0046] In one aspect, the use of a differential fragmentation pattern for dividing ctDNA is provided here. In one embodiment, the pattern of differential fragmentation is indicative of gene expression or disease status. In another embodiment, the differential fragmentation pattern is characterized by one or more differences relative to a normal selected from the group consisting of: length of each sequence reading that maps to each base portion in the reference genome; number of sequence readings that map to the base portion in the reference genome co
Petition 870190078052, of 12/08/2019, p. 36/238
32/194 mo a function of length of the sequence readings; number of sequence readings starting at each base portion in the reference genome; and number of sequence readings ending at each base portion in the reference genome.
[0047] In one aspect, the use of a differential fragmentation pattern for ctDNA division prior to sequencing and optional downstream analysis is provided here. In one embodiment, the pattern of differential fragmentation is indicative of gene expression or disease status. In another embodiment, the differential fragmentation pattern is characterized by one or more differences relative to a normal selected from the group consisting of: length of each sequence reading that maps to each base portion in the reference genome; number of sequence readings that map to the base portion of the reference genome as a function of length of the sequence readings; number of sequence readings starting at each base portion in the reference genome; and number of sequence readings ending at each base portion in the reference genome.
[0048] In one aspect, the use of a differential fragmentation pattern for dividing ctDNA for differential labeling / labeling is provided here.
[0049] In one aspect, the use of differential molecular labeling of DNA molecules divided by molecular binding domain (MBD) spheres is provided here to stratify into varying degrees of DNA methylation, which are then quantified by sequencing next generation (NGS).
[0050] In one aspect, a method of analyzing a nucleic acid population comprising at least two forms of nucleic acid selected from double-stranded DNA, single-stranded DNA, and single-stranded RNA, the method, is provided herein. which each
Petition 870190078052, of 12/08/2019, p. 37/238
33/194 of the at least two forms comprises a plurality of molecules, comprising: linking at least one of the forms of nucleic acid with at least one labeled nucleic acid to distinguish the forms from each other; amplify the forms of nucleic acid, at least one of which is linked to at least one nucleic acid tag, in which the nucleic acids and linked nucleic acid tag, are amplified, to produce amplified nucleic acids, of which those amplified by at least one shape are labeled; and, sequencing a plurality of the amplified nucleic acid that has been attached to the tags, in which the sequence data is sufficient to be decoded to reveal the shapes of the nucleic acids in the population prior to binding to at least one tag. In one embodiment, the molecular tag comprises one or a plurality of nucleic acid bar codes. In another embodiment, the pooling of labeled nucleic acid molecules, a combination of any two bar codes in one set has different combined sequences than a combination of any two bar codes in any other set.
[0051] In another aspect, a pool of labeled nucleic acid molecules is provided herein, each nucleic acid molecule in the pool comprising a molecular tag selected from one of a plurality of tag sets, each tag set comprising a plurality of tags different, in which the tags in any one set are distinct from the tags in any other set, and in which each set of tags contains information (i) indicating a characteristic of the molecule to which it is attached to the source molecule from which the molecule is derived and (ii) that, alone or in combination with the information from the molecule to which it is attached, only distinguishes the molecule to which it is attached from other molecules labeled with the same tags
Petition 870190078052, of 12/08/2019, p. 38/238
34/194 sticker set. In one embodiment, the molecular tag comprises two nucleic acid barcodes, attached at opposite ends of the molecule. In another embodiment, the bar codes are between 10 and 30 nucleotides in length.
[0052] In another aspect, a system is provided here comprising: a nucleic acid sequencer; a digital processing device comprising at least one processor, an operating system configured to carry out executable instructions, and a memory; and, a data link that communicates the nucleic acid sequencer and the digital processing device communicatively; in which the digital processing device further comprises executable Instructions for creating an application for analysis of a nucleic acid population comprising at least two forms of nucleic acid selected from: double-stranded DNA, single-stranded DNA, and single-stranded RNA, each of the at least two forms comprising a plurality of molecules, the application comprising: a software module that receives sequence data from the nucleic acid sequencer, via the data link, the amplified nucleic acid sequence data at least some of which they are labeled, the sequence data generated by binding at least one of the nucleic acid forms with at least one nucleic acid labeled to distinguish the forms from each other, amplify the forms of nucleic acid at least one of which is bound to at least minus one nucleic acid tag, in which the nucleic acids and nucleic acid tags l ligated are amplified to produce amplified nucleic acids from which those amplified in at least one way are labeled; and, a software module that tests the amplified nucleic acid sequence data by obtaining sufficient sequence information to decode the labeled nucleic acid molecules from the amplified nucleic acids
Petition 870190078052, of 12/08/2019, p. 39/238
35/194 to reveal the forms of nucleic acids in the population that provides an original model for the amplified nucleic acids attached to the label nucleic acid molecules for which the sequence data was tested. In one embodiment, the application additionally comprises a software module that decodes the labeled nucleic acid molecules from the amplified nucleic acids to reveal the forms of nucleic acids in the population that provides an original model for the amplified nucleic acids attached to the nucleic acid molecules of label for which the sequence data was tested. In another embodiment, the application additionally comprises a software module that transmits a test result, via a communications network.
[0053] In another aspect, a system is provided here comprising: a next generation sequencing instrument (NGS); a digital processing device comprising at least one processor, an operating system configured to carry out executable instructions, and a memory; and, a data link that communicates the NGS instrument and the digital processing device communicatively; in which the digital processing device additionally comprises executable instructions for creating an application comprising: a software module to receive sequence data from the NGS instrument, via the data link, the sequence data generated by physically fractioning molecules from DNA from a human sample to generate two or more divisions, apply differential molecular tags and NSG capability adapters to each of the two or more divisions to generate molecular labeled divisions, and test the molecular labeled divisions with the NGS instrument; a software module for generating sequence data for deconvolution of the sample into molecules that have been differentially divided; and, a softwa module
Petition 870190078052, of 12/08/2019, p. 40/238
36/194 refers to the analysis of the sequence data by sample devolution in molecules that were differentially divided. In one embodiment, the application additionally comprises a software module that transmits a test result, via a communications network.
[0054] In another aspect, a system is provided here comprising: a next generation sequencing instrument (NGS); a digital processing device comprising at least one processor, an operating system configured to carry out executable instructions, and a memory; and, a data link that communicates the NGS instrument and the digital processing device communicatively; in which the digital processing device additionally comprises instructions executable by at least one processor to create an application for molecular tag identification of MBD-fractional sphere libraries comprising: a software module configured to receive sequence data from the instrument of NGS, via data link, the sequence data generated by physically fractioning a DNA sample extracted using a methyl-purification sphere binding domain protein kit, saving all elutions for downstream processing; conducting parallel application of differential molecular tags and NSG-enabling adapter sequences for each fraction or group; re-combining all labeled molecular fractions or groups, and subsequent amplification using adapter-specific DNA primer sequences; conducting enrichment / hybridization of recombinant and amplified total library, targeting genomic regions of interest; re-amplification of the enriched total DNA library, attaching a sample tag; gathering different samples; and testing them in multiplex on the NGS instrument; in which
Petition 870190078052, of 12/08/2019, p. 41/238
37/194 of the NGS sequence produced by the instrument provides sequence of the molecular tags being used to identify unique molecules, and sequence data for sample devolution in molecules that were differentially MBD-divided and, a software module configured to perform analysis of the sequence data for use of molecular tags to identify single molecules and deconvolution of the sample into molecules that have been differentiated MBD-divided. In one embodiment, the application additionally comprises a software module configured to transmit an analysis result, via a communications network.
[0055] The summary provided above is an exemplary list of achievements, and is not intended to be a complete list of achievements.
INCORPORATION BY REFERENCE [0056] All publications, patents, and patent applications mentioned in this specification are incorporated herein by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference .
BRIEF DESCRIPTION OF THE FIGURES [0057] Fig. 1 shows an exemplary scheme for dividing RNA, single-stranded DNA, and double-stranded DNA.
[0058] Fig. 2 shows an additional exemplary scheme for dividing RNA, single-stranded DNA, and double-stranded DNA.
[0059] Fig. 3 shows a scheme for DNA analysis containing variant extensions of representation of 5-methyl cytosine.
[0060] Fig. 4 shows a scheme for sequencing methylated DNA bisulfite.
[0061] Fig. 5 shows an additional scheme for DNA analysis containing variant extensions of representation of 5-methyl cytosine.
Petition 870190078052, of 12/08/2019, p. 42/238
38/194 [0062] Fig. 6 shows an additional scheme for sequencing methylated DNA bisulfite.
[0063] Fig. 7 shows an overview of differential labeling.
[0064] Fig. 8 shows an overview of division methodology.
[0065] Fig. 9 shows an overview of the methodology.
[0066] Fig. 10 shows an example of using fragmentomic data analysis on fractionated nucleic acid molecules. The genomic position is shown on the X axis, fragment length on the Y axis, and coverage or copies on the Z axis, and corresponding regions of high hypo- or hypermethylation are indicated.
[0067] Fig. 11 shows the methylation profile of normal samples and lung cancer samples.
[0068] Fig. 12A, Fig. 12B, and Fig. 12C show the methylation profile using total genome sequencing. Fig. 12A shows the position along a region of 600 bp at the transcription start site (TSS) on the X axis, and frequency of hypermethylation sites along the Y axis. Fig. 12B shows the position at the a 600 bp region in the transcription start site (TSS) on the X axis, and frequency of hypomethylation sites along the Y axis. Fig.12C shows percentage of hypermethylation on the X axis, and fragment length on the Y axis.
[0069] Fig. 13A and Fig. 13B show methylation profile of MOB3A and WDR88. Fig. 13A shows the genomic position of the MOB3A gene on the X axis, and fragment length for nucleic acid molecules from separate fractionated groups is indicated by separate lines. The fractionated groups include hypermethylated, hypomethylated, hypermethylated groups mixed with hypomethylated (hyper + hypo), and an unfractionated group (no MBD) for comparison.
[0070] Fig. 14A and Fig. 14B show group methylation profile
Petition 870190078052, of 12/08/2019, p. 43/238
39/194 split and unfractionated powders. Fig. 14 A shows a heat map with unfractionated group coverage (no MBD), and mixing divisions after fractionation on the X and Y axis respectively.
[0071] Fig. 15 shows nucleosome organization for fractionated and non-fractionated samples.
[0072] Fig. 16 shows MBD signal validation.
[0073] Fig. 17 displays statistics on the association of entry genomic regions with the TSS of all genes putatively regulated by the genomic regions. The X axis indicates the distance to TSS in kilo bases (kb), while the Y axis indicates the region gene association in percentage (%). Above each bar on the chart, an absolute number of items being counted is listed. Foreground genomic regions, represented by the dark bar, were selected from a supercomputing of background genomic regions, indicated by the light bar. The background genomic regions were repetitive elements that were co-opted into functional roles selected from all repetitive elements in the genome.
[0074] Fig. 18A and Fig. 18B show methylation profile of AP3D1 gene. Fig. 18A shows the genomic position of the AP3D1 gene on the X axis, and coverage of readings for nucleic acid molecules of different groups indicated by separate lines. The groups include fractionated groups, such as hypermethylated, hypomethylated, and non-fractionated groups (no MBD) for comparison. TSS is shown as a vertical line in the middle of heat maps with an arrow indicating the direction of transcription. Fig.18B shows percentage of hypermethylation on the X axis and fragment length on the Y axis. For example, in Fig. 18B, the percentage of methylation in an unfractionated nucleic acid sample can be about 65%, as indicated by dashed red line.
Petition 870190078052, of 12/08/2019, p. 44/238
40/194 [0075] Fig. 19A and Fig. 19B show methylation profile of DNMT1 gene. Fig. 19A shows the genomic position of the DNMT1 gene on the X axis, and coverage of readings for nucleic acid molecules of different groups is indicated by separate lines. The groups include fractionated groups, such as hypermethylated, hypomethylated, and non-fractionated groups (no MBD) for comparison. TSS is shown as a vertical line in the middle of heat maps with an arrow indicating the direction of transcription. Fig. 19B shows the percentage of hypermethylation on the X axis and fragment length on the Y axis.
[0076] Fig. 20 shows the procedure for fractionation based on the isolation of nucleic acid molecules [0077] Fig. 21 shows the fractionation of nucleic acid molecules in ssDNA and dsDNA. The X-axis shows two technical replicates of two samples with varying input DNA (200 ng and 500 ng). The Y-axis shows copy number of target molecules using quantitative PCR amplification. The figure shows quantitative determination of target sequence in each fractionated cfDNA group.
[0078] Fig. 22 shows PCR yield after fractionation of nucleic acid molecules in ssDNA and dsDNA. The X axis shows cfDNA input (200 ng and 500 ng) in two technical replicates, while the Y axis shows PCR yield in pmol.
[0079] Fig. 23 shows methylation profile of promoter region using total genome sequencing.
[0080] Fig. 24 provides three examples of strategies for labeling divided or fractionated nucleic acid molecules using methyl binding domain proteins (MBD division).
[0081] Fig. 25A and Fig. 25B show comparison between coverage for MBD and non-MBD samples in directed sequencing assay.
Petition 870190078052, of 12/08/2019, p. 45/238
41/194 [0082] Fig. 26A and Fig. 26B show the coverage for the genes in the panel using 15 ng of cfDNA input and two clinical samples (PowerpoolVI and PowerpoolV2).
[0083] Fig. 27A and Fig. 27B show the coverage for the genes in the panel using 150 ng of cfDNA input and two clinical samples (PowerpoolVI and PowerpoolV2).
[0084] Fig. 28A, Fig. 28B and Fig. 28C show specificity and sensitivity of detecting variant or mutation for the genes in the panel using 15 ng of cfDNA input.
[0085] Fig. 29A, Fig. 29B and Fig. 29C show specificity and sensitivity of detecting variant or mutation for the genes in the panel using 150 ng of cfDNA input.
[0086] Fig. 30 shows the correlation between the levels of cover methylation as measured by the sequencing of total genome bisulfite (WGBS) and MBD division.
[0087] Fig. 31A and Fig. 31B show sensitivity (Fig. 31 A) and specificity (Fig. 31B) of detection of methylated DNA using MBD division (Y axis), and using the genome bisulfite sequencing assay total (WGBS, X axis).
[0088] Figure 32 shows an embodiment of a digital processing device.
[0089] Figure 33 shows an embodiment of an application provision system.
[0090] Figure 34 shows an embodiment of an application provision system employing a cloud-based architecture.
DETAILED DESCRIPTION [0091] The term “Free Cell DNA” and “Free Cell DNA Population”, as used here, refers to DNA that was originally found in a cell or cells in a large complex biological organism, for example, a mammal, and was released from
Petition 870190078052, of 12/08/2019, p. 46/238
42/194 of the cell in a liquid fluid found in the organism, for example, blood plasma, lymph, cerebrospinal fluid, urine, in which DNA can be obtained by obtaining a sample of the fluid without the need to perform a step in vitro cell lysis.
[0092] General [0093] The present disclosure provides numerous methods, reagents, compositions, and systems for analyzing complex genomic material, while reducing or eliminating loss of molecular characteristic information (eg, epigenetic types or other types of structural) which is initially present in complex genomic material. In some embodiments, molecular tags can be used to track different forms of nucleic acids and enumerate such different forms for the purpose of determining genetic modifications (for example, SNVs, indels, gene fusions and copy number variation). In some embodiments, the methods described herein are used to detect, analyze or monitor a condition, such as cancer in an individual, or the condition of a fetus. In some embodiments, the individual is not pregnant.
[0094] The disclosure provides methods for processing a population of nucleic acids containing different forms. As used herein, different forms of nucleic acids have different characteristics. For example, and without limitation, RNA and DNA are forms that differ based on the identity of sugar. Single-stranded (ss) and double-stranded (ds) nucleic acids differ in the number of strands. Nucleic acid molecules may differ based on epigenetic characteristics, such as 5-methylcytosine or association with proteins, such as histones. Nucleic acids can have different nucleotide sequences, for example, specific genes or genetic sites. Characteristics may differ in degree.
[0095] For example, DNA molecules may differ in their
Petition 870190078052, of 12/08/2019, p. 47/238
43/194 extension of epigenetic modification. Modification extension can refer to a number of modification events to which a molecule has been subjected, such as number of methylation groups (methylation extension), or other epigenetic changes. For example, methylated DNA can be either hypomethylated or hypermethylated. Forms can be characterized by combinations of characteristics, for example, non-methylated single-chain or methylated double-chain. The fractionation of molecules based on one or a combination of characteristics can be useful for multi-dimensional analysis of simple molecules. These methods accommodate multiple forms and / or modifications of nucleic acid in a sample, such that sequence information can be obtained for multiple forms. The methods also preserve the identity of the initial multiple forms or modified states through processing and analysis, such that the analysis of nucleic base sequences can be combined with epigenetic analysis. Some methods involve separation, labeling and subsequent assembly of different forms or states of modification, reducing the number of processing steps required to analyze multiple forms present in a sample. Analysis of multiple forms of nucleic acid in samples provides more information in part because there are more molecules to analyze (which can be significant when very low total amounts of nucleic acid are available), but also because different forms or states of modification can provide different information (for example, a mutation may be present only in RNA), and because different types of information (for example, genetic and epigenetic) may be correlated with each other, thereby producing greater precision, certainty, or resulting in the discovery of new correlations with a medical condition.
[0096] The CpG dinucleotide is overrepresented in the hu genome
Petition 870190078052, of 12/08/2019, p. 48/238
44/194 normal man, with most CpG dinucleotide sequences being transcriptionally inert (for example, heterochromatic regions of DNA in pericentromeric parts of the chromosome and in repeating elements) and methylated. However, many CpG islands are protected from such methylation especially around transcriptional departure sites (TSS).
[0097] Cancer can be indicated by epigenetic variations, such as methylation. Examples of methylation changes in cancer include local DNA methylation gains in the CpG islands at the transcriptional start site (TSS) of genes involved in normal growth control, DNA repair, cell cycle regulation, and / or differentiation cell. This hypermethylation may be associated with an aberrant loss of transcriptional capacity of the genes involved, and occurs at least as frequently as mutations and dot deletions as a cause of altered gene expression. The DNA methylation profile can be used to detect regions with different methylation extensions ("differentially methylated regions" or "DMRs") of the genome that are altered during development, or that are disturbed by disease, for example, cancer or any disease associated with cancer. The cancer cell genome harbors an imbalance in the patterns above DNA methylation, and therefore in functional DNA packaging. Chromatin organization abnormalities are therefore coupled with methylation changes, and can contribute to enhanced cancer profiling when analyzed together. Combining MBD division with fragmentomic data, such as mapped fragment start and stop positions (correlated with nucleosome positions), fragment length and associated nucleosome occupation, can be used for chromatin structure analysis in hypermethylation studies with the aim of improving the detection rate of
Petition 870190078052, of 12/08/2019, p. 49/238
45/194 biomarker.
[0098] The methylation profile may involve determining methylation patterns across different regions of the genome. For example, after dividing the molecules based on the extent of methylation (eg, relative number if methylated sites per molecule) and sequencing, the sequences of molecules in the different divisions can be mapped to a reference genome. This can show regions of the genome that, compared to other regions, are more highly methylated or are less highly methylated. Thus, genomic regions, in contrast to individual molecules, may differ in their extent of methylation.
[0099] A characteristic of nucleic acid molecules can be a modification, which can include various chemical modifications or protein modifications (i.e., epigenetic modifications). Non-limiting examples of chemical modification may include, but are not limited to, covalent DNA modifications, including DNA methylation. In some embodiments, DNA methylation comprises adding a methyl group to a cytosine at a CpG site (a cytosine followed by a guanine in a nucleic acid sequence). In some embodiments, DNA methylation comprises adding a methyl group to adenine, such as in N ⁶ -methyladenine. In some embodiments, DNA methylation is 5-methylation (modification of the 5th carbon of the 6 cytosine carbon rings). In some embodiments, 5-methylation comprises adding a methyl group to the 5C position of the cytosine to create 5-methylcytosine (m5c). In some embodiments, methylation comprises a m5c derivative. Derivatives of m5c include, but are not limited to, 5-hydroxymethylcytosine (5-hmC), 5-formylcytosine (5-fC), and 5-carboxylcytosine (5-caC). In some embodiments, DNA methylation is 3C methylation (modification of the 3 carbon of cytosine 6 carbon rings). In some cases,
Petition 870190078052, of 12/08/2019, p. 50/238
46/194 cretization, 3C methylation comprises adding a methyl group to the 3C position of the cytosine to generate 3-methylcytosine (3mC). Methylation may also occur at non-CpG sites, for example, methylation may occur at a CpA, CpT, or CpC site. DNA methylation can change the activity of the methylated DNA region. For example, when the DNA in a promoter region is methylated, transcription of the gene can be repressed. DNA methylation is critical for normal development, and abnormal methylation can disrupt epigenetic regulation. The disruption, for example, repression, in epigenetic regulation, can cause diseases, such as cancer. Methylation of the promoter in DNA may be indicative of cancer.
[00100] Protein modifications include binding to chromatin components, particularly histones, including modified forms of these, and binding to other proteins, such as proteins involved in replication or transcription. The disclosure provides methods of processing and analyzing nucleic acids with different extensions of modification, such that the nature of their original modification is correlated with a nucleic acid tag, and can be decoded by sequencing the tag when nucleic acids are analyzed. The genetic variation of nucleic acid sample modifications can then be associated with the extent of modification (epigenetic variation) of that nucleic acid in the original sample.
[00101] As used herein, the terms "fractionation" and "division" refer to the separation of molecules based on different characteristics. The nucleic acid molecules in a sample can be fractionated based on one or more characteristics. Fractionation can include physically splitting nucleic acid molecules into subsets or groups based on the presence or absence of a genomic characteristic. Fractionation can include physical split
Petition 870190078052, of 12/08/2019, p. 51/238
47/194 nucleic acid molecules into dividing groups based on the degree to which a genomic characteristic is present. A sample can be fractionated or divided into one or more group divisions based on a characteristic that is indicative of differential gene expression, or a disease state. A sample can be fractionated based on a characteristic, or a combination of these that provides a difference in the signal between a normal state and a sick state during nucleic acid analysis, for example, free cell DNA (“cfDNA”), non-cfDNA, DNA tumor, circulating tumor DNA (“ctDNA”) and free cell nucleic acids (“cfNA”).
[00102] The present disclosure provides methods and systems for efficiently analyzing nucleic acid molecules. The methods may include fractionating the nucleic acid molecules into different divisions based on one or a plurality of characteristics, followed by sequencing (alone or together), and analyzing the nucleic acid molecules in each division. In some cases, divisions of nucleic acid molecules are amplified before and / or after sequencing. The methods can be used in various applications, such as prognosis, diagnosis and / or for monitoring a disease.
[00103] Nucleic acid molecules can be characterized by any one or more characteristics. A characteristic of nucleic acid molecules can include isolation, protein binding regions, nucleic acid length, start / stop position, chemical modifications, or protein modifications. The isolation of nucleic acid molecules can include single-stranded molecules (for example, ssDNA or RNA), or double-stranded molecules (for example, dsDNA).
[00104] A genomic characteristic of nucleic acid molecules can be a modification, which can include several modifications
Petition 870190078052, of 12/08/2019, p. 52/238
48/194 chemical. As non-limiting examples, a chemical modification may include covalent DNA modification, such as DNA methylation (5mC), hydroxylmethylation (5hmC), formylmethylation (5fC), carboxylmethylation (5CaC), N ⁶ -methyladenine, or glycosylation. DNA methylation includes adding methyl groups to DNA (eg, CpG), and can change the expression of methylated DNA region. For example, when the DNA in a promoter region is methylated, the transcription of the gene can be repressed. DNA methylation is critical for normal development, and abnormal methylation can disrupt epigenetic regulation. The disruption, for example, repression, in epigenetic regulation, can cause diseases, such as cancer. Promoter methylation in DNA can be indicative of cancer.
[00105] As a non-limiting example, benefits of methods involving division of single-stranded RNA and / or DNA, as well as double-stranded DNA to characterize a sample, include:
[00106] Additional support for SNV, CNV, and indelible ssDNA cells and RNA molecules in addition to dsDNA;
[00107] Easier identification (targeting) of gene fusions in RNA as compared to DNA because variable break points in intronic DNA produce exon-exon junctions defined in RNA;
[00108] The identification or differential expression levels of messenger RNA (mRNA), microRNA (miRNA), and long non-coding RNA (IncRNA) can be characteristic of many disease states. The confirmation and additional support of expression signatures found in nucleosomal positioning changes within circulating tumor DNA (ctDNA) populations compared to leukocyte healthy free cell DNA (cfDNA) that may be important in early cancer detection. In addition, leukocyte-derived cfDNA and changes in cfRNA expression can also be
Petition 870190078052, of 12/08/2019, p. 53/238
49/194 indicative of immune response to the disease.
[00109] Evidence of unstable molecules. Capture of DNA from shorter circulating tumor (ctDNA) - Free cell DNA studies have found that the length of tumor DNA (ctDNA) can be significantly shorter than normal DNA. Some evidence indicates that these shorter sequences are unstable, and may be present as ssDNA. These can also provide information on changes in transcription factor binding in ctDNA compared to cfDNA which may be important in early cancer detection. Similarly, cfDNA can also be indicative of disease response; and [00110] Capture of damaged / degraded DNA that may be clinically relevant and that contains single-strand “loose” regions. [00111] The analysis of multiple forms of nucleic acids in a sample can occur by, for example, differentially labeling different forms of nucleic acids and / or different forms of division of nucleic acids prior to sequencing.
[00112] Differential different nucleic acid forms in a sample [00113] Nucleic acid samples, such as free cell nucleic acids in body fluids, often contain multiple forms nucleic acids, including single-stranded DNA and double-stranded DNA Single-stranded RNA. Because the total amount of nucleic acids in such samples may be low, and because different forms of nucleic acids having different characteristics and / or modifications may produce different information related to the sample, methods of analysis of 2, 3 or all such are provided herein. shapes.
[00114] The preparation and analysis of multiple forms are more efficient if at least some of the steps can be performed in
Petition 870190078052, of 12/08/2019, p. 54/238
50/194 parallel. The determined information from such samples is more informative if the sequence information of a particular nucleic acid after processing can be correlated with the original form of the nucleic acid in the sample. For example, if an SNV is determined on a particular nucleic acid after processing, it can be determined whether that nucleic acid was derived from RNA, single-stranded DNA or double-stranded DNA in the original sample.
[00115] The identification of different forms of nucleic acid in a sample can be achieved by differential labeling of different forms of nucleic acid in the sample before the forms have been altered in a way that obfuscates their original form, such as by second chain synthesis or amplification. Thus, in a nucleic acid including multiple forms, at least one form is attached to a nucleic acid tag to distinguish it from one or more other forms present in the sample. In a sample containing three forms of nucleic acid, such as single-stranded DNA, single-stranded RNA, and double-stranded DNA, the three forms can be distinguished by differentially labeling at least two of the forms, or by differentially labeling all the three. The tags attached to the nucleic acid molecules in the same way can be the same or different from each other. But if different from one another, the tags may, in some embodiments, have part of their code in common in order to identify the molecules to which they are fixed as being in a particular way. For example, nucleic molecules of a particular form can support codes of the form A1, A2, A3, A4 and so on, and those of a different form B1, B2, B3, B4 and so on. Such a coding system allows for the distinction between both forms and molecules within a form. Exemplary strategies for differentially labeling nucleic acid molecules having different characteristics, for example, degree of
Petition 870190078052, of 12/08/2019, p. 55/238
51/194 methylation as determined using methyl binding domain proteins, are provided in Fig. 24 (described below).
[00116] After differentiated labeling of one, some, or all forms of nucleic acid in a sample with nucleic acid tags, the forms can be amplified such that the nucleic acid tags are amplified together with the forms in the original sample. The amplified nucleic acids can then be subjected to sequence analysis for reading part or all of the nucleic acid sequence originally in the samples, as well as that of the attached nucleic acid tags. The tag sequences can then be decoded to indicate the shape of a nucleic acid in the original sample. The sequences of different forms can then be compared to see if a genetic variation is found predominantly or exclusively only in a certain form (s) of nucleic acid, or occurs at about the same frequency regardless of the original form. Some or all of the steps after differential labeling in different ways, particularly amplification and sequencing, can be performed with nucleic acids of the different forms combined. Such methods preferably result in amplification and sequencing of at least 40, 50, 60, 70, 80, 90 or 95% of nucleic acid molecules of two, three or more forms present in a sample.
[00117] Double-stranded nucleic acids can be differentially labeled by binding to at least partially double-stranded adapters. Typically, double-stranded nucleic acids are linked to such adapters and both ends. Either or both of such adapters can include a nucleic acid tag. If two adapters each having a tag are attached to the respective ends of a nucleic acid, the combination of ethi
Petition 870190078052, of 12/08/2019, p. 56/238
52/194 can act as an identifier. Single-stranded DNA or RNA molecules do not bind to a significant extent to the double-stranded ends of the adapters, and thus do not receive a nucleic acid tag. Double-stranded adapters can be fully double-stranded or partially double-stranded, as is the case for Y-shaped adapters, or hair clip adapters. Exemplary strings for Y-shaped adapters are shown below.
[00118] Universal adapter [00119] Universal adapter [00120] SEQ ID No. 1:
[00121] 5'AATGATACGGCGACCACCGAGATCTACACTCTTTCCC TACACGACGCTCTTCCGATCT-3 '(SEQ ID NO: 1) [00122] Adapter Label [00123] SEQ ID No. 2:
[00124] 5'GATCGGAAGAGCACACGTCTGAACTCCAGTCACNNN NNNATCTCGTATGCCGTCTTCTGCTTG-3 '(SEQ ID NO: 2) [00125] A truncated version of these adapter strings has been described by Rohland et al., Genome Res. 2012 May; 22 (5): 939-946. [00126] Because Y-shaped adapters have single-stranded ends, they may need to be avoided (for example, by separating single-stranded DNA with a probe that does not bind to Y-shaped adapters), or protected whether a subsequent step is to be performed to separate single-stranded sample nucleic acids from other sample nucleic acids.
[00127] RNA molecules can be differentially labeled with a nucleic acid tag because it is the only form of a molecule in a sample in which an RNA-dependent DNA polymerase reverse transcriptase can act. The nucleic acid tag can be inserted as a 5 'tag of a
Petition 870190078052, of 12/08/2019, p. 57/238
53/194 primer used to initiate reverse transcription. Reverse transcription can be random or sequence specific. After reverse transcription, the original RNA strand can be degraded, followed by synthesis of a second complementary DNA strand. The now double-stranded DNA can be blunt-ended, if necessary, and attached to the adapters in a similar way to the double-stranded DNA molecules already present in the sample. Alternatively, hybrid RNA / DNA molecules can be directly attached to the adapters.
[00128] Single-stranded DNA molecules can be fractionated from double-stranded DNA molecules by treatment with an intramolecular ligase. In some embodiments, the intramolecular ligase is CircLigase ™ ssDNA Ligase to differentially label ssDNA with a 3 'tag. ssDNA is dephosphorylated at the 5 'end prior to treatment with intramolecular ligase to prevent ssDNA circularization. In one example, the ligase used to attach tags to single-stranded DNA is CircLigase ™ ssDNA Ligase. CircLigase ™ ssDNA Ligase is a thermostable ATP-dependent ligase. The second strand synthesis can occur by several mechanisms including single-stranded DNA binding at one end to an oligonucleotide (eg, with T4 RNA ligase) to provide a primer binding site, single-stranded DNA hybridization to complementary oligonucleotides which serve as primers to extend based on the model sequence they are hybridized to, or hybridize to random oligonucleotides, which likewise serve as primers for extension based on the model sequence they are hybridized to. One method uses a single-stranded ligase to attach an oligonucleotide with an extensible 3 'end and to the single-stranded DNA library members (see Gansauge & Meyer, Nature Protocols 8, 737 (2013)). The second strand of DNA is filled in using the adapter as a binding site
Petition 870190078052, of 12/08/2019, p. 58/238
54/194 of primer. A standard 5'DNA phosphorylation step (dsDNA) is then performed to add an adapter to the 5 'end of the library molecules.
[00129] In another method, steps from the commercially available NEBDirect methodology can be included in the method, single-stranded DNA molecules are hybridized to a sequence specific primer for second chain synthesis, followed by ternary repair, and binding to flanking of adapters (see neb.com/nebnext-direct/nebnext-direct-for-etiqueta-enrichment). The second strand of DNA containing the primer is degraded so that it is not sequenced. Another method uses random primers having adapter strings at their 5 'ends and random bases at the 3' end. There are usually 6 random bases, but they can be between 4 and 9 long bases. This approach is particularly susceptible to low single cell entry / amplification for RNAseq or Blssulfite Sequencing (Smallwood et al., Nat. Methods 2014 Aug; 11 (8): 817-820).
[00130] ssDNA can be selectively captured by nucleic acid (NA) probes, by omitting the standard denaturation step before hybridization. The ssDNA-probe hybrids can be isolated from the population of cfNA (free cell nucleic acids) by conventional methods (for example, biotinylated DNA / RNA probes, captured by streptavidin sphere magnets). The probe sequences can be target specific and the same as a panel with a dsDNA operating flow, a subset of that operating flow, or different (for example, targeting RNA fusions at exon-exon junctions, DNA sequences 'hot spot'). All single-stranded nucleic acid (ssNA) can be captured in this step, in an agonistic sequence way using probes with 'universal nucleotide bases', such as
Petition 870190078052, of 12/08/2019, p. 59/238
55/194 deoxyinosine, 3-nitropyrrole, and 5-nitroindole.
[00131] Fig. 1 shows an exemplary scheme for separating forms of nucleic acid. The upper portion of the figure shows a sample including double-stranded DNA, single-stranded DNA, and single-stranded RNA. The reverse RNA is transcribed with a specific sequence or random polyT primer with a 5 'RNA-tag identification nucleic acid. After synthesis of a complementary DNA strand, the RNA model is degraded with RNase H or NaOH or ribosomal depletion by selective hybridization. The sample is then treated with capture probes (which can be specific or agnostic sequence) without denaturing the sample. These probes hybridize to single-stranded molecules by removing single-stranded molecules from the sample. The double-stranded DNA molecules in the sample in this example are then cut at the end and attached to the adapters including nucleic acid tags. In this example, the adapters are Y-shaped, and the double-stranded arm portion of the Y is linked to the DNA molecules. However, the separate single-stranded nucleic acids are processed by the DNA protocol or the NEBdirect protocol, as discussed above, including tag fixation.
[00132] Fig. 2 shows an additional exemplary scheme starting with a sample including double-stranded DNA, single-stranded DNA, and single-stranded RNA, with a streamlined operation flow, most notably obviating a 5 'phosphorylation step DNA. The double-stranded DNA in the sample is first attached to the hairpin adapters including nucleic acid tags. The sample is then de-phosphorylated 5'DNA, and the RNA is then converted to cDNA, and also linked to different tags. The single-stranded DNA is then processed similarly as in Fig. 1. In some embodiments, hairpin adapters can
Petition 870190078052, of 12/08/2019, p. 60/238
56/194 to be cleaved into two strands prior to library amplification. [00133] Fig. 7 illustrates an embodiment of differential labeling. In step 701, a population of nucleic acids is obtained. Nucleic acids can be circulating nude acids (cNA) such as from a liquid biopsy sample (serum, plasma or blood). In step 702, a first form of nucleic acid is differentially labeled to form a mixture (703) of a first form of labeled nucleic acid, and a second form of unlabeled nucleic acid. Subsequently, in step 704, the second form of nucleic acids (or residual nude acids) is labeled with different tags. The above method can include 2 or more different differential labeling steps (702) before step 704. After labeling the two or more forms of nucleic acids in the population, the different forms can, in some embodiments, be divided. If the different forms are divided, the differentially labeled nucleic acids can then be brought together before sequencing or sequenced separately. Preferably, the differential labeling of different forms of nude acids occurs in a reaction tube or volume, and the entire labeled molecule is sequenced (without division). The readings obtained from the sequencing can be used for analysis to be performed on the readings derived from different forms of nude acids, as well as the collective nucleic acid sample.
[00134] In some embodiments, the first form of nucleic acids that is differentially labeled is dsDNA, and differential labeling is performed by attachment to the double-stranded dsDNA adapters comprising a first set of tags. ssDNA (residual nude labels) is then tagged with a different set of tags (second set of tags).
[00135] In some embodiments, the first form of nu acids
Petition 870190078052, of 12/08/2019, p. 61/238
57/194 cleicos that is differentially labeled is DNA from open chromatin regions, and the labeling is carried out by contact of the nucleic acid population with Tn5-mediated transposase activity. [00136] In some embodiments, the first form of nucleic acids that is differentially labeled is double-stranded nucleic acids, and labeling is accomplished by attaching hairpin adapters to double-stranded nucleic acids.
[00137] Division of nucleic acids with different extensions of modification [00138] In certain embodiments described here, a population of different forms of nucleic acids can be divided based on one or more characteristics of the nucleic acids prior to tagging and sequencing. By dividing a heterogeneous nucleic acid population, rare signals can be increased, for example, by enriching rare nucleic acid molecules that are more prevalent in a fraction (or division) of the population. For example, a genetic variation present in RNA, but less (or not) in DNA, can be detected by dividing RNA from DNA. Similarly, a genetic variation present in hypermethylated DNA, but less (or not) in hypomethylated DNA, can be more easily detected by dividing a sample into the hypermethylated and hypo-methylated nucleic acid molecules. By analyzing multiple fractions of a sample, a multi-dimensional analysis of a single molecule can be performed and, consequently, greater sensitivity can be achieved.
[00139] In some examples, a heterogeneous sample of nucleic acid is divided into two or more divisions (for example, at least 3, 4, 5, 6 or 7 divisions). In some embodiments, each division is differentially labeled. Labeled divisions are then brought together for collective sample preparation and / or sequencing
Petition 870190078052, of 12/08/2019, p. 62/238
58/194 ment. The split-tagging-meeting steps can occur more than once, with each split step occurring based on a different characteristic (examples provided here), and labeled using differential tags that are distinguished from other divisions and means of division.
[00140] Examples of characteristics that can be used for division include, sequence length, methylation level, nucleosome binding, sequence mismatch, immunoprecipitation, and / or proteins that bind to DNA. Resulting divisions can include one or more of the following forms of nucleic acid: ribonucleic acids (RNA), single-stranded DNA (ssDNA), double-stranded DNA (dsDNA), shorter DNA fragments, and longer DNA fragments. In some embodiments, a heterogeneous population of nude acids is divided into nucleic acid molecules associated with nucleosomes and nucleic acid molecules devoid of nucleosomes. Alternatively or additionally, a heterogeneous population of nude acids is divided into RNA and DNA. Alternatively or additionally, a heterogeneous population of nude acids can be divided into single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA). Alternatively or additionally, a heterogeneous population of nude acids can be divided into nude acids with one or more epigenetic changes, and without one or more epigenetic changes. Examples of epigenetic changes include the presence or absence of methylation; methylation level, type of methylation (5 'cytosine); and association and level of association with one or more proteins, such as histones. Alternatively, or in addition, a heterogeneous population of nude acids can be divided based on the length of nude acids (for example, molecules up to 160 bp, and molecules having a length of more than 160 bp).
Petition 870190078052, of 12/08/2019, p. 63/238
59/194 [00141] In some examples, each division (representative of a different form of nucleic acid) is differentially labeled, and the divisions are brought together before sequencing. In other examples, the different shapes are separately sequenced.
[00142] Fig. 8 illustrates an embodiment of the disclosure. A population of different nucleic acids (801) is divided (802) into two or more different divisions (803 a, b). Each division (803 a, b) is representative of a different form of nucleic acid. Each division is distinctly labeled (804). The labeled nucleic acids are brought together (807) prior to sequencing (808). Readings are analyzed, in silico. Labels are used to classify readings from different divisions. Analysis to detect genetic variants can be performed at a division-by-division level, as well as a total nucleic acid population level. For example, analysis can include in silico analysis to determine genetic variants, such as CNV, SNV, indel, nucleic acid fusion in each division. In some examples, in silico analysis may include determining chromatin structure. For example, coverage or copy number of sequence readings can be used to determine nucleosome placement in chromatin. Higher coverage may correlate with higher nucleosome occupation in the genomic region, while lower coverage may correlate with lower nucleosome occupation, or depleted nucleosome region (NDR).
[00143] Samples can include nucleic acids that vary in modifications including post-replication modifications to nucleotides and binding, usually non-covalently, to one or more proteins.
[00144] In one embodiment, the nucleic acid population is one obtained from a serum, plasma or blood sample from an individual suspected of having cancer or previously diagnosed with cancer.
Petition 870190078052, of 12/08/2019, p. 64/238
60/194
Nucleic acids include one having varying levels of methylation. Methylation can occur from any one or more post-replication or transcriptional modifications. Post-replication modifications include modifications of the cytosine nucleotide, particularly, 5-methylcytosine, 5-hydroxymethylcytosine, 5-formylcytosine and 5-carboxylcytosine.
[00145] Nucleic acid division is accomplished by contacting the nucleic acids with a methylation-binding domain ("MBD") of a methylation-binding protein ("MBP"). MBD binds to 5methylcytosine (5mC). The MBD is coupled to paramagnetic spheres, such as Dynabeads® M-280 Streptavidin, via a biotin linker. The division into fractions with different methylation extensions can be carried out by elution fractions by increasing the concentration of NaCI.
[00146] In general, elution is a function of the number of methylated sites per molecule, with molecules having more methylation that elutes under increased salt concentrations. To elute DNA in different populations based on the extent of methylation, a series of elution buffers with increased NaCI concentration can be used. The salt concentration can vary from about 100nm to about 2500mM NaCI. In one embodiment, the process results in three (3) divisions. The molecules are contacted with a solution in a first salt concentration, and comprising a molecule comprising a methyl binding domain, the molecule of which can be attached to a capture fraction, such as streptavidin. At the first concentration of salt, a population of molecules will bind to MBD, and a population will remain unbound. The unbound population can be separated as a “hypomethylated” population. For example, a representative first division of the hypomethylated form of DNA is one that remains unbound at a low salt concentration, for example, 160 nM. A second representative division of DNA
Petition 870190078052, of 12/08/2019, p. 65/238
61/194 methylated intermediate is eluted using an intermediate salt concentration, for example, between a concentration of 100 mM and 2000 mM. This is also separated from the sample. A third hypermethylated form representative division of DNA is eluted using a high salt concentration, for example, at least about 2000 nM.
[00147] Each division is differentially labeled. Labels can be molecules, such as nucleic acids, containing information that indicates a characteristic of the molecule with which the label is associated. For example, molecules can support a sample tag (which distinguishes molecules in a sample from those in a different sample), a division tag (which distinguishes molecules in one division from that in a different division), or a molecular tag (which distinguishes different molecules from one another (in both unique and non-unique labeling scenarios). In certain embodiments, a label may comprise one or a combination of barcodes. As used herein, the term "barcode" refers to a A nucleic acid molecule having a particular nucleotide sequence, or the nucleotide sequence itself, depending on the context. A bar code can have, for example, between 10 and 100 nucleotides. A collection of bar codes can have degenerate sequences, or can have strings having a certain Hamming distance, as desired for the specific proposal. So, for example, a sample index, split index, or molecular index, can be comprised of a bar code, or a combination of two bar codes, each attached to different ends of a molecule.
[00148] The tags can be used to tag the individual polynucleotide population divisions in order to correlate the tag (or tags) with a specific division. In some embodiments, a single tag can be used to tag a tag.
Petition 870190078052, of 12/08/2019, p. 66/238
62/194 specific division. In some embodiments, different multiple labels can be used to label a specific division. In embodiments employing different multiple labels to label a specific division, the set of labels used to label a division can be readily differentiated from the set of labels used to label other divisions. In some embodiments, tags can have additional functions, for example, tags can be used to index sample sources, or used as unique molecular identifiers (which can be used to improve the quality of sequencing data by differentiating sequencing errors mutations). Similarly, in some embodiments, tags can have additional functions, for example, tags can be used to index sample sources, or used as non-unique molecular identifiers (which can be used to improve the quality of sequencing data by differentiation mutation sequencing errors). [00149] In one embodiment, the division labeling comprises target molecules in each division with the equivalent of a sample label. After re-combining divisions and sequencing molecules, the sample tags identify the source division. In another embodiment, different divisions are labeled with different sets of molecular tags, for example, comprised of a pair of bar codes. In this way, each molecular bar code indicates the source division, as well as being useful for distinguishing molecules within a division. For example, a first set of 35 bar codes can be used to label molecules in a first division, while a second set of 35 bar codes can be used to target molecules in a second division.
[00150] While labels can be attached to molecules already
Petition 870190078052, of 12/08/2019, p. 67/238
63/194 divided based on one or more characteristics, the final labeled molecules in the library may no longer have these characteristics. For example, while single-stranded DNA molecules can be divided and labeled, the final labeled molecules in the library are likely to be double-stranded. Similarly, while RNA can be subjected to division, in the final library, labeled molecules derived from these RNA molecules are likely to be DNA. Consequently, the label attached to the molecule in the library typically indicates the characteristic of the "source molecule" from which the last labeled molecule is derived, not necessarily for the characteristic of the labeled molecule itself.
[00151] For example, bar codes 1, 2, 3, 4, etc. are used for tag and target molecules in the first division; barcodes A, B, C, D, etc. are used for tag and target molecules in the second division; and barcodes a, b, c, d, etc. are used to label and target molecules in the third division. Differently labeled divisions can be brought together before sequencing. Differentially labeled divisions can be separately sequenced or sequenced together concurrently, for example, in the same flow cell as an Illumina sequencer.
[00152] After sequencing, readings are analyzed to detect genetic variants that can be performed at a division-by-division level, as well as a total nucleic acid population level. Labels are used to classify readings from different divisions. The analysis may include in silico analysis to determine genetic variants and chromatin structure using sequence information, length of genomic coordinates, and coverage or copy number. Higher coverage may correlate with higher nucleosome occupation in the genomic region, while lower coverage may correlate with lower nucleosome occupationPetition 870190078052, of 12/08/2019, p. 68/238
64/194 mo, or depleted nucleosome region (NDR).
[00153] In some embodiments, the nucleic acids in the original population can be DNA and / or RNA, single-stranded, and / or double-stranded. Positioning based on a single chain v. without double strand, it can be accompanied by, for example, using labeled capture probes for dividing ssDNA, and using double strand adapters for dividing dsDNA. The division based on the composition of RNA v. DNA includes, but is not limited to using double-stranded adapters for dividing dsDNA, and using reverse transcription with or without capture probes for dividing double-stranded RNA adapters.
[00154] Affinity agents can be antibodies with the desired specificity, natural binding patterns, or variants thereof (Bock et al., Nat Biotech 28: 1106-1114 (2010); Song et al., Nat Biotech 29, 68 -72 (2011)), or artificial peptides selected, for example, by phage display to have specificity for a given label.
[00155] Examples of capture fractions contemplated here include methyl binding domain (MBDs) and methyl binding proteins (MBPs). Examples of MBPs contemplated here include, but are not limited to:
[00156] MeCP2 is preferably a 5-methyl cytosine-binding protein over unmodified cytosine.
[00157] RPL26, PRP8 and the MHS6 DNA unbalance repair protein preferentially bind to 5-hydroxymethylcytosine over unmodified cytosine.
[00158] FOXK1, FOXK2, FOXP1, FOXP4 and FOXI3 preferably binds to 5-formyl-cytosine over unmodified cytosine (lurlaro et al., Genome Biol. 14, R119 (2013)).
[00159] Specific antibodies for one or more nucleus basesPetition 870190078052, of 12/08/2019, p. 69/238
65/194 methylated peptide.
[00160] Likewise, the division of different forms of nucleic acids can be accomplished using histone-binding proteins that can separate histone-linked nucleic acids from free or unbound nucleic acids. Examples of histone binding proteins that can be used in the methods disclosed herein include RBBP4, RbAp48 and SANT domain peptides.
[00161] Although for some affinity agents and modifications, binding to the agent can occur in an essentially all or no way depending on whether a nucleic acid supports a modification, the separation can be of a degree. In such examples, nucleic acids overrepresented in a modification bind to the agent to a greater extent than nucleic acids overrepresented in the modification. Alternatively, nucleic acids having modifications can bind in any or no way. But then several levels of modification can be sequentially eluted from the binding agent.
[00162] For example, in some embodiments, the division can be binary, or based on the degree / level of changes. For example, all methylated fragments can be divided from non-methylated fragments using methyl binding domain proteins (for example, MethylMinder DNA methylated Enrichment Kit (ThermoFisher Scientific). Subsequently, further division may involve elution of fragments having different levels of methylation by adjusting the salt concentration in a solution with the methyl binding domain and bound fragments. As the salt concentration increases, fragments having a higher level of mutilation are eluted.
[00163] In some examples, the final divisions are representative of nucleic acids having different extensions of modifications (overrepresentative or underrepresentative modifications). Over
Petition 870190078052, of 12/08/2019, p. 70/238
66/194 representation and underrepresentation can be defined by the number of changes that a nucleic acid has made relative to the average number of changes per chain in a population. For example, if the average number of 5-methylcytosine residues in nucleic acid in a sample is 2, a nucleic acid including more than 5-methylcytosine residues is overrepresented in this modification, and a nucleic acid with 1 or zero residues of 5 -methylcytosine is overrepresented. The effect of affinity separation is to enrich the nucleic acids overrepresented in a modification in a bound phase, and for nucleic acids overrepresented in a modification in an unbound phase (that is, in solution). Nucleic acids in the bound phase can be eluted before further processing. [00164] When using the MethylMiner DNA methylated Enrichment Kit (ThermoFisher Scientific), various levels of methylation can be divided using sequential elutions. For example, a hypomethylated division (no methylation) can be separated from a methylated division by contact of the nucleic acid population with the MBD from the kit, which is attached to the magnetic spheres. The spheres are used to separate methylated nucleic acids from non-methylated nucleic acids. Subsequently, one or more elution steps are carried out sequentially to elute nucleic acids having different levels of methylation. For example, a first set of methylated nucleic acids can be eluted at a salt concentration of 160 mM, or higher, for example, at least 200 mM, 300 mM, 400 mM, 500 mM, 600 mM, 700 mM, 800 mM, 900 mM, 1000 mM, or 2000 mM. After such methylated nucleic acids are eluted, magnetic separation is again used to separate higher levels of methylated nucleic acids from those with lower levels of methylation. The steps of elution and magnetic separation can be repeated to create several divisions, such as a division
Petition 870190078052, of 12/08/2019, p. 71/238
67/194 hypomethylated (representative of no methylation), a methylated division (representative of low methylation level), and a hyper methylated division (representative of high methylation level).
[00165] In some methods, nucleic acids bound to an agent used for affinity separation are subjected to a washing step. The wash step washes nucleic acids loosely bound to the affinity agent. Such nucleic acids can be enriched in nucleic acids having the modification to an extent close to the average or median (that is, intermediate between remaining nucleic acids bound to the solid phase, and nucleic acids not binding to the solid phase in initial contact of the sample with the agent).
[00166] The affinity separation results in at least two, and sometimes three or more nucleic acid divisions with different extensions of a modification. While the divisions are still separated, the nucleic acids of at least one division, and usually two or three (or more) divisions are attached to the nucleic acid tags, usually providing as adapter components, with the nucleic acids in different divisions that they receive different labels that distinguish members of one division from another. The tags attached to the nucleic acid molecules in the same division can be the same or different from one another. But if different from one another, the tags may have part of their code in common, in order to identify the molecules to which they are attached as being of a particular division.
[00167] Fig. 3 shows an exemplary diagram. The sample includes nucleic acids with different methylation extensions, some of which also have genetic variations. The samples are contacted with magnetic beads connected to an affinity reagent, preferably binding 5-methylcytosine over cytosine. Affinity purification results in two nucleic acid divisions. The division in es
Petition 870190078052, of 12/08/2019, p. 72/238
68/194 shown in the figure represents nucleic acids that bind to the affinity reagents, and is enriched in nude acids overrepresented in 5-methylcytosine. The division on the right represents nucleic acids that do not bind to the affinity reagent, and is enriched in nude acids missing or underrepresented in 5-methylcytosine. The two divisions are then attached to the Y-shaped adapters including differential and amplified nucleic acid tags. The amplified nude additives are then tested for sequence data, the sample nucleic acid sequence indicating genetic variations, and the label sequence indicating which division of a nucleic acid sample divided into, thereby indicating an extent of modification .
[00168] Fig. 24 provides an illustrative example of MBD division and labeling approaches. In the operation flow (1), a set of molecular tags (for example, 35x35 tags) can be applied to the entire sample prior to division. After division, in this example, for hyper- and hypo-methylated forms, the molecules in each division are optionally amplified and then independently sequenced. In the operating flow (2), the molecules in a sample are divided, for example, based on methylation characteristics. Each division is separately labeled, amplified, and sequenced. In the flow of operation (3), the molecules in each of a plurality of samples are subjected to division, labeled with specific division labels, assembled, and amplified. The molecules in each sample are then provided with a sample tag, to deconvolve the sample from which they originate.
[00169] In some embodiments, the nucleic acid molecules can be fractionated into different divisions based on the nucleic acid molecules that are attached to a specific protein, or
Petition 870190078052, of 12/08/2019, p. 73/238
69/194 to a fragment thereof, and those that are not bound to that specific protein, or fragment thereof. The nucleic acid molecules can be fractionated based on the protein binding of DNA. Protein-DNA complexes can be fractionated based on a specific protein property. Examples of such properties include various epitopes, modifications (for example, histone methylation or acetylation), or enzymatic activity. Examples of proteins that can bind DNA and serve as a basis for fractionation may include, but are not limited to, protein A and protein G. Any suitable method can be used to fractionate nucleic acid molecules based on the protein binding regions . Examples of methods used to fractionate nucleic acid molecules based on protein binding regions include, but are not limited to, SDS-PAGE, immuno-chromatin precipitation (ChIP), heparin chromatography, and asymmetric field flow fractionation ( AF4).
[00170] 5-Methylcytosine nucleic acid pattern determination [00171] Bisulfite-based sequencing and variants of this provides a means of determining the methylation pattern of a nucleic acid. In some embodiments, determining the methylation pattern comprises distinguishing 5-methylcytosine (5mC) from unmethylated cytosine. In some embodiments, determining the methylation pattern comprises distinguishing N ⁶ -methyladenine from unmethylated adenine. In some embodiments, the methylation pattern determination comprises distinguishing 5-hydroxylmethyl cytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) from unmethylated cytosine. Examples of bisulfite sequencing include, but are not limited to, oxidative bisulfite sequencing (OX-BSseq), Tet-aided bisulfite sequencing (TAB-seq), and reduced bisulfite sequencing (redBS-seq).
Petition 870190078052, of 12/08/2019, p. 74/238
70/194 [00172] The oxidative bisulfite sequencing (OX-BS-seq) is used to distinguish between 5mC and 5hmC, by first converting from 5hmC to 5fC, and then proceeding with bisulfite sequencing, as previously described. Tet-aided bisulfite sequencing (TAB-seq) can also be used to distinguish 5mc and 5hmC. In TAB-seq, 5hmC is protected by glycosylation. A Tet enzyme is then used to convert 5mC to 5caC before proceeding with bisulfite sequencing, as previously described. The reduced bisulfite sequencing is used to distinguish 5fC from modified cytosine.
[00173] Generally, in bisulfite sequencing, a nucleic acid sample is divided into two aliquots, and an aliquot is treated with bisulfite. Bisulfite converts native cytosine and certain modified cytosine nucleotides (for example, 5-formylcytosine or 5-carboxylcytosine) to uracil, whereby another modified cytosine (for example, 5-methylcytosine, 5-hydroxylmethylcystein) is not converted. The comparison of nucleic acid sequences of molecules from the two aliquots indicates that the cytosines were and were not converted to uracis. Consequently, the cytosines that have been and have not been modified can be determined. Initial division of the sample into two aliquots is disadvantageous for samples containing only small amounts of nucleic acids, and / or composed of heterogeneous cell / tissue origins, such as body fluids containing free cell DNA.
[00174] The present disclosure provides methods that allow sequencing of bisulfite and variants thereof. These methods operate by binding nucleic acids in a population to a capture fraction, that is, a tag that can be captured or immobilized capture fractions include, without limitation, biotin, avidin, streptavidin, a nucleic acid comprising a sequence of core
Petition 870190078052, of 12/08/2019, p. 75/238
71/194 particular video, a hapten recognized by an antibody, and magnetically attractive particles. The extraction fraction can be a member of a binding pair, such as biotin / streptavidin, or hapten / antibody. In some embodiments, a capture fraction that is attached to an analyte is captured by its binding pair that is attached to an isolable fraction, such as a magnetically attractive particle, or a larger particle that can be pelleted by centrifugation. The capture fraction can be any type of molecule that allows separation of affinity of nucleic acids that support the capture fraction of nucleic acids that lack the capture fraction. Exemplary capture fractions are biotin that allow affinity separation by binding to streptavidin bound or bound to a solid phase, or an oligonucleotide, which allows separation of affinity through binding to a complementary oligonucleotide bound or bonded to a solid phase. After binding capture fractions to the sample nucleic acids, the sample nucleic acids serve as models for amplification. After amplification, the original models remain linked to the capture fractions, but amplicons are not linked to the capture fractions.
[00175] The capture fraction can be linked to the sample nucleic acids as a component of an adapter, which can also provide amplification and / or sequencing of primer binding sites. In some methods, the sample nucleic acids are attached to the adapters and both ends, with both adapters, support a capture fraction. Preferably, any cytosine residues in the adapters are modified, such as by 5 methylcytosine, to protect against bisulfite action. In some examples, the capture fractions are linked to the original models by a cleavable link (eg, photocleavable destiobiotin-TEG residues or uracil cleavable with USER ™ enzyme, Chem. Commun.
Petition 870190078052, of 12/08/2019, p. 76/238
72/194 (Camb). 2015 Feb 21; 51 (15): 3266-3269), in which case the capture fractions can, if desired, be removed.
[00176] The amplicons are denatured and contacted with an affinity reagent to capture the label. The original models bind to the affinity reagent so the nucleic acid molecules result from non-amplification. In this way, the original models can be separated from the nucleic acid molecules resulting from the amplification.
[00177] After separation or division, the respective populations of nucleic acids (ie original models and amplification products) can be subjected to bisulfite treatment with the original model population receiving bisulfite treatment and amplification products not. Alternatively, the amplification products can be subjected to bisulfite treatment, and the original model population cannot. After such treatment, the respective populations can be amplified (which in the case of the original model population converts uracis to thymines). The populations can also be submitted to hybridization of biotin probe for enrichment. The respective populations are then analyzed, and the sequences compared to determine which cytosines were 5-methylated (or 5-hydroxylmethylated) in the original. The detection of a T nucleotide in the model population (corresponding to a non-methylated cytosine converted to uracil), and a C nucleotide in the corresponding position of the amplified population, indicate an unmodified C. The presence of Cs in corresponding positions of the original model and amplified populations indicates a modified C in the original sample.
[00178] In some embodiments, a method uses sequential DNA-seq and bisulfite-seq (BlS-seq) NGS library preparation of the molecular tag of the DNA libraries (see FIG. 4). This process is carried out by tagging adapters (for example, biotiPetição 870190078052, of 12/08/2019, page 77/238
73/194 na), amplification of total library DNA-seq, recovery of source molecule (for example, streptavidin sphere removed), bisulfite and BIS-seq conversion. In some embodiments, the method identifies 5-methicocytosine with single-base resolution, through preparative amplification of sequential NGS of library molecules of origin with and without bisulfite treatment. This can be achieved by modifying the 5-methylated NGS adapters (directional adapters; Y-shaped pitchfork with 5-methylcytosine replacement) used in BIS-seq with a tag (eg biotin) on one of the two adapter chains. The sample DNA molecules are attached to the adapter, and amplified (for example, by PCR). Since only the parent molecules will have a labeled adapter end, they can be selectively recovered from their amplified progeny by specific tag capture methods (for example, streptavidin-magnetic beads). As the parent molecules retain 5-methylation tags, the bisulfite conversion in the captured library will produce a single base 5-methylation state resolution after BIS-seq, retention of molecular information to corresponding DNA-seq. In some embodiments, the bisulfite-treated library can be combined with an untreated library prior to enrichment / NGS by adding a sample tag DNA sequence to a standard multiplexed NGS run stream. As with BIS-seq operation flows, bioinformatics analysis can be performed for genomic alignment and identification of 5-methylated base. In short, this method provides the ability to selectively recover the linked molecules of origin, which carry 5-methylcytosine tags, after amplifying the library, thereby allowing parallel processing for bisulfite converted to DNA. This overcomes the destructive nature of bisulfite treatment in the quality / sensitivity of
Petition 870190078052, of 12/08/2019, p. 78/238
74/194
DNA-seq extracted from an operation flow. With this method, the recovered linked DNA molecules (via labeled adapters) allow amplification of the complete DNA library and parallel application of treatments that induce epigenic DNA modifications. The present disclosure discusses the use of BISseq methods to identify 5-methylation cytosine (5-methylcytosine), but this should not be limiting. Variants of BIS-seq have been developed to identify hydroxymethylated cytosines (5hmC; OX-BS ~ seq, TAB-seq), formylcytosine (5fC; redBS-seq) and carboxylcytosines. These methodologies can be implemented with the preparation of sequential / parallel library described here.
[00179] Alternative Methods of Analyzing Modified Nucleic Acid [00180] The disclosure provides alternative methods for analyzing modified nucleic acids (for example, methylated, linked to histones and other modifications discussed above). In some such methods, a population of nucleic acids supporting the modification to different extents (for example, 0, 1, 2, 3, 4, 5 or more methyl groups per nucleic acid molecule) is contacted with adapters prior to fractionation of the population depending on the extent of the modification. Adapters attach to either one end or both ends of nucleic acid molecules in the population. Preferably, adapters include labels other than sufficient numbers that the number of label combinations results in a low probability, for example, 95, 99 or 99.9% of two nucleic acids with the same start and stop points that they receive the same combination of tags. After attaching the adapters, nucleic acids are amplified from primers that bind to the primer binding sites inside the adapters. Adapters, whether supporting the same or different labels, can include the same
Petition 870190078052, of 12/08/2019, p. 79/238
75/194 or different primer binding sites, but preferably the adapters include the same primer binding site. After amplification, the nucleic acids are contacted with an agent that preferably binds to the nucleic acids that support the modification (such as those previously described). The nucleic acids are separated into at least two divisions that differ in the extent to which the nucleic acids support the binding modification to agents. For example, if the agent has an affinity for nucleic acids supporting the modification, the nucleic acids overrepresented in the modification (compared with average representation in the population) preferentially bind to the agent, so the overrepresented nucleic acids for the modification do not bind or are more easily eluted from the agent. After separation, the different divisions can then be subjected to additional processing steps, which typically include additional amplification, and sequence analysis, in parallel, but separately. Sequence data for the different divisions can then be compared.
[00181] An exemplary scheme for performing such separation is shown in Fig. 5. The nucleic acids are linked at both ends to Y-shaped adapters including primer and label binding sites. The molecules are amplified. The amplified molecules are then fractionated by contact with an antibody preferentially binding to 5-methylcytosine to produce two divisions. A division includes original molecules that lack methylation and copies of amplification having lost methylation. The other division includes original methylation DNA molecules. The two divisions are then processed and sequenced separately with further amplification of the methylated division. The sequence data for the two divisions can then be compared. In this example
Petition 870190078052, of 12/08/2019, p. 80/238
76/194 pio, tags are not used to distinguish between methylated DNA and non-methylated DNA, but preferably, to distinguish between different molecules within these divisions, so that one can determine whether readings with the same starting and stopping points are based on the same or different molecules.
[00182] The disclosure provides additional methods for analyzing a nucleic acid population in which at least some of the nucleic acids include one or more modified cytosine residues, such as 5-methylcytosine, and any of the other modifications described above. In these methods, the nucleic acid population is contacted with adapters including one or more cytosine residues modified at the 5C position, such as 5-methylcytosine. Preferably, all cytosine residues in such adapters are also modified, or all such cytosines in a primer binding region of the adapters are modified. Adapters attach to both ends of nucleic acid molecules in the population. Preferably, adapters include labels other than enough numbers that the number of label combinations results in a low probability, for example, 95, 99 or 99.9% of two nucleic acids with the same start and stop points that receive the same label combination. The primer attachment locations on such adapters can be the same or different, but are preferably the same. After attaching the adapters, nucleic acids are amplified from primers that bind to the primer binding sites on the adapters. The amplified nucleic acids are divided into first and second aliquots. The first aliquot is tested for sequence data with or without further processing. The sequence data in the molecules in the first aliquot is thus determined regardless of the initial methylation status of the nucleic acid molecules. The nucleic acid molecules in the second
Petition 870190078052, of 12/08/2019, p. 81/238
77/194 quota are treated with bisulfite. This treatment converts unmodified cytosines into uracis. Bisulphite-treated nude acids are then subjected to primer-initiated amplification to the original primer binding sites of the adapters attached to the nucleic acid. Only nucleic acid molecules originally attached to adapters (as distinct from their amplification products) are now amplifiable because these nude acids retain cytosines in the primer binding sites of the adapters, so amplification products have lost the methylation of these residues. cytosine, which supported conversion to uracis in bisulfite treatment. Thus, only original molecules in populations, at least some of which are methylated, support amplification. After amplification, these nude acids are subjected to sequence analysis. The comparison of sequences determined from the first and second aliquots may indicate, among other things, that cytosines in the nucleic acid population were subjected to methylation.
[00183] An exemplary scheme for these analyzes is shown in Fig. 6. The methylated DNA is attached to the Y-shaped adapters at both ends including primer and label binding sites. The cytosines in the adapters are 5-methylated. Methylation of the primers serves to protect the primer binding sites in a subsequent bisulfite step. After fixing the adapters, the DNA molecules are amplified. The amplification product is divided into two aliquots for sequencing with and without bisulfite treatment. The aliquot not subjected to bisulfite sequencing can be subjected to sequence analysis with or without further processing. The other aliquot is treated with bisulfite, which converts unmethylated cytosines into uracis. Only primer binding sites protected by cytosine methylation can support amplification.
Petition 870190078052, of 12/08/2019, p. 82/238
78/194 cation when contacted with specific primers for original primer connection sites. In this way, only original molecules and not copies from the first amplification are subjected to further amplification. The additional amplified molecules are then subjected to sequence analysis. The strings can then be compared from the two aliquots. As in Fig. 5, the nucleic acid tags on the adapters are not used to distinguish between methylated and non-methylated DNA, but to distinguish nucleic acid molecules within the same division.
[00184] General Characteristics of the Methods [00185] Samples [00186] The sample can be any biological sample isolated from an individual. A sample can be a body sample. Samples may include body tissues, such as known or suspected solid tumors, whole blood, platelets, serum, plasma, feces, red blood cells, white blood cells, or leukocytes, endothelial cells, tissue biopsies, cerebrospinal fluid , synovial fluid, lymphatic fluid, ascites fluid, interstitial or extracellular fluid, the fluid in spaces between cells, including gingival crevicular fluid, bone marrow, pleural effusions, cerebrospinal fluid, saliva, mucus, sputum, sperm, sweat, urine. The samples are preferably body fluids, particularly blood and fractions thereof, and urine. A sample may be in the form originally isolated from an individual, or it may have undergone further processing to remove or add components, such as cells, or enrich one component relative to another. Thus, a preferred body fluid for analysis is plasma or serum containing free cell nucleic acids. A sample can be isolated or obtained from an individual, and transported to a sample analysis site. The sample can be preserved and loaded at a desirable temperature, for example,
Petition 870190078052, of 12/08/2019, p. 83/238
79/194 room temperature, 4 ° C, -20 ° C, and / or -80 ° C. A sample can be isolated or obtained from an individual at the site of the sample analysis. The individual may be a human, a mammal, an animal, a companion animal, a service animal, or a pet. The individual may have cancer. The individual may not have cancer or a detectable cancer symptom. The individual may have been treated with one or more cancer therapy, for example, any one or more of chemotherapies, antibodies, vaccines, or biologicals. The individual may be in remission. The individual may or may not be diagnosed as being susceptible to cancer or any mutation / genetic disorder associated with cancer.
[00187] The volume of plasma may depend on the desired reading depth for sequenced regions. Exemplary volumes are 0.4-40 ml, 5-20 ml, 10-20 ml. For example, the volume can be 0.5 ml, 1 ml, 5 ml 10 ml, 20 ml, 30 ml, or 40 ml. A sampled plasma volume can be 5 to 20 ml.
[00188] A sample can comprise various amounts of nucleic acid that contain equivalent genomes. For example, a sample of about 30 ng of DNA can contain about 10,000 (10 ⁴ ) human haploid genomes equivalent and, in the case of cfDNA, about 200 billion (2x10 ¹¹ ) individual polynucleotide molecules. Similarly, a sample of about 100 ng of DNA can contain about 30,000 human haploid genome equivalents and, in the case of cfDNA, about 600 billion individual molecules.
[00189] A sample may comprise nucleic acids from different sources, for example, cells and cell-free from the same individual, cells and cell-free from different individuals. A sample can comprise nucleic acids that carry mutations. For example, a sample may comprise DNA that carries germline mutations and / or somatic mutations. Line mutations
Petition 870190078052, of 12/08/2019, p. 84/238
Germinal 80/194 refer to mutations in an individual's germline DNA. Somatic mutations refer to mutations that originate in an individual's somatic cells, for example, cancer cells. A sample may comprise DNA that carries mutations associated with cancer (for example, somatic mutations associated with cancer). A sample can comprise an epigenetic variant (i.e., a chemical modification or protein modification), in which the epigenetic variant is associated with the presence of a genetic variant, such as a cancer-associated mutation. In some embodiments, the sample comprises an epigenetic variant associated with the presence of a genetic variant, in which the sample does not comprise the genetic variant.
[00190] Exemplary amounts of free cell nucleic acids in a sample before amplification range from about 1 pg to about 1 pg, for example, 1 pg to 200 ng, 1 ng to 100 ng, 10 ng to 1000 ng. For example, the amount can be up to about 600 ng, up to about 500 ng, up to about 400 ng, up to about 300 ng, up to about 200 ng, up to about 100 ng, up to about 50 ng, or up to about 20 ng of free cell nucleic acid molecules. The amount can be at least 1 fg, at least 10 fg, at least 100 fg, at least 1 pg, at least 100 pg, at least 1 ng, at least 10 ng, at least 100 ng, at least at least 150 ng, or at least 200 ng of free cell nucleic acid molecules. The amount can be up to 1 femtogram (fg), 10 fg, 100 fg, 1 picogram (pg), 10 pg, 100 pg, 1 ng, 10 ng, 100 ng, 150 ng, or 200 ng of nucleic acid molecules free cell. The method may comprise obtaining 1 femtogram (fg) at 200 ng.
[00191] Free cell nucleic acids are nucleic acids not contained or otherwise bound to a cell or, in other words, nucleic acids remaining in a sample after removal
Petition 870190078052, of 12/08/2019, p. 85/238
81/194 of intact cells. Free cell nucleic acids include DNA, RNA, and hybrids thereof, including genomic DNA, mitochondrial DNA, siRNA, miRNA, circulating RNA (cRNA), tRNA, rRNA, small nucleolar RNA (snoRNA), Piwi-interaction RNA (piRNA) ), Long non -ocoding RNA (long ncRNA), or fragments of any of these. Free cell nucleic acids can be double-stranded, single-stranded, or a hybrid of these. A free cell nucleic acid can be released into the body fluid through secretion or cell death processes, for example, cell necrosis and apoptosis. Some free cell nucleic acids are released into the body fluid of cancer cells, for example, circulating tumor DNA (ctDNA). Others are released from healthy cells. In some embodiments, cfDNA is a free-cell fetal DNA (cffDNA). In some embodiments, free cell nucleic acids are produced by tumor cells. In some embodiments, free cell nucleic acids are produced by a mixture of tumor cells and non-tumor cells.
[00192] Free cell nucleic acids have an exemplary size distribution of about 100-500 nucleotides, with molecules from 110 to about 230 nucleotides representing about 90% of molecules, with a mode of about 168 nucleotides, and a second minor peak in a range between 240 to 440 nucleotides.
[00193] Free cell nucleic acids can be isolated from body fluids through a fractionation or division step in which free cell nucleic acids, as found in solution, are separated from intact cells and other non-soluble components of the body fluid. The division can include techniques such as centrifugation or filtration. Alternatively, cells in body fluids can be lysed and free cell, and cell nucleic acids processed together. Generally, after adding buffers and
Petition 870190078052, of 12/08/2019, p. 86/238
82/194 washing steps, nucleic acids can be precipitated with an alcohol. Additional cleaning steps can be used such as silica-based columns to remove contaminants or salts. Non-specific volume-transporting nucleic acids, such as C _o t-1 DNA, DNA or protein for bisulfite sequencing, hybridization, and / or ligation, can be added throughout the reaction to optimize certain aspects of the procedure, such as Yield. [00194] After such processing, samples can include various forms of nucleic acid including double-stranded DNA, single-stranded DNA, and single-stranded RNA. In some embodiments, single-stranded DNA and RNA can be converted to double-stranded node forms that they are included in subsequent processing and analysis steps.
[00195] Linking DNA Molecules to Adapters [00196] Double-stranded DNA molecules in a sample, and single-stranded RNA, or DNA molecules converted to double-stranded DNA molecules, can be linked to adapters at, or one end, or both ends. Typically, double-stranded molecules are blind-ended by treatment with a polymerase with a 5 ^s -3 'polymerase and a 3' ~ 5 'exonuclease (or proof reading function), in the presence of all four stranded nucleotides. Large fragments of Klenow and T4 polymerase are examples of suitable polymerase. The blunt-ended DNA molecules can be linked with at least partially double-stranded adapter (for example, a bell-shaped or Y-shaped adapter). Alternatively, complementary nucleotides can be added to the blunt ends of sample nucleic acids and adapters to facilitate binding. Included here are both blunt end and adhesive end connections. In the blunt-ended bond, both nucleic acid molecules and tags
Petition 870190078052, of 12/08/2019, p. 87/238
83/194 adapter ports have blunt ends. In adhesive end bonding, nucleic acid molecules typically support an "A" protrusion, and adapters support an "T" protrusion.
[00197] Amplification [00198] The sample nucleic acids flanked by the adapters can be amplified by PCR and other amplification methods. Amplification is typically initiated by primers that bind to the primer binding sites on adapters that flank a DNA molecule to be amplified. The amplification methods may involve cycles of denaturation, annealing and extension, resulting from thermocycling, or they may be isothermal as in transcription-mediated amplification. Other methods of amplification include ligase chain reaction, chain displacement amplification, nucleic acid sequence-based amplification, and self-sustained sequence-based replication.
[00199] Preferably, the present methods perform dsDNA 'T / A bonds' with adapters with T-tail and C-tail, which result in amplification of at least 50, 60, 70 or 80% of double-stranded nucleic acids before connection to adapters. Preferably, the present methods increase the amount or number of amplified molecules relative to the control methods performed with T-tail adapters alone by at least 10, 15 or 20%.
[00200] Labels [00201] Labels comprising bar codes can be incorporated into or otherwise attached to the adapters. The tags can be incorporated by connection, overlapping extension PCR among other methods.
[00202] Molecular Labeling Strategies [00203] Molecular labeling refers to a labeling practice that allows you to differentiate between molecules from which readings of
Petition 870190078052, of 12/08/2019, p. 88/238
84/194 sequence originate. Tagging strategies can be divided into single tagging and non-tagging strategies. In single tagging, all or substantially all of the molecules in a sample support a different tag, so readings can be assigned to the original molecules based on the tag information alone. The tags used in such methods are sometimes referred to as "unique tags". In non-unique labeling, different molecules in the same sample can support the same label, so that other information in addition to the label information is used to assign a sequence reading to an original molecule. Such information can include start and stop coordinates, coordinates to which the molecule maps, start or stop coordinates alone, etc. The tags used in such methods are sometimes referred to as "non-unique tags". Consequently, it is not necessary to tag only every molecule in a sample. This serves to tag only molecules that fall within an identifiable class within a sample. In this way, molecules in different identifiable families can support the same tag without losing information about the identity of the tagged molecule.
[00204] In certain embodiments of non-unique tagging, the number of different tags used may be sufficient that there is a very high probability (for example, at least 99%, at least 99.9%, at least 99.99%, or at least 99.999%, that all molecules of a particular group support a different label. It is to be noted that when bar codes are used as labels, and when bar codes are fixed, for example, randomly, to both ends of a molecule, the combination of bar codes, together, can constitute a label. This number, in term, is a function of the number of molecules that fall
Petition 870190078052, of 12/08/2019, p. 89/238
85/194 in the cells. For example, the class can be all molecules that map to the same start-stop position in a reference genome. The class can be all molecules that map through a particular genetic site, for example, a particular base, or a particular region (for example, up to 100 bases, or a gene or exon of a gene). In certain embodiments, the number of different tags used to uniquely identify a number of molecules, z, in a class, can be between any of 2 * z, 3 * z, 4 * z, 5 * z, 6 * z, 7 * z, 8 * z, 9 * z, 10 * z, 11 * z, 12 * z, 13 * z, 14 * z, 15 * z, I6 * z, 17 * z, 18 * z, 19 * z , 20 * z or 100 * z (for example, lower limit), and any of! 00,000 * z, 10,000 * z, 1000 * z or 100 * z (for example, upper limit).
[00205] For example, in a sample of about 5 ng to 30 ng of free cell DNA, around 3000 molecules are expected to map to a particular nucleotide coordinate, and between about 3 and 10 molecules having any start coordinate to share the same stop coordinate. Consequently, about 50 to about 50,000 different labels (for example, between about 6 and 220 barcode combinations) may be sufficient to label only such molecules. To tag only all 3000 molecules that map via a nucleotide coordinate, about 1 million to about 20 million different tags would be required.
[00206] Generally, the assignment of unique or non-unique barcode labels in reactions follows methods and systems described by United States patent applications 20010053519, 20030152490, 20110160078, and United States Patent. No. 6,582,908 and United States Patent. No. 7,537,898 and United States Patent No. 9,598,731. The tags can be attached to the sample nucleic acids randomly or non-randomly.
[00207] In some embodiments, nucleic acids tag
Petition 870190078052, of 12/08/2019, p. 90/238
86/194 of them are sequenced after loading into a microcavity plate. The microwell plate can have 96, 384, or 1536 micro wells. In some cases, they are introduced in an expected proportion of unique microcavity labels. For example, unique labels can be loaded so that more than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, 100, 500, 1000, 5000, 10000 , 50,000, 100,000, 500,000, 1,000,000, 10,000,000, 50,000,000 or 1,000,000,000 unique tags are loaded per genome sample. In some cases, single tags can be loaded so that less than about 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, 100, 500, 1000, 5000, 10000, 50,000. 100,000. 500,000. 1,000,000. 10,000,000. 50,000,000 or 1,000,000,000 of unique tags are loaded per genome sample. In some cases, the average number of unique tags loaded per sample genome is less than, or more than, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50 , 100, 500, 1000, 5000, 10000, 50,000. 100,000. 500,000. 1,000,000. 10,000,000. 50,000,000 or 1,000,000,000 of unique tags per genome sample.
[00208] A preferred format uses 20-50 different label bar codes attached to both ends of label nucleic acids. For example, 35 different label bar codes attached to both ends of target molecules that create 35 x 35 permutations, which equate 1225 to 35 label bar codes. Such tag numbers are sufficient so that different molecules having the same starting and stopping points have a high probability (for example, at least 94%, 99.5%, 99.99%, 99.999%) of receiving different combinations of labels. Other barcode combinations include any number between 10 and 500, for example, about 15x15, about 35x35, about 75x75, about 100x100, about 250x250, about 500x500.
Petition 870190078052, of 12/08/2019, p. 91/238
87/194 [00209] In some cases, single tags may be predetermined or random or semi-random sequence oligonucleotides. In other cases, a plurality of bar codes can be used such that bar codes are not necessarily unique to each other in the plurality. In this example, bar codes can be linked to individual molecules, such that the combination of the bar code and the sequence can be linked to create a unique sequence that can be individually scanned. As described herein, the detection of non-unique bar codes in combination with sequence data from the start (start) and end (stop) portions of sequence readings, may allow assignment of a unique identity to a particular molecule. The length or number of base pairs, from an individual sequence reading, can also be used to assign a unique identity to such a molecule. As described herein, fragments of a single strand of nucleic acid having been assigned a unique identity, can thus allow subsequent identification of fragments from the source strand.
[00210] Target enrichment [00211] In certain embodiments, the nucleic acids in a sample can be subjected to target enrichment, in which molecules having tag sequences are captured for subsequent analysis. Target enrichment may involve using a set of baits comprising oligonucleotide baits labeled with a capture fraction, such as biotin. The probes can have sequences selected to coat through a panel of regions, such as genes. In some embodiments, a bait set may have a higher relative concentration for more specifically desired sequences of interest. Such sets of baits are combined with a sample under conditions that allow hybridization of the target molecules with the baits. Then the molecules
Petition 870190078052, of 12/08/2019, p. 92/238
88/194 captured are isolated using the capture fraction. For example, a fraction of biotin capture by streptavidin based on a sphere. Such methods are further described in, for example, USSN 15 / 426,668, filed on February 7, 2017 (United States Patent 9,850,523, published on December 26, 2017).
[00212] Sequencing [00213] Sample nucleic acids flanked by adapters with or without previous amplification can be subjected to sequencing. Sequencing methods include, for example, Sanger sequencing, high throughput sequencing, pyro sequencing, sequencing-by-synthesis, single molecule sequencing, nano-pore sequencing, semiconductor sequencing, sequencing-by-linking, sequencing-by hybridization , RNA-Seq (Illumina), Digital gene expression (Helicos), Next generation sequencing (NGS), Single Synthesis Molecule Sequencing (SMSS) (Helicos), massively parallel sequencing, Single Clonal Molecule Matrix (Solexa), shotgun sequencing, Ion Torrent, Oxford Nanopore, Roche Genia, Maxim-Gilbert sequencing, primer walking sequencing, using PacBio, SOLiD, Ion Torrent, or Nanopore platforms. Sequencing reactions can be performed in a variety of sample processing units, which can be multiple lanes, multiple channels, multiple wells, or other means of processing multiple sample sets substantially simultaneously. The sample processing unit may also include multiple sample chambers to enable processing of multiple operations simultaneously.
[00214] Sequencing reactions can be performed on one or more forms of nucleic acids, at least one of which is known to contain cancer markers, or another disease. The areas
Petition 870190078052, of 12/08/2019, p. 93/238
89/194 sequencing sessions can also be performed on any nucleic acid fragments present in the sample. Sequence reactions can provide genome sequence coverage of at least 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 99.9% or 100%. In other cases, genome sequence coverage may be less than 5%, 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90% , 95%, 99%, 99.9% or 100%. Sequence coverage can be performed on at least 5, 10, 20, 70, 100, 200 or 500 different genes, or at most 5000, 2500, 1000, 500 or 100 different genes.
[00215] Simultaneous sequencing reactions can be performed using multiplex sequencing. In some cases, free cell nucleic acids can be sequenced with at least 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 50000, 100,000 sequencing reactions. In other cases, free cell nucleic acids can be sequenced with less than 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 50000, 100,000 sequencing reactions. Sequencing reactions can be performed sequentially or simultaneously. Subsequent data analysis can be performed on all or part of the sequencing reactions. In some cases, data analysis can be performed on at least 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 50000, 100,000 sequencing reactions. In other cases, data analysis can be performed in less than 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 50000, 100,000 sequencing reactions. An exemplary reading depth is 1000-50000 readings per location (base).
[00216] Analysis [00217] The present methods can be used to diagnose the presence of conditions, particularly cancer, in an individual, to
Petition 870190078052, of 12/08/2019, p. 94/238
90/194 characterize conditions (for example, stage of cancer or determination of the heterogeneity of a cancer), monitor response to treatment of a condition, effect risk of prognosis of development of a condition or subsequent course of a condition. The present disclosure may also be useful in determining the effectiveness of a particular treatment option. Successful treatment options can increase the amount of copy number variation or rare mutations detected in an individual's blood if treatment is successful as more cancers can kill and eliminate DNA. In other examples, this cannot happen. In another example, perhaps certain treatment options can be correlated with cancer genetic profiles over time. This correlation can be useful in selecting a therapy. In addition, if a cancer is observed to be in remission after treatment, the present methods can be used to monitor residual disease or disease recurrence.
[00218] The types and number of cancers that can be detected can include blood cancers, brain cancers, lung cancers, skin cancers, nose cancers, throat cancers, liver cancers, bone cancers, lymphomas, cancers pancreatic, skin cancers, bowel cancers, rectal cancers, thyroid cancers, bladder cancers, kidney cancers, mouth cancers, stomach cancers, solid state tumors, heterogeneous tumors, homogeneous tumors, and the like. Cancer type and / or stage can be detected from genetic variations including mutations, rare mutations, indels, copy number variations, transversions, translocations, inversion, cancellations, aneuploidy, partial aneuploidy, polyploidy, chromosomal instability, changes in chromosomal structure, gene fusions, chromosome fusions, gene truncations, gene amplification, gene duplications, chromosome lesions
Petition 870190078052, of 12/08/2019, p. 95/238
91/194 more, DNA damage, abnormal changes in chemical modifications of nucleic acid, abnormal changes in epigenetic patterns, and abnormal changes in 5-methylcytosine nucleic acid.
[00219] Genetic data can also be used to characterize a specific form of cancer. Cancers are often heterogeneous in both composition and stage. Genetic profile data may allow the characterization of specific subtypes of cancer that may be important in the diagnosis or treatment of that specific subtype. This information can also provide an individual or doctor with clues related to the prognosis of a specific type of cancer and allow, or allow an individual or doctor to adapt to treatment options as the disease progresses. Some cancers can progress to become more aggressive and genetically unstable. Other cancers can remain benign, inactive or latent. The system and methods of this disclosure can be useful in determining disease progression. [00220] The present analyzes are also useful in determining the effectiveness of a particular treatment option. Successful treatment options can increase the amount of copy number variation or rare mutations detected in an individual's blood if treatment is successful as more cancers can kill and eliminate DNA. In other examples, this may not be the case. In another example, perhaps certain treatment options may be correlated with cancer genetic profiles over time. This correlation can be useful in selecting a therapy. In addition, if a cancer is found to be in remission after treatment, the present methods can be used to monitor residual disease or disease recurrence.
[00221] The present methods can also be used to detect genetic variations in conditions other than cancer.
Petition 870190078052, of 12/08/2019, p. 96/238
92/194
Immune cells, such as B cells, can support rapid clonal expression after the presence of certain diseases. Clonal expansions can be monitored using copy number variation detection and certain immune states can be monitored. In this example, analysis of the copy number variation can be performed over time to produce a profile of how a particular disease may be progressing. Copy number variation or even detection of rare mutations can be used to determine how a population of pathogens is changing during the course of infection. This can be particularly important during chronic infections, such as HIV / AIDS, or Hepatitis infections, so viruses can change the state of the life cycle and / or change in more virulent forms during the course of infection. The present methods can be used to determine or profile rejection activities in the host's body, as immune cells try to destroy the transplanted tissue to monitor the state of the transplanted tissue, as well as altering the course of treatment or prevention of rejection.
[00222] Still, methods of disclosure can be used to characterize the heterogeneity of an abnormal condition in an individual. Such methods may include, for example, generating a genetic profile of extracellular polynucleotides derived from the individual, in which the genetic profile comprises a plurality of data resulting from copy number variation and rare mutation analysis. In some embodiments, an abnormal condition is cancer. In some embodiments, the abnormal condition may be one resulting in a heterogeneous genomic population. In the cancer example, some tumors are known to comprise tumor cells at different stages of the cancer. In other examples, heterogeneity can comprise multiple foci of disease. Again, in the cancer example, there may be multiple tumor foci, perhaps where one or
Petition 870190078052, of 12/08/2019, p. 97/238
93/194 more outbreaks are the result of metastases that have spread from a primary site.
[00223] The present methods can be used to generate or profile, fingerprint or data set which is a summation of generic information derived from different cells in a heterogeneous disease. This data set can comprise copy number variation and mutation analyzes alone or in combination.
[00224] The present methods can be used to diagnose, predict, monitor or observe cancers, or other diseases. In some embodiments, the methods here do not involve the diagnosis, prognosis or monitoring of a fetus, and as such, are not intended for non-invasive prenatal testing. In other embodiments, these methodologies can be employed in a pregnant individual to diagnose, predict, monitor or observe cancers or other diseases in an unborn individual whose DNA and other polynucleotides can co-circulate with maternal molecules.
[00225] An exemplary method for identifying molecular tag of MBD-based split sphere libraries via NGS is as follows:
[00226] Physical division of an extracted DNA sample (eg, blood plasma DNA extracted from a human sample) using a methyl protein-sphere purification domain binding kit, saving all process elutions for downstream.
[00227] Parallel application of differential molecular tags and NSG training adapter sequences to each division. For example, hypermethylated residual methylation ('washing'), and hypomethylated divisions are linked with NGS-adapters with molecular tags.
Petition 870190078052, of 12/08/2019, p. 98/238
94/194 [00228] Re-combination of all labeled molecular divisions, and subsequent amplification using adapter specific DNA primer sequences.
[00229] Enrichment / hybridization of recombinant and amplified total libraries, labeling of genomic regions of interest (for example, specific genetic variants of cancer, and differentially methylated regions).
[00230] Re-amplification of the enriched total DNA library, attaching a sample tag. Different samples are collected, and tested in multiplex on an NGS Instrument.
[00231] Bioinformatics analysis of NGS data, with the molecular tags being used to identify unique molecules, as well as sample devolution in molecules that were differentially MBD-divided. This analysis can produce information on 5-methylcytosine relative to genomic regions, concurrent with genetic sequencing / variant detection, patterns.
[00232] Ways to practice disclosure [00233] The present disclosure provides a method of understanding the division of populations of free cell nucleic acid (cfNA) into divisions that share one or more similar characteristics.
[00234] The methods of the present disclosure can be carried out to divide single-stranded nucleic acids (ssNA; ssDNA, RNA) and dsDNA, whereby dsDNA molecules are prepared through standard library preparation, and ssNA are prepared in a flow of operation of preparing an adjunct library that converts ssNAs into an altered form with enrichment, sequencing (eg, NGS), and analysis, while retaining information about the type of biomolecule that originates (ie, RNA, ssDNA, dsDNA) .
[00235] Approaches in the preparation of an inclusive cfNA library may involve (a) converting RNA into an identifiable ssDNA
Petition 870190078052, of 12/08/2019, p. 99/238
95/194 speed, and (b) division of ssDNA and dsDNA molecules for preparation of parallel NGS library, (c) followed by (optional) target enrichment, (d) NGS and downstream data analysis to identify type of sequence molecule (see FIG. 1).
[00236] In some embodiments, dsDNA-specific NGS adapter binding of the cfNA population can be performed prior to molecular RNA labeling, specific binding, cDNA conversion, and NGS library preparation. Simultaneous sequencing methodology, in which dsDNA, then RNA, is sequentially linked to create a NGS library, without division, can be applied to cfNA samples, as shown in Fig. 2.
[00237] In some embodiments, platform bonding uses Y-shaped or 'pitchfork' adapters that produce ds-cf-DNA molecules linked with 5 'and 3' ends ssDNA. These ends can be weakly ligated by Hgase RNA (or Circligase ™ ll) in simultaneous sequencing or traditional ssDNA library preparation methodologies. By changing the ends of the Y-shaped adapters to hairpins or blisters, the linked cf-dsM DNA molecules no longer have ssDNA ends, and are not a substrate for subsequent ssNA binding in simultaneous sequencing / library preparation. Traditional DNA. Thus, reinventing NGS adapters to contain non-free ssDNA ends enables the preparation of RNA and ssDNA library in addition to a dsDNA operating flow, without dividing molecule types.
[00238] The methods of the present disclosure can be performed on a population of cfNA with reverse transcription enzymes using specific / random / polyT DNA primer genes with a molecular labeling tail, subsequently removing the RNA by hydrolysis of RNase H or NaOH, producing an eti ssDNA
Petition 870190078052, of 12/08/2019, p. 100/238
96/194 quetum (cDNA) to replace each RNA molecule. Additional methodologies known to those skilled in the art can be employed to remove unwanted RNA sequences, such as depletion of ribosomal RNA by selective hybridization.
[00239] ssDNA can be selectively captured by NA probes, by omitting the standard denaturation stage before hybridization. The hybrids of ssDNA probes can be isolated from the cfNA population by methods known in the art (for example, biotinylated DNA / RNA probes, captured by streptavidin-sphere magnets). The probe sequences can be tag specific, and the same as a panel with a dsDNA operating flow, a subset of that operating flow, or different (for example, labeling RNA fusions at exon-exon junctions, sequences of 'Hot spot' DNA). In addition, all ssNA can be captured in this step, in a sequence agonistic manner using probes with 'universal nucleotide bases', such as deoxyinosine, 3-nitropyrrole, and 5-nitroindole.
[00240] In addition to genetic variations such as SNV, indels, gene fusions, and CNV, identified by DNA sequencing, epigenetic variations (such as 5-methylcytosine, histone methylation, nucleosome positioning, and micro and RNA expression long non-coding), can lead to or be involved in disease progression, such as cancer. High-yield measurements of epigenetic markers require intricate molecular biology techniques, developed specifically for each type of epigenetic tag. As such, epigenetic sequencing projects are typically parallel to (genetic) DNA sequencing, and require large amounts of input. Differently formulated, detection of multi-analyte biomarker is performed with sample destruction.
Petition 870190078052, of 12/08/2019, p. 101/238
97/194 [00241] Both genetic sequencing (DNA) and epigenetic sequencing of free cell DNA have diagnostic value for non-invasive prenatal testing (NIPT) and cancer monitoring / detection. In both applications, the amount of genetic material is limiting and identification of rare molecular events is paramount. Thus, with current methodologies, the performance of epigenetic sequencing results in a reduction in sensitivity in the detection of genetic variants, as each type of marker requires a dedicated sample.
[00242] The present disclosure provides methods for obtaining information on the 5-methylcytosine DNA epigenetic process, but the molecular labeled division methodology outlined for 5-methylcytosine can also be applied to other epigenetic mechanisms. Similarly, labeling and retrieval of NGS-originating DNA molecules attached to an adapter, as outlined in the present disclosure for identification of 5-methylcytosine (5mC), can also be used to identify other epigenetic DNA modification marks (for example, hydroxymethylate) , formyl, and carboxyl; 5hmC, 5fC, and 5caC, respectively).
[00243] With respect to 5 ~ methylcytosine, bisulfite sequencing has been the most popular approach, capable of resolving 5-methylcytosine bases with single base resolution. This method involves a chemical treatment (bisulfite) that acts on all cytosine bases, converting them to a uracil, unless they are 5-methylated or 5-hydroxylmethylated. Sequencing after bisulfite treatment will result in residues of 5-methylated cytosines and 5hydroxylmethylated cytosines detected as cytosine, while non-methylated cytosines, 5-formylmethylated cytosines, and 5carboxylmethylated cytosines are detected as thymine. Variations of bisulfite sequencing, previously described, may be additional
Petition 870190078052, of 12/08/2019, p. 102/238
98/194 distinguish between 5mC, 5hmC, 5fC, and 5caC. The main limitation of this approach is that most of the generic material is lost. Severe bisulfite treatment degrades <99% of incoming DNA, thereby reducing the molecular complexity of the sample and the achievable limit of detection. Molecular biology DNA amplification techniques present (eg, PCR, LAMP, RCA) are agnostic to the 5-state of cytosine methylation, and thus, 5-methylation marks are lost with amplification. This is extremely undesirable in liquid biopsy applications. In addition, with bisulfite-converted DNA libraries that detect somatic variants become more challenging (for example, differentiating a C-> T SNV from a non-methylated cytosine). Thus, bisulfite-treated DNA is not used to detect a genetic variant in liquid biopsy applications. Performing 5-methylcytosine analysis and genetic variant calling in DNA requires that the sample be split, which reduces input / detection sensitivity in each operation flow, and prevents identification of both 5-methylcytosine genetic information and variants in a molecule only.
[00244] In certain embodiments, nucleic acids are divided based on methylation differences. Forms of "hypermethylation" and "hypomethylation" of nucleic acids can be defined as molecules that fall above and below, respectively, a particular degree of methylation differentiated by the particular division method used. For example, the division method can select molecules having at least 2, at least 3, at least 4, at least 5, or at least 6 methylated nucleotides. Methylation extension refers to the number of methylated nucleotides in a nucleic acid fragment. Identification of DNA molecules that are relatively “hypermethylated” in a DNA sample can be achieved by capturing molecules that bind to a methyl-binding domain protein
Petition 870190078052, of 12/08/2019, p. 103/238
99/194 (MBD), or a fragment or variant thereof. MBD can also be referred to as a MetU-CpG binding domain. The MBD protein can be complexed with magnetic spheres. In some embodiments, a protein that binds to MBD is MECP2, MBD1, MBD2, MBD3, MBD4, or a fragment or variant thereof. Although 5-methylation sites are not directly indicated with this method (no bisulfite conversion), overlapping bioinformatics analysis of hypermethylated fragments can determine specific 5-methylcytosine site (s). The main problem with this method is that by sequencing only the hypermethylated division, the majority of the human genome that is non-methylated (-80-97% by mass) is not sequenced, which prevents / limits the identification of genetic variants (for example, SNV, indels, and CNVs), as these are regions of low coverage, or do not present at all in the hypermethylated division.
[00245] The present disclosure provides methods for obtaining 5-methylcytosine data and for obtaining sequencing data for detecting a rare genetic variant in the same low input sample (e.g., liquid biopsy operation flow). For example, an approach comprising MBD fractionation and labeling is non-destructive to nucleic acids in the sample, and preserves genome complexity after amplification. In addition, fractionation-tagging approaches (for example, MBD fractionation and tagging) can differentially recombine divided nucleic acid molecules to ensure preservation of genome complexity and enable detection of multi-analyte biomarker (genetic and epigenetic variant). In contrast, other approaches can be destructive to nucleic acid molecules in a sample. These other approaches may include bisulfite sequencing, methyl sensitive restriction enzyme digestion, and
Petition 870190078052, of 12/08/2019, p. 104/238
100/194 heating of MBD in cases where only a fraction or group of nucleic acid molecules is analyzed (for example, hypermetallated nucleic acid molecules). For example, bisulfite sequencing creates physical damage to nucleic acid molecules. Digestion of methyl-sensitive restriction enzyme reduces genome complexity by destroying a non-methylated fraction, leaving only methylated nucleic acids intact. MBD enrichment, in examples where only MBD-linked nucleic acid molecules are analyzed, can similarly be used to isolate only a single fraction of nucleic acids in a sample. Approaches analyze only a single fraction of nucleic acid molecules destroying information about nucleic acid molecules present in an unenriched portion.
[00246] The methods provided herein for obtaining 5-methylcytosine data (or other methylation status data) can be practiced in combination with the methods described above for obtaining single-stranded nucleic acid and double-stranded nucleic acid information. In some embodiments, the methods here quantify% of hypermethylated DNA by differentially labeling DNA molecules that have been divided by MBD beads at varying degrees of methylation. (See Fig. 3). In this method, all MBD division protocol eluents can be recovered, and an NGS-library prepared with different sets of molecular tags correspond to their MBD division. In this way, the MBD division process reduces the loss of material present with typical bisulfite treatment. As the linked divisions can be re-combined before amplification / enrichment / NGS, there is minimal defect for DNA operation flow sequencing. MBD binds to double-stranded DNA (dsDNA), thereby dividing MBD retains the double-stranded nature of sample DNA, allowing labeling
Petition 870190078052, of 12/08/2019, p. 105/238
101/194 double-stranded molecular by sensitive DNA sequencing methodologies.
[00247] In an NSG operation flow of MBD split molecular tag, the molecular tags can serve two purposes - identification of unique DNA molecules from the sample (by combining tag and genomic start / end coordinates), and indicating the relative level of 5-methylcytosine of the molecule. Molecular tags can be used to identify and count unique nucleic acid molecules. This information can be used to calculate amplification imbalances. Molecular labels can allow the original complexity of the sample to be discerned. Molecular labeling can be used to identify and count nucleic acid molecules in one even when there is non-uniform amplification. The above methodology describes physical division by degree of 5-methylcytosine, application of differential molecular tags, recombine library, enrichment, NGS and bioinformatics decoupling of each originating molecule division, competing with DNA-seq, used for genetic sequencing / variant detection . The methodology is extensible to characterize other interactions by replacing the methylation-binding protein (MBD) division with different DNA and protein binding elements that retain the double-stranded nature of DNA molecules. For example, histone antibodies, modified histones, and transcription factors used in various immunoprecipitation protocols can replace MBD division to generate relative information on nucleosome positioning, nucleosome modification, and transcription factor binding associated with every molecule of DNA in a sample through the use of differential sets of molecular tags.
[00248] Data analysis [00249] A greater challenge faced by the methylation analysis of
Petition 870190078052, of 12/08/2019, p. 106/238
102/194 cancer in liquid biopsy is the heterogeneity of the cell type. In addition to the inherent and well-documented heterogeneity of cancer, free cell DNA in plasma represents a type of mixed cell death that is predominantly unrelated to cancer. For example, cell death can be in a non-malignant organ, a physiological hematopoietic lineage. Added to this complexity is that even non-cancer cells in the stromal component are very distinct, for example, vascular and endothelial cells from lymphoids and pericytes, immune cells such as macrophages, leukocytes and lymphocytes, stromal fibroblasts, myofibroblasts, myoepithelial cells, as well as fat cells, endocrine cells, nerve cells, and other cellular and tissue elements that have different developmental origins. Therefore, in some embodiments, adjustment for changes in cell type composition is made when analyzing and interpreting liquid biopsy findings.
[00250] The conduct of analysis may involve the following steps: [00251] an occupation resolution [00252] Location of dyads, assigning stringency [00253] Adjustment of the Gaussian mixture model within individual genomic elements across the entire genome [00254] Deconvolution of cell lines at the gene level.
[00255] As an illustrative example, cfDNA fragment start enrichment profile can be separately determined on samples from individual divisions. For example, divided samples can comprise hyper, hypo, or intermediate methylated DNA. The cfDNA fragment start enrichment profile determined can be used to establish nucleosomal occupation within relevant regulatory elements, for example, TSS, enhancer region, distal intergenic elements. For each division, the occupation peaks, for example, dyad, can be determined, and their
Petition 870190078052, of 12/08/2019, p. 107/238
103/194 tringency can be attributed. A tapered profile associated with a cell state observed in healthy plasma samples can be established by determining the enrichment profile of the beginning of the cfDNA fragment and location of the dyads in a large non-malignant control (for example, a sample from an individual healthy, or a plurality of healthy individuals). For any sample, the Gaussian mix model can be adjusted using the conical profile as defined above to produce residual occupation corresponding to a malignant (non-canonical) chromatin state observed in the divided samples, thereby determining peaks and fragment profiles of non-canonical cfDNA. Non-canonical cfDNA fragment peaks and profiles can be associated with malignant chromatin status in cancer in each divided sample. The biological regulation by methylation can be mediated by a single CpG, or by a group of CpGs in proximity to each other. Therefore, regional DNA methylation analysis offers a more comprehensive and systematic view of methylation data. Typically, methylation information is summarized on tiled windows, or on a set of predefined regions (promoters, CpG islands, introns, and so on). [00256] The organization of the nucleosome can be determined by two independent metrics, such as nucleosome occupation and nucleosome positioning. Nucleosome occupation can be understood as the probability that a nucleosome is present over a specific genomic region within a population of cells. Nucleosome occupancy can be measured in sequencing-based experiments as coverage (number of Unhada sequencing readings mapped to the genomic region. Nucleosome positioning may be the probability that a nucleosome reference point (for example, a dyad) is in a specific genomic coordinate relative to the surrounding coordinates.
Petition 870190078052, of 12/08/2019, p. 108/238
104/194
As shown in Fig. 9, good nucleosome positioning can be biologically interpreted as a nucleosome dyad that occurs in the same genomic coordinate every time it is present. Poor positioning can be interpreted as a dyad of a nucleosome that occupies a range of positions within the same general footprint as a total nucleosome. In one example, samples from 8 individuals with lung cancer were used to determine centers of the dyads. Nucleosome positioning and nucleosome occupation were determined. For example, high occupancy and good positioning can be indicated when coverage is> 0.5 Quantile (Qu) and peak width is <0.5 Qu. In some examples, the distance between dyad centers in fractionated samples (such as hyper- / hypomethylated fractions) can be compared with non-fractionated (no MBD). In some cases, dyad centers as well as adjacent chromatin structures can be resolved by assigning dyad centers to all peaks with occupation of all peaks with occupation coverage above 5% across the genome. Occupancy coverage can be 15%, 20%, 25% or 30%. Occupancy coverage can be assigned using machine learning approaches by determining peak location, width, length, center and width resolution. This provides an empirical resolution of chromatin architecture for plasma DNA.
[00257] An increase in the coverage of sequence readings may be correlated with greater nucleosome occupation. Still, the occupation of nucleosome can be inversely related to the depleted region of nucleosome (NDR). The increase in nucleosome occupation may indicate alternating chromatin structure, such as more compacted chromatin. The compacted chromatin may be indicative of down-regulation of gene expression that can disrupt normal cell function. The disturbance in the operation Petition 870190078052, of 12/08/2019, p. 109/238
105/194 normal cell growth can serve as an indication of diseases, such as cancer.
[00258] Free cell DNA comprises signal from a heterogeneous population of cells (for example, death, malignant, non-malignant, etc.). The heterogeneous population of cells may have nucleic acids with multiple chromatin states. In some examples, multiple chromatin states may include different states of nucleosome occupation, such as well-positioned or dispersed ("diffuse") nucleosomes. Well-positioned nucleosomes show greater coverage, whereas diffuse nucleosomes show less coverage of sequence readings. Based on coverage of sequence readings, nucleosome occupation through chromatin can be solved.
[00259] "Deconvolution" can refer to the process of decomposing peaks of occupation of a free cell DNA fragment that overlaps with each other, thereby extracting information about the "hidden peak". Deconvolution of nucleosome occupation peaks can be achieved by dividing MBD. The division of nucleic acids into hypermethylated and hypomethylated divisions can produce two distinct peaks, peak 1 and peak 2. However, when the nucleic acids are not fractionated, a continuous peak can be obtained, and peak deconvolution associated with the peak 1 malignancy. non-malignancy 2 may not be viable.
[00260] Dyads can be regions of DNA occupied by the center of the nucleosome. Dyads can be located in divided samples. In some cases, nucleic acids are divided into a hyper- and hypo-methylated fraction. The positioning or location of the dyad can be performed using the free reference method or the reference-based method. The free reference method may include in situ combination of both hyper and hypo divisions to determine sub dyad position
Petition 870190078052, of 12/08/2019, p. 110/238
106/194, thus determining a dyad map. In some cases, hyper- and hypo-methylated division sequencing data are combined to determine nucleosome occupation, and are compared across divisions, for example, combine signal from all divisions, and detect occupation peaks, then compare locations of those seen in hyper vs hypo. Baseline method may include independent division analysis. For example, nucleosome occupation for hyper and hypomethylated fractions are determined. The nucleosome occupation for each division in a first experiment can be used for corresponding division in subsequent experiment (s), where the same part 1 is done independently in a large set of samples (WGS standard would be sufficient, since information to the division basis is not used, and information is combined to optimize peak resolution), and the peak occupation map is stored as a “reference” against each single division (or both) can be compared.
[00261] Fragment signatures based on fragment data [00262] Methods of examining fragment data are described in, for example, publication US 2016/0201142 (Lo), WO 2016/015058 (Shendure), and PCT / US17 / 40986 , filed on July 6, 2017 (“Methods For Fragmentome Profiling Of Cell-Free Nucleic Acids”), all of which are incorporated herein by reference. Fragmentomic data refers to sequence data obtained by analyzing fragments of nucleic acid. For example, sequence data can include fragment length (in base pairs), genomic coordinates (for example, start and stop locations in the reference genome), coverage (for example, number of copies), or sequence information (for example, bases A, G, C, T). Fragmentomic data refer to match sequence information and pa
Petition 870190078052, of 12/08/2019, p. 111/238
107/194 fragments and associated occupation in free cell DNA corresponding to the enrichment of protected content of free cell DNA observed in blood or plasma.
[00263] For example, one can determine, in a sample, the number of cfDNA molecules having their central point mapping to particular nucleotide coordinates across the genome, or a tag portion of it. In a healthy individual, this would typically produce a waveform in which the peaks of the graph represent nucleosome positions (for example, where cellular DNA is not cleaving during conversion to cfDNA), and the gutters represent inter-nucleosome positions (for example, where many molecules are cloned and, consequently, few molecules are centered). The distance between peaks represents nucleosome dyads. In malignant cells, the positions of nucleosomes can change, for example, as a function of methylation. In this case, a change in the peak and track positions on the graph is expected. Such changes can be more easily detected by dividing molecules based on different characteristics, and by examining fragment distribution for each division. The fragment data can be further analyzed in one or a plurality of more dimensions. For example, in any coordinate, the number of molecules that maps it can be further differentiated based on the size of the fragment. In a graph based on such data, a third dimension “Z”, represents fragment size. So, for example, in a two-dimensional graph, the X axis represents genomic coordinate and the Y axis represents number of molecules map to the coordinate. In a three-dimensional graph, the X axis represents genomic coordinate, the Z dimension represents fragment length, and the Y axis represents number of molecules from each size mapping to the coordinate. Such a three-dimensional graph can be
Petition 870190078052, of 12/08/2019, p. 112/238
108/194 represented as a two-dimensional heat map, in which the X and Z axes are displayed in two dimensions, and the value on the Y axis is represented by, for example, color intensity (for example, darker representing greater values) , or “spicy” color (for example, blue representing lower values and red representing higher values). Such data can be undermined to determine the characteristic of nucleosome position patterns of a state being examined, such as the presence or absence of cancer, type of cancer, degree of metastasis, etc.
[00264] Cohorts of individuals can all have a shared characteristic. This shared characteristic can be selected from the group consisting of: a type of tumor, an inflammatory condition, an apoptotic condition, a necrotic condition, a tumor recurrence, and resistance to treatment. In some instances, a cohort comprises individuals having a specific type of cancer (for example, breast, colorectal, pancreatic, prostate, melanoma, lung or liver). To obtain the cancer nucleosome signature, an individual suffering from cancer provides a blood sample. Free cell DNA is obtained from the blood sample. Free cell DNA is sequenced (either with or without selective enrichment of a set of regions from the genome). Sequence information in the form of sequence readings from the sequencing reactions is mapped to the human reference genome. In some embodiments, molecules are collapsed into single molecule readings or before or after the mapping operation.
[00265] Since the fragments of free cell DNA in a given sample represent a mixture of cells from which free cell DNA arises, the differential nucleosomal occupation of each cell type can result in a contribution towards the representative mathematical model of a given cell DNA sample
Petition 870190078052, of 12/08/2019, p. 113/238
109/194 free. For example, a fragment length distribution may have arisen due to differential nucleosomal protection across different cell types, or through tumor vs. tumor cells. non-tumor cells. This method can be used to develop a set of clinically useful assessments based on uniparametric, multi-parametric, and / or sequence data statistics. [00266] Nucleic acid molecules in a sample can be fractionated based on one or more characteristics. Fractionation can include nucleic acid molecules that clinically divide into subsets or groups based on the presence or absence of a genomic characteristic. Fractionation can include nucleic acid molecules that divide clinically into groups based on the degree to which a genomic characteristic is present. A sample can be fractionated or divided into one or more groups based on a characteristic that is indicative of differential gene expression, or a disease state. A sample can be fractionated based on a characteristic that provides a difference in signal between a normal state and a sick state during nucleic acid analysis, for example, cfDNA, non-cfDNA, tumor DNA, circulating tumor DNA (ctDNA).
[00267] Fragomic data can be used to infer genetic variants. Genetic variants include copy number variation (CNV), insertion and / deletion (indel), single nucleotide variation (SNV), and / or gene fusion. Fragmentomic data can be used to infer epigenetic variants, such as variants indicative of cancer. One or more genetic variants in each fractionated or divided group and / or non-fractionated nucleic acids can be determined. Fractionation or division can be performed based on at least one of several characteristics including, but not limited to, methylation status, size, length, and bonding.
Petition 870190078052, of 12/08/2019, p. 114/238
110/194 transcription of nude acids. Genetic variants determined in the fractionated or divided groups can be compared with each other, and / or with unfractionated nude acids that may or may not have the same characteristics. Fractionated or divided nude acids can be recombined and fragmentomic data can be compared with unfractionated nude acids, and / or nude acids that do not have the same characteristics as fractionated or divided nude acids to determine the presence of genetic variants.
[00268] Models can be used in a panel configuration to selectively enrich regions (for example, regions associated with the fragmentome profile) and ensure a high number of readings covering a particular mutation, important chromatin-centered events similar to the starting points of transcription (TSSs), promoter regions, junction sites, and intronic regions, can also be considered.
[00269] In one example, differences in fragmentome profiles are found at or near the junctions (or limits) of introns and exons. Identification of one or more somatic mutations can be correlated with one or more multi-parametric or uniparametric models to reveal genomic locations where fragments of cfDNA are distributed. This correlation analysis can reveal one or more intron-exon junctions where fragmentome profile breaks are more pronounced.
[00270] As another example, hypermethylation in the sample can be observed in regions more distant from TSS. The enrichment of hypermethylated regions can be observed at a distance between 0 kb and 5 kb, 5 kb and 50 kb, and / or 50 kb and 500 kb from the TSS. The enrichment of hypermethylated regions can be observed between 5 kb and 50 kb from the TSS. The enrichment of hypermethylated regions
Petition 870190078052, of 12/08/2019, p. 115/238
111/194 can be observed less than 5 kb, 10 kb, 15 kb, 20 kb, 25 kb, 30 kb, 35 kb, 40 kb, 50 kb, 100 kb, 200 kb, 300 kb, 400 kb, and / or 500 kb from the TSS. The enrichment of hypermethylated regions can be observed more than 5 kb, 10 kb, 15 kb, 20 kb, 25 kb, 30 kb, 35 kb, 40 kb, 50 kb, 100 kb, 200 kb, 300 kb, 400 kb, and / or 500 kb from the TSS. The position and enrichment of hypermethylation can vary between DNA obtained from a normal or healthy individual (normal DNA) and DNA obtained from a sick individual. For example, DNA from an individual suspected of having or having lung cancer (lung cancer DNA) may show enrichment from the farthest hypermethylated distance from canonical locations in TSS and well-positioned nucleosomes in occupation of the hypermethylated fraction of the neighborhood of the promoter region ( Fig. 17). For example, unfractionated nucleic acids (no MBD) from a lung cancer patient were used for sequencing. Based on the fragmentomic data, such as genomic location, nucleosome dyad centers were determined for the sequence readings. Still based on the fragmentomic data, sequence readings that have coverage less than or equal to 5%, or coverage less than or equal to 95% were additionally analyzed. Gene annotation tools, such as Enrichment of Genomic Annotation Tool Regions (GREAT) were used to assign functionality to a set of genomic regions based on the closest genes. The distance between sequence readings and their putatively regulated genes was determined (Fig. 17). The distances were divided into four separate deposits: one from 0 to 5 kb, another from 5 kb to 50 kb, a third from 50 kb to 500 kb, and a final deposit from all associations above 500 kb. For accuracy, the deposits are [0, 5 kb], [5 kb, 50 kb], [50 kb, 500 kb], [500 kb, Infinity], In the graph, all associations precisely at 0 (that is, in TSS) were evenly divided
Petition 870190078052, of 12/08/2019, p. 116/238
112/194 between the [--5 kb, 0] and [0.5 kb] deposits. Using this method, hypermethylation in the sample was observed in regions more distant from TSS in both previous genomic regions (for example, all nucleosomes ) and foreground genomic regions (for example, methylated nucleosomes). For example, enrichment of hypermethylated regions was observed between deposits [5 kb, 50 kb], [00271] The fragmentome signature can assist in determining nucleosome occupation, nucleosome positioning, RNA Polymerase II pause, DNase-specific hypersensitivity of cell death, and chromatin condensation during cell death. Such a signature can also provide insight into the release and traffic of cell fragments. For example, the release of cell fragments may involve DNA fragmentation effected by caspase-activated DNase (CAD) in cells that die from apoptosis, but it can also be effected by lysosomal DNase II after dead cells are phagocytosed, resulting in maps of different divage.
[00272] Genome division maps can be constructed by broad genome identification of differential chromatin states in malignant vs non-malignant conditions associated with aforementioned chromatin properties via aggregation of significant windows in regions of interest. Such regions of interest are generally referred to as genome division maps.
[00273] Methylation-based fractionation [00274] The nucleic acid molecules in a sample can be fractionated based on the 5-methylcytosine characteristic. DNA can be methylated into cytosines such as GpG dinucleotide regions. DNA methylation together with histone complexes can influence the packing of DNA into chromatin as well as epigenetic regulation of gene expression. Epigenetic changes po
Petition 870190078052, of 12/08/2019, p. 117/238
113/194 may play a crucial role in various diseases, such as in all stages of cancer progression, initiation of primary or previous stage cancer, elapsed or metastatic cancer. For example, hypermethylation of a normally hypomethylated region, such as the transcription start site (TSS) of genes involved in normal growth, DNA repair, cell cycle regulation, and cell differentiation, may be indicative of cancer. Hypermethylation can alter gene expression by transcriptional repression. In some cases, hypermethylation can reduce and / or suppress gene expression. For example, hypermethylation can reduce and / or suppress expression of an oncogene repressor. In some cases, hypermethylation can increase and / or promote gene expression. For example, hypermethylation of a suppressor can result in increased and / or promoted gene expression of a downstream responder, for example, an oncogene that is normally suppressed by the suppressor.
[00275] Based on the DNA methylation status, the nucleic acid molecules in a sample can be fractionated into different groups that can enrich nucleic acid molecules with similar methylation status using experimental procedures. For example, a methyl binding domain protein (MBD) can be used to purify affinity of nucleic acid molecules with similar methylation status, such as hypermethylation, hypomethylation and residual methylation. In another example, an antibody specific for 5 methyl cytosine can be used to immunoprecipitate nucleic acid molecules with similar levels of methylation. In another example, bisulfite-based methods can be employed to selectively enrich highly methylated nucleic acid molecules. In yet another example, a methylation-sensitive restriction enzyme can be used to selectively enrich highly methylated nucleic acid molecules.
Petition 870190078052, of 12/08/2019, p. 118/238
114/194 [00276] After fractionation using one of the characteristics, the nucleic acid molecules in each group can be sequenced to generate sequence readings. Sequence readings can be mapped to a reference genome. The mapping can generate sequence information. Sequence information can be analyzed to determine genetic variations, including, for example, single nucleotide variants, variation in copy number, indels, or fusions. In examples where free cell DNA is assayed using the methods disclosed herein it can generate fragmentomic data, which can vary between groups of fractured nucleic acid molecules. Fragmentomic data can include genomic coordinates, size, coverage or sequence information. The revelation provides methods for integrating the fragmentomic data with sequence readings for each of the divisions. Such integration can be useful in the accurate and rapid detection of biomarkers indicative of a disease state.
[00277] The methods described here can be used to enrich nucleic acid molecules in silico based on fragmentomic data. For example, unfractionated nucleic acid molecules (no MBD) from a lung cancer patient can be used for sequencing. In another example, fractionation can be achieved based on a difference in a mono-nucleosomal profile or a dinucleosomal profile alone or in combination with other characteristics such as size and / or methylation status. The mono-nucleosomal profile can refer to the coverage or counts of fragments that are approximately the length required to wrap around a single nucleosome (for example, about 146 bp). The dinucleosomal profile can refer to the coverage or counts of fragments that are approximately the length required to wrap around a single nucleosome twice (for example, about 292 bp).
Petition 870190078052, of 12/08/2019, p. 119/238
115/194 [00278] Data Analysis [00279] In certain embodiments, data from different classes of individuals, for example, cancer / cancer free, cancer type 1 / cancer type 2, can be used to train an algorithm for machine learning to classify a sample as belonging to one of the classes. The term “machine learning algorithm, as used here, refers to an algorithm, executed by computer, that automates the construction of an analytical model, for example, for grouping, classification or standard recognition. Machine learning algorithm can be supervised or not supervised. Learning algorithms include, for example, artificial neural networks (for example, posterior propagation networks), discriminant analysis (for example, Bayesian classifier or Fischer analysis), support vector machines, decision trees (for example, processes recursive dividing lines such as CART - classification and regression trees), random forests), linear classifiers (for example, multiple linear regression (MLR), partial least squares regression (PLS) and main component regression (PCR)), hierarchical grouping and cluster analysis. A set of data from which a machine learning algorithm learns can be referred to as “training data”.
[00280] The term "classifier", as used herein, refers to computer code of algorithm which, receives, as input, test data and produces, as output, a classification of the input data as belonging to one or another class .
[00281] The term “data set”, as used here, refers to a collection of values that characterize elements of a system. A system can be, for example, cfDNA from a biological sample. Elements of such a system can be genetic loci. Examples of a dataset (or “dataset”) include indiPetition values 870190078052, of 8/12/2019, p. 120/238
116/194 citing a quantitative measure of a selected characteristic of:
(i) DNA sequence mapping to a genetic site, (ii) DNA sequence starting at a genetic site, (iii) DNA sequence ending at a genetic site; (iv) a dinucleosome protection! or mononucleosomal protection of a DNA sequence; (v) DNA sequence located in an intron or exon of a reference genome; (vi) a size distribution of DNA sequences having one or more characteristics; (vii) a length distribution of DNA sequences having one or more characteristics, etc. [00282] The term “value,” as used here, refers to an entry in a data set may be nothing that characterizes the characteristic to which the value refers. This includes, without limitation, numbers, words or phrases, symbols (for example, + or -), or degrees.
[00283] Digital processing device [00284] In some embodiments, the methods described here use a digital processing device. In additional embodiments, the digital processing device includes one or more central hardware processing units (CPUs), or general purpose graphics processing units (GPGPUs) that perform the functions of the device. In still further embodiments, the digital processing device additionally comprises an operating system configured to carry out executable instructions. In some embodiments, the digital processing device is optionally connected to a computer network. In additional embodiments, the digital processing device is optionally connected to the Internet such that it accesses the World Wide Web. In still other embodiments, the digital processing device is optionally connected to a cloud computing infrastructure. In other embodiments, the digital processing device is optionally connected to an intranet. In other embodiments, the
Petition 870190078052, of 12/08/2019, p. 121/238
117/194 digital processing device is optionally connected to a data storage device.
[00285] According to the description here, suitable digital processing devices include, by way of non-limiting examples, server computers, desktop computers, laptop computers, notebook computers, portable computers, Internet devices, mobile smartphones, and tablet computers.
[00286] In some embodiments, the digital processing device includes an operating system configured to carry out executable instructions. The operating system is, for example, software, including programs and data, that control the device's hardware, and provides services for running applications. Those skilled in the art will recognize that suitable server operating systems include, by way of non-limiting examples, FreeBSD, OpenBSD, NetBSD®, Linux, Apple® Mac OS X Server®, Oracle® Solaris®, Windows Server®, and Novell ® NetWare®. Those skilled in the art will recognize that suitable personal computer operating systems include, by way of non-limiting examples, operating systems similar to Microsoft® Windows®, Apple® Mac OS X®, UNIX®, and UNIX, such as GNU / Linux®. In some embodiments, the operating system is provided by cloud computing. Those skilled in the art will also recognize that a suitable mobile smart phone operating system includes, by way of non-limiting examples, Nokia® Symbian® OS, Apple® iOS®, Research In Motion® BlackBerry OS®, Google® Android®, Microsoft ® Windows Phone® OS, Microsoft® Windows Mobile® OS, Linux®, and Palm® WebOS®.
[00287] In some embodiments, the device includes a storage and / or memory device. The storage and / or memory device is one or more physical devices used to store as
Petition 870190078052, of 12/08/2019, p. 122/238
118/194 dos or program on a temporary or permanent basis. In some embodiments, the device has volatile memory and requires energy to maintain stored information. In some embodiments, the device is non-volatile memory, and retains stored information when the digital processing device is not powered. In additional embodiments, the non-volatile memory comprises instant memory. In some embodiments, the nonvolatile memory comprises dynamic random access memory (DRAM). In some embodiments, the non-volatile memory comprises ferroelectric random access memory (FRAM). In some embodiments, the non-volatile memory comprises phase change random access memory (PRAM). In other embodiments, the device is a storage device including, by way of non-limiting examples, CD-ROMs, DVDs, instant memory devices, magnetic disk drives, magnetic tape drives, optical disk drives, and computer computing. snow to the storage base. In additional embodiments, the storage and / or memory device is a combination of devices as disclosed herein.
[00288] In some embodiments, the digital processing device includes a display for sending visual information to a user. In some embodiments, the display is a liquid crystal display (LCD). In additional embodiments, the display is a thin film transistor liquid crystal display (TFTLCD). In some embodiments, the display is an organic light emitting diode (OLED) display. In several additional embodiments, an OLED display is a passive matrix OLED (PMOLED) or active matrix OLED (AMOLED) display. In some embodiments, the display is a plasma display. In other embodiments, the display is a video projector. In still others
Petition 870190078052, of 12/08/2019, p. 123/238
119/194 embodiments, the display is an upper mounted display in communication with the digital processing device, such as a VR headset. In additional embodiments, suitable VR headsets include, by way of non-limiting examples, HTC Vive, Oculus Rift, Samsung Gear VR, Microsoft HoloLens, Razer OSVR, FOVE VR, Zeiss VR One, Avegant Glyph, Freefly VR headset, and the like . In still further embodiments, the display is a combination of devices such as those disclosed herein.
[00289] In some embodiments, the digital processing device includes an input device for receiving information from a user. In some embodiments, the input device is a keyboard. In some embodiments, the input device is a pointing device including, by means of non-limiting examples, a mouse, trackball, track pad, joystick, game controller, or stylus. In some embodiments, the input device is either a touch screen or a multi-touch screen. In other embodiments, the input device is a microphone for capturing voice or other sound input. In other embodiments, the input device is a video camera or other sensor for capturing motion input or visual input. In additional embodiments, the input device is a Kinect, Leap Motion, or the like. In still other embodiments, the input device is a combination of devices such as those disclosed herein.
[00290] Referring to Fig. 32, in a particular embodiment, an exemplary digital processing device 101 is programmed or otherwise configured to analyze, test, decode and / or decode sequence and / or tag data. In the embodiment, the digital processing device 101 includes a central processing unit (CPU, also "processor" and "computer processor" here) 105, which can be a core processor
Petition 870190078052, of 12/08/2019, p. 124/238
120/194 single or multi-core, or a plurality of processors for parallel processing. Digital processing device 101 also includes memory or memory location 110 (for example, random access memory, read-only memory, instant memory), electronic storage unit 115 (for example, hard disk), communication interface 120 ( for example, network adapter) for communication with one or more other systems, and peripheral devices 125, such as cache, other memory, data storage display adapters and / or electronic display adapters. Memory 110, storage unit 115, interface 120 and peripheral devices 125 are in communication with CPU 105 via a communication bar (solid lines), such as a motherboard. The storage unit 115 can be a data storage unit (or data repository) for data storage. The digital processing device 101 can be operably coupled to a computer network ("network") 130 with the aid of the communication interface 120. The network 130 can be the Internet, an internet and / or extranet, or an intranet and / or extranet that is communicating with the Internet. Network 130 in some cases is a telecommunication network and / or data network. Network 130 may include one or more computer servers, which can enable distributed computing, such as cloud computing. Network 130, in some cases, with the aid of device 101, can implement point-to-point, which can enable devices to couple with device 101 to behave like a client or a server.
[00291] Continuing to refer to Fig. 32, CPU 105 can execute a sequence of machine-readable instructions, which can be implemented in a program or software. Instructions can be stored in a memory location, such as memory
110. Instructions can be directed to CPU 105, which can sub
Petition 870190078052, of 12/08/2019, p. 125/238
121/194 sequentially programming or otherwise configuring CPU 105 to implement the methods of the present disclosure. Examples of operations performed by CPU 105 may include fetching, decoding, executing, and responding. CPU 105 may be part of a circuit, such as an integrated circuit. One or more other components of device 101 can be included in the circuit. In some cases, the circuit is an application-specific integrated circuit (ASIC), or a series of programmable field gate (FPGA).
[00292] Continuing to refer to Fig. 32, the storage unit 115 can store files, such as drivers, libraries and saved programs. The storage unit 115 can store user data, for example, user preferences and user programs. The digital processing device 101, in some cases, may include one or more additional data storage units that are external, such as located on a remote server that is communicating over an intranet or the Internet.
[00293] Continuing to refer to Fig. 32, digital processing device 101 can communicate with one or more remote computer systems over network 130. For example, device 101 can communicate with a remote computer system from a user. Examples of remote computer systems include personal computers (for example, portable PC), slate or tablet PCs (for example, Apple® iPad, Samsung® Galaxy Tab, and Microsoft® Surface®), and smartphones (for example, Apple® iPhone or Androidenabled device).
[00294] Methods as described herein can be at least partially implemented by machine executable code (eg computer processor) stored in an electronic storage location of the digital processing device 101, such as, for example, in memory 110, or uni
Petition 870190078052, of 12/08/2019, p. 126/238
122/194 electronic storage facility 115. Machine-executable code, or machine-readable code, can be provided in the form of software. During use, the code can be executed by processor 105. In some cases, the code can be retrieved from storage unit 115, and stored in memory 110 for ready access by processor 105. In some situations, electronic storage unit 115 can deleted, and machine executable instructions are stored in memory 110.
[00295] Non-transient computer-readable storage medium [00296] In some embodiments, the methods disclosed herein use one or more non-transient computer-readable storage media encoded with a program including instructions executable by a one-way operation system. digital processing device optionally networked. In additional embodiments, a computer-readable storage medium is a tangible component of a digital processing device. In still other embodiments, a computer-readable storage medium is optionally removable from a digital processing device. In some embodiments, a computer-readable storage medium includes, by way of non-limiting examples, CD-ROMs, DVDs, instant memory devices, solid state memory, magnetic disk drives, magnetic tape drives, disk drives optical, cloud computing systems and services, and the like. In some cases, the program and instructions are permanently, substantially permanently, semi-permanently, or not transiently encoded in between.
[00297] Executable instructions [00298] In some embodiments, the methods disclosed here use instructions that are executable by a process device
Petition 870190078052, of 12/08/2019, p. 127/238
123/194 digital itchy, in the form of at least one computer program. For example, a computer program includes a sequence of instructions, executable on the CPU of the digital processing device, written to perform a specified task. Computer-readable instructions can be implemented as program modules, such as functions, objectives, Application Programming Interfaces (APIs), data structures, and the like, that perform particular tasks or implement particular abstract data types. In the light of the disclosure provided here, those skilled in the art will recognize that a computer program can be written in several versions of various languages.
[00299] The functionality of the computer-readable instructions can be combined or distributed as desired in various environments. In some embodiments, a computer program comprises a sequence of instructions. In some embodiments, a computer program comprises a plurality of instruction sequences. In some embodiments, a computer program is provided with a location. In other embodiments, a computer program is provided with a plurality of locations. In various embodiments, a computer program includes one or more software modules. In various embodiments, a computer program includes, in part or in whole, one or more web applications, one or more mobile applications, one or more independent applications, one or more web browser connectors, extensions, add-ins, or add-ons, or combinations of these.
[00300] Web application [00301] In some embodiments, a computer program comprises a web application. In light of the disclosure provided here, those skilled in the art will recognize that a web application, in various embodiments, uses one or more softwa structures
Petition 870190078052, of 12/08/2019, p. 128/238
124/194 re, and one or more database systems. In some embodiments, a web application is created after a software framework, such as Microsoft® .NET or Ruby on Rails (RoR). In some embodiments, a web application uses one or more database systems including, by means of non-limiting examples, relational, non-relational, oriented, associative, and XML database systems. In additional embodiments, systems Suitable relational databases include, by way of non-limiting examples, Microsoft® SQL Server, mySQL ™, and Oracle®. Those skilled in the art will also recognize that a web application, in several embodiments, is written in one or more versions of one or more languages. The web application can be written in one or more marked languages, presentation definition languages, client-side scripting languages, server-side coding languages, database query languages, or combinations thereof. In some embodiments, a web application is written to some extent in a marked language such as Hypertext Markup Language (HTML), Extensible Hypertext Markup Language (XHTML), or extensible Markup Language (XML). In some embodiments, a web application is written to some extent in a presentation definition language, such as Cascading Style Sheets (CSS). In some embodiments, a web application is written to some extent in client-side scripting, such as Asynchronous Javascript and XML (AJAX), Flash® Actionscript, Javascript, or Silverlight®. In some embodiments, a web application is written to some extent in a server-side coding language such as Active Server Pages (ASP), ColdFusion®, Perl, Java ™, JavaServer Pages (JSP), Hypertext Preprocessor (PHP) , Python ™, Ruby, Tel, Smalltalk, WebDNA®, or Groovy. In some embodiments, a web application
Petition 870190078052, of 12/08/2019, p. 129/238
125/194 is written to some extent in a database query language such as Structured Query Language (SQL). In some embodiments, a web application integrates enterprise server products such as IBM® Lotus Domino®. In some embodiments, a web application includes an element of media playback. In several other embodiments, a media player utilizes one or more of many suitable multimedia technologies including, by way of non-limiting examples, Adobe® Flash®, HTML 5, Apple® QuickTime®, Microsoft® Silverlight®, Java ™, and Unity®.
[00302] Referring to Fig. 33, in a particular embodiment, an application provision system comprises one or more databases 200 accessed by a relational database control system (RDBMS) 210. Suitable RDBMSs include Firebird , MySQL, PostgreSQL, SQLite, Oracle Database, Microsoft SQL Server, IBM DB2, IBM Informix, SAP Sybase, Teradata, and the like. In this embodiment, the application provisioning system additionally comprises one or more application servers 220 (such as Java servers, .NET servers, PHP servers, and the like), and one or more web servers 230 (such as Apache, IIS, GWS and the like). The web server (s) optionally exposes one or more web services, via app application programming interfaces (APIs) 240, via a network, such as the Internet, the system provides user interfaces browser-based and / or mobile native.
[00303] Referring to Fig. 34, in a particular embodiment, an application provisioning system alternatively has a distributed cloud-based architecture 300, and comprises elastically loaded auto-scale web server resources 310 and server resources application 320 also synchronously replicated databases 330.
Petition 870190078052, of 12/08/2019, p. 130/238
126/194 [00304] Mobile application [00305] In some embodiments, a computer program comprises a mobile application provided with a mobile digital processing device. In some embodiments, the mobile application is provided on a mobile digital processing device at the time it is manufactured. In other embodiments, the mobile application is provided on a mobile digital processing device, via the computer network described here.
[00306] In view of the disclosure provided here, a mobile application is created by techniques known to those skilled in the art using hardware, languages, and development environments known in the art. Those skilled in the art will recognize that mobile applications are written in several languages. Suitable programming languages include, using non-limiting examples, C, C ++, C #, Objective-C, Java ™, Javascript, Pascal, Object Pascal, Python ™, Ruby, VB.NET, WML, and XHTML / HTML with or without CSS, or combinations of these.
[00307] Suitable mobile application development environments are available from several sources. Commercially available development environments include, by way of non-limiting examples, AirplaySDK, alcheMo, Appcelerator®, Celsius, Bedrock, Flash Lite, .NET Compact Framework, Rhomobile, and WorkLight Mobile Platform. Other development environments are available at no cost including, by way of non-limiting examples, Lazarus, MobiFlex, MoSync, and PhoneGap. Also, mobile device producers distribute software developer kits including, by way of non-limiting examples, iPhone and iPad (iOS) SDK, Android ™ SDK, BlackBerry® SDK, BREW SDK, Palm® OS SDK, Symbian SDK, webOS SDK , and Windows® Mobile SDK.
[00308] Those technicians on the subject will recognize that several p
Petition 870190078052, of 12/08/2019, p. 131/238
127/194 commercial runs are available for mobile application distribution including, through non-Hmitante examples, Apple® App Store, Google® Play, Chrome WebStore, BlackBerry® App World, App Store for Palm devices, App Catalog for webOS, Windows® Marketplace for Mobile, Ovi Store for Nokia® devices, Samsung® Apps, and Nintendo® DSi Shop.
[00309] Independent extension [00310] In some embodiments, a computer program includes an independent application, which is a program that is operated as an independent computer process, not an add-on to an existing process, for example, not an plug-in. Those skilled in the art will recognize that independent applications are often compiled. A compiler is a computer program (s) that turns source code written in a programming language into binary object code, such as assembly language or machine code. Suitable compiled programming languages include, by way of non-limiting examples, C, C ++, Objective-C, COBOL, Delphi, Eiffel, Java ™, Lisp, Python ™, Visual Basic, and VB .NET, or combinations thereof. Compilation is often done, at least in part, to create an executable program. In some embodiments, a computer program includes one or more compiled executable applications.
[00311] Software modules [00312] In some embodiments, the methods disclosed here use software, server, and / or database modules. In view of the disclosure provided herein, software modules are created by techniques known to those skilled in the art using machines, software, and languages known in the art. The software modules disclosed here are implemented in a multitude of ways. In several embodiments, a software module comprises a
Petition 870190078052, of 12/08/2019, p. 132/238
128/194 file, a code section, a programming object, a programming structure, or combinations of these. In several additional embodiments, a software module comprises a plurality of files, a plurality of sections of code, a plurality of programming objects, a plurality of programming structures, or combinations thereof. In various embodiments, the one or more software modules comprise, by means of non-limiting examples, a web application, a mobile application, and an independent application. In some embodiments, the software modules are in a computer program or application. In other embodiments, the software modules are in more than one computer program or application. In some embodiments, the software modules are hosted on a machine. In other embodiments, the software modules are hosted on more than one machine. In additional embodiments, the software modules are hosted on cloud computing platforms. In some embodiments, the software modules are hosted on one or more machines in one location. In other embodiments, the software modules are hosted on one or more machines in more than one location.
[00313] Databases [00314] In some embodiments, the methods disclosed here use one or more databases. In view of the disclosure provided herein, those skilled in the art will recognize that many databases are suitable for storing and retrieving the patient, sequence, tag, encode / decode, genetic variant, and disease information. In various embodiments, suitable databases include, by way of non-limiting examples, relational databases, non-relational databases, object-oriented databases, object databases, relationship model databases
Petition 870190078052, of 12/08/2019, p. 133/238
129/194 entity entity, associative databases, and XML databases. Additional non-limiting examples include SQL, PostgreSQL, MySQL, Oracle, DB2, and Sybase. In some embodiments, the database is internet-based. In additional embodiments, a database is web-based. In still further embodiments, a database is based on cloud computing. In other embodiments, a database is based on one or more local computer storage devices.
[00315] In one aspect, here is provided a system comprising a computer comprising a processor and computer memory, in which the computer is in communication with a communications network, and in which the computer's memory comprises code which, when executed by the processor, (1) receives sequence data in computer memory from the communications network: (2) determines whether a genetic variant in the sequence data represents a germline mutant or a somatic cell mutant, using the methods described here ; and (3) reports, on the communications network, the determination.
[00316] The communications network can be any available network that connects to the internet. The communications network can use, for example, a high speed transmission network including, without limitation, Broadband over Powerlines (BPL), Cable Modem, Digital Subscriber Line (DSL), Fiber, Satellite, and Wireless.
[00317] In one aspect, a system is provided here comprising: a local area network; one or more DNA sequencers comprising computer memory configured to store DNA sequence data that are connected to the local area network; a bioinformatics computer comprising a computer memory and a processor, the computer of which is connected to the local area network; in which the computer additionally comprises code
Petition 870190078052, of 12/08/2019, p. 134/238
130/194 go which, when executed, copies DNA sequence data stored in a DNA sequencer, writes the copied data to memory on the bioinformatics computer, and performs steps as described here.
[00318] Also provided here are numerous systems for implementing the described methods. In some embodiments, the systems comprise a nucleic acid sequencer, including next generation DNA sequencers, the sequencer is in data communication with a digital processing device, in which the data received by a software module or modules in the device Digital processing is generated by the sequencer when the sequencer obtains DNA sequence information from the divided and tagged DNA sequence that has been divided and tagged by the individual methods. The sequencer and the digital processing device do not need to be located close together, and in some embodiments, they can be separated by large physical distances, provided that adequate data communication exists between the system components. The specific system embodiments described below are exemplary of the greatest variety of systems provided by the invention. It will be understood by those skilled in the art that the method described here which comprises a step of data analysis can be readily implemented through the systems disclosed here, in which a software module or modules in a digital processing device is used to analyze sequence data obtained by sequencing populations of labeled nucleic acids produced by individual methods.
[00319] An embodiment is a system comprising:
[00320] a nucleic acid sequencer: a digital processing device comprising at least one processor, an operating system configured to carry out executable instructions,
Petition 870190078052, of 12/08/2019, p. 135/238
131/194 and a memory; and a data link communicatively connecting the nucleic acid sequencer and the digital processing device; in which the digital processing device additionally comprises executable instructions for creating an application for analysis of a nucleic acid population comprising at least two forms of nucleic acid selected from: double-stranded DNA, single-stranded DNA, and single-stranded RNA, each of the at least two forms comprising a plurality of molecules, the application comprising: (i) a software module that receives sequence data from the nucleic acid sequencer, via the data link, the amplified nucleic acid sequence data at least some of which are labeled, the sequence data generated by linking at least one of the nucleic acid forms with at least one nucleic acid labeled to distinguish the forms from each other, amplify the forms of nucleic acid at least one of which is attached to at least one nucleic acid tag, in which the nucleic acids and nucleic acid tag ligated s are amplified to produce amplified nucleic acids from which those amplified in at least one way are labeled; and (li) a software module that tests the amplified nucleic acid sequence data by obtaining sufficient sequence information to decode the labeled nucleic acid molecules from the amplified nucleic acids to reveal the nucleic acid forms in the population that provides a model original for the amplified nucleic acids attached to the label nucleic acid molecules for which the sequence data was assayed. In another embodiment, the system additionally comprises a software module that decodes the labeled nucleic acid molecules from the amplified nucleic acids to reveal the forms of nucleic acids in the population that provides an original model for the amplified nucleic acids
Petition 870190078052, of 12/08/2019, p. 136/238
132/194 data linked to the label nucleic acid molecules for which the sequence data was tested. In another embodiment of a system, the application additionally comprises a software module that transmits a test result, via a communications network. [00321] Another embodiment is a system comprising: a next generation sequencing instrument (NGS); a digital processing device comprising at least one processor, an operating system configured to carry out executable instructions, and a memory: and a data link communicatively connecting the NGS Instrument and the digital processing device; in which the digital processing device additionally comprises executable instructions for creating an application comprising: (i) a software module for receiving sequence data from the NGS Instrument, via the data link, the sequence data generated by physically breaking up the DNA molecules of a human sample to generate two or more divisions, apply differential molecular tags and NSG capability adapters to each of the two or more divisions to generate molecular labeled divisions, and test the molecular labeled divisions with the NGS instrument; (ii) a software module to generate sequence data for sample devolution in molecules that were differentially divided; and (iii) a software module to analyze the sequence data by deconvolution of the sample into molecules that have been differentially divided. In another embodiment of a system, the system additionally comprises a software module that transmits a test result, via a communications network.
[00322] Another embodiment is a system comprising: a next generation sequencing instrument (NGS); a digital processing device comprising at least one process
Petition 870190078052, of 12/08/2019, p. 137/238
133/194 sador, an operating system configured to carry out executable instructions, and a memory; and a data link communicatively connecting the NGS instrument and the digital processing device; in which the digital processing device additionally comprises instructions executable by at least one processor to create an application for molecular tag identification of MBD-fractional sphere libraries comprising: a software module configured to receive sequence data from the instrument of NGS, via the data link, the sequence data generated by physically fractioning a DNA sample extracted using a methyl binding domain sphere-protein purification kit, saving all elutions for downstream processing; conduct parallel application of differential molecular tags and NSG enabling adapter sequences for each fraction or group; re-combining all labeled molecular fractions or groups, and subsequent amplification using adapter-specific DNA primer sequences; conducting enrichment / hybridization of recombinant and amplified total library for labeling genomic regions of interest; re-amplification of the enriched total DNA library by attaching a sample tag; gathering different samples; and testing them in multiplex on the NGS instrument; in which NGS sequence data produced by the instrument provides sequence of the molecular tags being used to identify unique molecules, and sequence data for sample devolution in molecules that were differentially MBD-divided: and (ii) a software module configured to perform analysis of sequence data using molecular tags to identify single molecules and deconvolution of the sample into molecules that were differentially MBD-divided. Another embodiment is a system in which the application additionally
Petition 870190078052, of 12/08/2019, p. 138/238
134/194 comprises a software module configured to transmit an analysis result, via a communications network.
[00323] Another embodiment is a system comprising: (a) a next generation sequencing instrument (NGS), (b) a digital processing device comprising at least one processor, an operating system configured to carry out executable instructions, and a memory; and (c) a data link communicatively connecting the NGS instrument and the digital processing device; in which the digital processing device additionally comprises executable instructions for creating an application comprising: I) a software module for receiving sequence data from the NGS instrument, via the data link, the generated sequence data loaded with nucleic acids labeled prepared by contact of the nucleic acid population with an agent that preferably binds to the nucleic acids that support the modification, separation of a first nucleic acid pool linked to the agent from a second nucleic acid pool unrelated to the agent, in which the first nucleic acid pool is overrepresented for the modification, and the nucleic acids in the second pool are overrepresented for the modification; linking the nucleic acids at the first meeting and / or the second meeting to one or more nucleic acid tags that distinguish the nucleic acids at the first meeting and the second meeting to produce a population of labeled nucleic acids; amplifying the labeled nucleic acids, in which the nucleic acids and the attached tags, are amplified; and test the molecular labeled divisions with the NGS instrument; ii) a software module for generating sequence data for decoding the tag; and iii) a software module for analyzing the sequence data to decode the tags to reveal whether the nucleic acids for which sequence data was
Petition 870190078052, of 12/08/2019, p. 139/238
135/194 tested were amplified from models at the first or second meeting. Another embodiment is a system additionally comprising a software module that transmits a test result, via a network of combinations.
[00324] Examples:
[00325] Example 1: Experimental procedure for fractionation based on the methyl binding domain (MBD) [00326] Sample collection [00327] Samples, such as blood, serum or plasma, from individuals with lung cancer (for example, NSCLC) were selected from the Guardant Health repository that showed high circulating tumor DNA (ctDNA) content as determined by the GUARDANT360 ™ assay. Free cell DNA (cfDNA) from healthy normal donors was extracted from isolated blood plasma, as previously described (Lanman et al., Analytical and clinical validation of a digital sequencing panel for highly accurate, quantitative assessment of circulating tumor DNA free cell, PLoS ONE 10 (10): e0140712 (2015)).
[00328] Extraction of cfDNA [00329] The sample was subjected to digestion of proteinase K. The DNA was precipitated with isopropanol. The DNA was captured in a DNA purification column (for example, a QIAamp DNA Blood Mini Kit) and eluted in 100 μΙ of solution. DNAs below 500 bp were selected with Ampure SPRI magnetic sphere capture (PEG / salt). The resulting production was suspended at 30 μ! of H2O. The size distribution was verified (major peak-166 nucleotides; minor peak -330 nucleotides), and quantified. In general, 5 ng of extracted DNA contains approximately 1700 haploid genome equivalents (“HGE”). The general correlation between the amount of DNA and HGE was listed as follows: 3 pg of DNA-1 HGE; 3 ng of DNA = 1K HGE; 3 ng of
Petition 870190078052, of 12/08/2019, p. 140/238
136/194
DNA-1M HGE; 10 pg of DNA = 3 HE; 10 ng of DNA-3K HGE; 10 ng of DNA-3M HGE.
[00330] DNA fractionation [00331] DNA was fractionated into multiple fractions (or divisions). cfDNA (10 ~ 150ng) was fractionated into hypermethylated, methylated and hypomethylated fractions using the MethylMiner ™ affinity enrichment protocol (Thermo Fisher Scientific, Cat # ME10025), except that reaction conditions were modified using 300mM NaCI incubation and wash buffer, and protocol for a microgram DNA entry was scaled for sub-microgram DNA entries.
[00332] Sphere preparation [00333] Streptavidin Dynabeads® M-280 wash: Streptavidin Dynabeads® M-280 was washed using a wash buffer containing 300 mlVI of NaCI prior to coupling with MBD-Biotin Protein. The stock of Streptavidin Dynabeads® M-280 was resuspended to obtain a homogeneous suppression. For each microgram of incoming DNA, 10 μΙ of beads were added to a 1.7 ml DNase-free microcentrifuge tube. The sphere volume was brought to 100 μΙ with 1X Bind / Wash Buffer. The tube was placed on a magnetic support for 1 minute to concentrate all of the spheres on the inner wall of the tube before the liquid was removed and discarded. The tube was removed from the magnetic support and an equal volume (for example, about 100-250 μΙ) of IXBind / Wash Buffer was added to resuspend the spheres. The resuspended spheres were concentrated and washed once more before the MBD-Biotin Protein coupling procedure to the spheres.
[00334] Dynabeads® M-280 Streptavidin Coupling with MBD-Biotin Protein: For each microgram of incoming DNA, 7 μΙ (3.5 pig) MBD-Biotin Protein were added to a
Petition 870190078052, of 12/08/2019, p. 141/238
137/194 DNase-free microcentrifuge of 1.7 ml. The ball volume was brought to 100 pl with IXBind / Wash Buffer containing 300 mM NaCI. The MBD-Biotin Protein was diluted and transferred to the resuspended ball tube from the initial ball wash. The sphere-protein mixture was mixed in a rotary mixer at room temperature for 1 hour, before washing the MBD beads. [00335] Washing of the MBD spheres: The MBD spheres in the tube were concentrated by placing the tube in a magnetic support for 1 minute. The liquid was removed and discarded. The spheres were resuspended with 100-250 µl IXBind / Wash Buffer containing 300 mM NaCI and mixed in a rotary mixer at room temperature for 5 minutes. The spheres were concentrated, washed, and resuspended, as described above two more times. The tube was then placed in the magnetic holder for 1 minute, and the liquid was carefully removed and discarded. The spheres were resuspended with 100-250 µl IXBind / Wash Buffer containing 300 mM NaCI before capturing methylation DNA.
[00336] Capture of fragmented methylated DNA in the MBDespheres and incubation of the MBD-spheres with fragmented DNA: In general, the incoming DNA can vary from 5 ng-1 pg. The control reaction typically uses 1 pg of K-562 DNA. To a clean 1.7 ml DNase-free micro centrifuge tube, 20 pl of 5X Wash / Bind Buffer containing 300 mM NaCI were added. A fragmented sample DNA, for example, 5 ng-1 pg, was added to the tube and the final volume was brought to 100 pl with DNase free water. The DNA / Buffer mixture was transferred to the tube containing the MBD-spheres and mixed in a rotary mixer for 1 hour at room temperature. Alternatively, the mixture can be mixed overnight at 4 ° C.
[00337] Collection of non-captured DNA from the solution of es
Petition 870190078052, of 12/08/2019, p. 142/238
138/194 beast: Uncatched / unmethylated DNA was collected from the DNA and mixture of MBD-spheres. The tube containing a mixture of DNA and MBD-beads was placed on the magnetic support for 1 minute to concentrate the beads, and the supernatant liquid was removed and saved in a clean DNase-free micro centrifuge tube. This saved supernatant liquid is the un-captured DNA supernatant, and can be stored on ice. The spheres were washed with 200 μΙ of IxBind / Wash Buffer containing 300 mM NaCI in a rotary mixer for 3 minutes. The spheres were concentrated as described above, and the supernatant liquid containing uncaptured / non-methylated / hypomethylated DNA was removed, saved and stored on ice, as described above. The spheres were washed, mixed, concentrated with the supernatant removed and saved one more time to collect two wash fractions. Each wash fraction was stored on ice. The washing fractions can be combined together and labeled accordingly.
[00338] Elution of captured DNÃ: The captured DNA was eluted using an elution buffer containing 2000 mM NaCI. The spheres were resuspended in 200 μΙ of elution buffer (2000 mM NaCI). The spheres were incubated in a rotary mixer for 3 minutes, and placed on the magnetic support for 1 minute to concentrate all of the spheres, and the liquid containing captured / hypermethylated DNA was removed and saved in a clean DNase-free micro centrifuge tube. The first saved fraction of captured DNA / methylated DNA was stored on ice. The spheres were resuspended and incubated once more, and the liquid containing captured DNA / methylated DNA was removed and saved in a second clean tube. The first and second collection of captured DNA / methylated DNA were collected and stored on ice.
[00339] Preparation of methylated fractionated DNA for analysis ·
Petition 870190078052, of 12/08/2019, p. 143/238
139/194 if: split cfDNA, hyper methylated, intermediate methylated and non-methylated DNA was purified, for example, by SPRI sphere cleaning (Ampure XP, Beckman Coulter), subsequently prepared for ligation (using NEBNext® Ultra ™ End Repair / dA-Tailing Module), then linked with modified Y-shaped dsDNA adapters containing non-random molecular bar codes as described in Lanman et ah, 2015. The divisions of hypermethylated, intermediate methylated and hypomethylated cfDNA were linked with 11 , 12, and 12 distinct nonrandom molecular bar code adapters, respectively. Split cfDNA molecules bound to each sample were again purified with SPRI beads (Ampure XP) then re-combined in a PCR reaction with universal oligos for all adapter-bound molecules (NEBNext Ultra II ™ Q5 master mix), amplifying all cfDNA molecules in a sample together. Amplified DNA libraries were again purified using SPRI beads (Ampure XP), in preparation for target enrichment or total genome sequencing (WGS) using standard preparation techniques.
[00340] Target capture and enrichment: DNA samples can be enriched using commercially available protocols, for example, SureSelect ^XT Target Enrichment System for Illumina Multiplexed Sequencing.
[00341] Example 3: CDKN2A methylation profile [00342] The DNA methylation profile in conjunction with fragmentomic data was used to differentially capture methylated regions (DMR) in the CDKN2A gene. The CDKN2A gene is a tumor suppressor gene that encodes proteins p16INK4A and p14ARF, evolved in cell cycle regulation. A sample of cfDNA was fractionated in hypomethylated and hypermethylated divisions using MBD-affinity purification. After fractionation, the nucleic acid molecules in
Petition 870190078052, of 12/08/2019, p. 144/238
140/194 each group was sequenced to generate sequence readings. Sequence readings when mapped to a reference genome provide fragmentomic data which were then combined with sequence readings from each of the split divisions (Fig. 10). The CDKN2A gene showed an overall increase in coverage of the hypomethylated division compared to the hypermethylated division.
[00343] Example 4: Methylation profiles of normal and lung cancer samples [00344] As shown in Fig. 11, the MBD splitting process was applied to four samples of cfDNA from healthy donors (Norm13893, Norm13959, Norm13961, Norm13962) and two samples of cfDNA from lung cancer patients with high% ctDNA (LungAI 345402, LungA0516902), with varying input quantity (10 - 150ng cfDNA) and replicates (for example, 3 replicates). The samples were grouped hierarchically by the percentage of hypermethylated DNA across all genomic sites labeled on the panel. The percentage of hypermethylated DNA can be determined by dividing the number of free cell hypermethylated DNA fragments by the total number of free cell DNA fragments observed across all divisions. The panel is a custom gene panel that covers about 30 kb of genomic region. The panel also has a higher sensitivity for detecting different cancers, such as lung cancer, colorectal cancer, etc. Samples from healthy donors were pooled separately from samples from lung cancer patients. The individual lung cancer samples have distinct methylation profiles that have been additionally grouped separately (that is, replicates of each lung cancer sample are correctly identified and grouped together). See, for example, WO 2017/181146, October 19, 2017.
[00345] Example 5: Methylation profile using sequencing
Petition 870190078052, of 12/08/2019, p. 145/238
141/194 total genome [00346] The DNA methylation profile was integrated with fragmentomic data to determine abnormal fragmentation patterns and, consequently, altered chromatin structure in a clinical sample (Fig. 12A, Fig. 12B, and Fig. 12C). Nucleic acid molecules were derived from lung cancer patients. The nucleic acid molecules were fractionated using MBD-affinity purification in hypomethylated and hypermethylated divisions. After fractionation, the nucleic acid molecules in each division were sequenced to generate sequence readings. Sequence readings when mapped to a reference genome provide fragmentomic data. Fragmentomic data, such as genomic position, fragment length and coverage, was combined with the sequence readings for each division. As shown in Fig. 12A and Fig. 12B, a 600 bp region at the transcription start site (TSS) is an X axis and frequency or coverage is indicated on the Y axis. Fig.12C shows a fraction of hypermethylated fragments when compared to total fragments on the X axis and frequency on the Y axis. For example, in Fig. 12C, the fraction of hypermethylated fragments between total fragments is about 0.2 (that is, about 20%).
[00347] Example 6: Methylation profile of MOB3A and WDR88 [00348] The DNA methylation profile was integrated with fragmentomic data to determine differences in epigenetic regulations (Fig. 13A and Fig. 13B). The nucleic acid molecules were fractionated using MBD-affinity purification in hypomethylated and hypermethylated divisions. After fractionation, the nucleic acid molecules in each division were sequenced to generate sequence readings. Sequence readings when mapped to a reference genome provide fragmentomic data. Fragmentomic data, such as genomic position and coverage, was combined
Petition 870190078052, of 12/08/2019, p. 146/238
142/194 with sequence readings from each of the fractionated group.
[00349] The MOB3A gene may have unknown biochemical functions, and may be implicated in supporting tumor proliferation and growth. Heat maps, as in fig. 13A, show more coverage for a hypermethylated close-up site compared to the hypomethylated close-up site of TSS in samples from healthy individuals. The example provides an application of fractional combination groups with fragmentomic data to detect TSS markers of genes that may be indicative of cancer. These data show that fractionated groups (or divisions), hypermethylated and hypomethylated, provide better resolution for discerning methylation status across a genomic region, such as TSS. As described above, coverage in fractionated groups shows differences in methylation status through TSS. The example provides an application of fractionation of nucleic acid molecules to provide better resolution of methylation status through a gene.
[00350] The WDR88 gene can be implicated in cell cycle regulation, apoptosis and autophagy. Heat maps show more coverage for hypermethylated near departure site compared to TSS near hypomethylated departure site (Fig. 13B) in samples from healthy individuals. In addition, Fig. 13B shows that fractionated, hypermethylated and hypomethylated groups provide better regulation for discerning methylation status across a genomic region, such as TSS. As described above, coverage in fractionated groups shows differences in methylation status through TSS. The example provides an application of fractionation of nucleic acid molecules to provide better resolution of methylation status through a gene.
[00351] Example 7: Combination divisions methylation profilePetition 870190078052, of 12/08/2019, pg. 147/238
143/194 das and unfractionated sample [00352] Fig. 14A shows a heat map with unfractionated group coverage (no MBD) and recombined divisions after MBD-affinity division (total MBD), respectively on the X axis and Y axis. The divisions were recombined in silico after division into hyper and hypo-methylated divisions to form "hyper + hypo" or "total MBD". The heat map shows a linear correlation between coverage for no MBD and total MDB. Linear correlation indicates similar coverage and can provide similar resolution of methylation status through a genomic site. The level of resolution achieved by any MBD and / or total MBD may not be sufficient to distinguish differences in methylation status across a site, showing an unexpected division advantage based on the MBD's affinity.
[00353] Fig. 14B shows a heat map MVA graph with total MBD. The X-axis shows average fragments in total MBD (recombinant hyper and hypomethylated divisions) as (a + b) / 2, where a = total MBD and b ™ no MBD.
[00354] Example 8: Organization of nucleosome between recombined divisions (total MBD) and unfractionated sample [00355] As shown in Fig. 15, differences in distances between centers of nucleosome occupation to the total MBD (in silico hyper recombined divisions) and hypomethylated) and no BD (unfractionated) samples across a genomic region were plotted on the X axis. Differences in the distribution of distances between nucleosome occupation centers for samples of total MBD and no MBD across a genomic region were plotted on the Y axis , as indicated by “density”. The total MBD samples were prepared by recombining the hyper and hypomethylated divisions in silico. These results show that MBD division does not affect nucleosomal occupation.
Petition 870190078052, of 12/08/2019, p. 148/238
144/194 [00356] Example 9: MBD signal validation [00357] Split MDB samples were used to discern nucleosomal occupation in healthy and cancer samples. In this example, blood samples from six lung cancer patients and three healthy non-malignant adults were obtained. Free cell nucleic acids from the samples were extracted and divided using MBD affinity purification in hyper- and hypo-methylated divisions. The nucleic acid samples were sequenced using total genome sequencing. The percentage of hypermethylated fragments for each division and for all samples was determined. Fig. 16 shows MBD signal in hyper- and hypo-methylated divisions of lung cancer patients (lines 1 and 2 from the top) and healthy adults (lines 3 and 4). As shown in Fig. 16, free cell DNA fragments from lung cancer patients show enrichment of distal intragenic regions in hypermethylated division (LungSigHyper) when compared to the hypermethylated division of healthy individuals. In addition, the distribution of characteristics at the top 5% higher percentage of 'hypermethylated peaks (LungSigHyper) and hppomethylated peaks (LungSigHypo) shows significant enrichment of hppomethylated peaks in all exons beyond exon 1 (Fig. 16, lines 1 and 2).
[00358] Example 10: Methylation profile of AP3D1 gene [00359] The methods described here were used for lung cancer prognosis. In one experiment, a sample with nucleic acid molecules from a lung cancer patient was fractionated into hypomethylated and hypermethylated divisions using MBD affinity purification. As a control, a sample was not divided (no MBD). The samples were sequenced using total genome sequencing.
[00360] The AP3D1 gene can encode subunit of complex of
Petition 870190078052, of 12/08/2019, p. 149/238
145/194
AP-3 delta-1 that may be involved in organelle transport. The heat maps show more coverage for hypermethylated division compared to hypomethylated division and / or no MBD close to TSS (Fig. 18A). The hypermethylated division showed stronger coverage and / or more localized coverage than the group of no MBD. As shown in the heat map, the hypermethylated division has a stronger localized coverage close to the TSS, while the group of no MBD has similar coverage across the genomic region. The average percentage of hypermethylation was also determined as indicated by the red line in Fig. 18B. The example may provide an application of fractionation of nucleic acid molecules to provide better resolution of methylation status through a gene. These results show that the AP3D1 gene is hypermethylated especially close to TSS (Fig. 18A) and that the AP31 gene is hypermethylated (> 60% as shown in Fig. 18B). Deregulation of the AP3D1 gene may be involved in causing lung cancer. Thus, this example can provide an application for this method in the prognosis of lung cancer by monitoring an individual's methylation profile.
[00361] Example 11: DNMT1 gene methylation profile [00362] In another example, the DNMT1 gene methylation profile was examined. The DNMT1 gene encodes an enzyme that catalyzes the transfer of methyl groups to specific CpG dinucleotides in DNA. DNMT1 has been implicated in maintaining DNA methylation to ensure the replication fidelity of hereditary epigenetic patterns. Aberrant methylation patterns can be associated with cancers and developmental abnormalities.
[00363] Heat maps for hypermethylated, hypo-mediated and no MBD are shown with respect to TSS (Fig. 19A). The division
Petition 870190078052, of 12/08/2019, p. 150/238
146/194 hypermethylated showed stronger coverage and / or more localized coverage than the group of no MBD. The hypermethylated division has a localized coverage and a stronger coverage close to the TSS, while no group of MBD has similar coverage through the gene. The average percentage of hypermethylation was also determined as indicated by the red line in Fig. 19B to be about 75%. These results show that the DNMT1 gene is hypermethylated especially close to TSS (Fig. 19A), and that the DNMT1 gene is hypermethylated (about 75% as shown in Fig. 19B). Aberrant methylation patterns coupled with changes in chromatin structure can result in dysregulation of DNMT1 which may be involved in causing lung cancer. Thus, this example can provide an application for this method in the prognosis of lung cancer by monitoring an individual's methylation profile. The example may also provide an application of fractionation of nucleic acid molecules to provide better resolution of methylation status through a gene.
[00364] Example 12: Modified histone fractionation [00365] This example demonstrates division using the modified histone approach. DNA is divided based on histone modification. Soon, agarose beads are blocked with BSA and, after washing, the beads are pre-incubated with antibodies against H3K9me3 and H4K20me3 (Millipore, Temecula, CA, USA) for 4 h at 4 ° C. Subsequently, 200 μΙ of plasma is diluted in 800 μΙ of the split dilution buffer and is then added to the pelleted agarose beads that have been pre-incubated with antibodies. After overnight incubation at 4 ° C, the beads are washed with low salt, high salt, LiCI and Tris / EDTA buffers. Finally, the chromatin is eluted by incubating the beads at 65 ° C, and the proteins are removed by tr
Petition 870190078052, of 12/08/2019, p. 151/238
147/194 proteinase K treatment. The split DNA is then purified using an appropriate purification kit and stored at - “20 ° C.
[00366] Example 13: Fractionation based on protein bound regions [00367] This example demonstrates the division approach using a protein based region. DNA is divided based on differences in protein A binding. The nucleic acid molecules in a sample can also be fractionated based on protein binding regions. For example, nucleic acid molecules can be fractionated into different groups based on the nucleic acid molecules that are linked to a specific protein, and those that are not linked to that specific protein. The nucleic acid molecules can be fractionated based on the binding of DNAprotein. Protein-DNA complexes can be fractionated based on a specific protein property. Examples of such properties include various epitopes, modifications (for example, histone methylation or acetylation), or enzymatic activity. Examples of proteins that can bind to DNA and serve as a basis for fracking may include, for example, protein A or protein
G. Experimental procedures, such as immuno-chromatin precipitation, are used to fractionate nucleic acid molecules based on protein A binding regions.
[00368] Example 14: Hydroxymethylation based fracking [00369] This example demonstrates division using a modified histone approach. DNA is divided based on hydroxymethylation. Briefly, 5-hmC-modified bases are glycosylated in vitro. Specific glycosylation of 5-hmC is performed by the following protocol of the enzyme 5-hmC Highly active glycosyltransferase from Zymo Research (zymoresearch, com / epigenetics / dna-hydroxymethylation / 5-hmc
Petition 870190078052, of 12/08/2019, p. 152/238
148/194 glycosyltransferase). J-Binding Protein-1 (JBP-1) binds specifically to glycosylated DNA with high affinity, allowing levels of 5hmC to be determined by enrichment based on JBP-1. In addition, 5-hmC glycosylation alters DNA digestion by various restriction enzymes, and therefore, 5-hmC ~ glycosylated DNA digestion patterns can be used to assess hydroxymethylation status of DNA.
[00370] Example 15: Fractionation based on isolation of nucleic acid molecules [00371] The nucleic acid molecules in a sample are fractionated based on isolation. For example, ssDNA and dsDNA are divided into two groups. These groups are subjected to a sequencing test, either individually or simultaneously. A nucleic acid sample having both ssDNA and dsDNA is fractionated by not subjecting the sample to a denaturation step during fractionation. The denaturation step converts dsDNA to ssDNA, and does not allow fractionation of the nucleic acid molecules based on isolation.
[00372] Example 16: Molecular division of ssDNA and dsDNA with modified pre-amplification target capture protocol (NEBNext Direct) [00373] A new hybrid capture methodology, in which a pre-amplification hybrid capture target sequencing protocol (for example, NEBNext Direct HotSpot Cancer Panel), was applied to a sample of free cell DNA (cfDNA) without DNA denaturation, capturing ssDNA molecules (Fig. 18). The unbound fraction containing dsDNA molecules was isolated, denatured to ssDNA, and applied to the capture protocol.
[00374] The pre-amplification hybrid capture sequencing protocol used was the NEBNext Direct HotSpot Cancer Panel, con
Petition 870190078052, of 12/08/2019, p. 153/238
149/194 having baits for 190 common cancer targets of 50 genes, involving approximately 40 kb of sequence, and including over 18,000 COSMIC characteristics (NEBNext Direct HotSpot Cancer Panel; neb.com/products/e7000-nebnext-direct-cancer- hotspot-panel). Briefly, the NEBNext Direct target enrichment approach quickly hybridizes DNA samples to biotinylated oligonucleotide baits, which define the 3'-end of each target of interest. The bait target hybrids were linked to the streptavidin beads, and enzymatic reactions were used to remove target sequence 37 Prep from subsequent library converts the targets into Illumina-compatible libraries that include molecular tagsand from a sample barcode. The use of the kit allows capture of all ssDNA and dsDNA molecules in a sample by denaturing the DNA sample before hybridization with baits.
[00375] A sample of cfDNA containing ssDNA and dscfDNA was subjected to a target capture protocol omitting the step of denaturing dsDNA in advance. The captured ssDNA molecules were prepared by NGS using the NEBNext protocol (left column in Fig.20), while the supernatant from the capture was applied to a second target capture protocol, with a step of denaturing the standard anticipated dsDNA and subsequently prepared by NGS (right hill in Fig. 20). CfDNA extracted from plasma was quantified by measurement based on electrophoresis. A sample volume equivalent to 200 ng or 500 ng was applied to the NEBNExt Direct HotSpot Cancer Panel assay, omitting the DNA denaturation step, such that only ssDNA molecules hybridize to the baits. The capture supernatant, containing dsDNA molecules and non-targeting ssDNA molecules, was retained and subjected to a second target capture (Figure 20). Both ssDNA and dsDNA libraries were prepared separately by NGS, with barcode
Petition 870190078052, of 12/08/2019, p. 154/238
150/194 sample that are identified in the analysis of bioinformatics to the Judge. Both prepared ssDNA and dsDNA libraries were sequenced on an Illumina NextSeq 500 (2 x 75 paired ends) and the total number of target molecules (corresponding to 40kb baits) was computed (Fig. 1).
[00376] A sample of free cell DNA (cfDNA) with both single-cell free cell DNA (ss-cfDNA) and double-cell free cell DNA (ds ~ cfDNA) was fractionated into groups of ss-cfDNA and ds-cfDNA, respectively, using the method described above (Fig. 20). In two of the sequenced samples, the ssDNA library contains -80% of the dsDNA (target molecules, first 200 ng and second 500 ng cfDNA input). The second 200 ng of cfDNA fails to produce both ssDNA and dsDNA libraries, and indicates a probable error in sample processing downstream of the ssDNA / dsDNA division process, while the first 500 ng of cfDNA input produces dsDNA library significant only, which suggests that the relative amount of ssDNA and dsDNA in a cfDNA sample was variable. The target molecules were computed as defined by the Broad Institute's Picard package (Picard metrics; broadinstitute.github.io/picard/picard-metric-definitions.html). The PCR produced for this experiment was shown in Fig. 20. A relative PCR yield produced for ssDNA / PCR yield for dsDNA, was determined to be between 20% and 75% for all four samples.
[00377] Example 17: Detection of sensory somatic mutation retained with MBD-based methylation division method [00378] Sample collection and collection [00379] Samples were selected from the Guardant Health repository that showed high cfDNA yield. Clinical samples were prepared by mixing 96 samples in equal volumes. This
Petition 870190078052, of 12/08/2019, p. 155/238
151/194 serves as a test material for assay sensitivity for mutation detection, as meetings contain reference genome mutations at <0.02% to 100%. Two different clinical samples (PowerpoolVI and PowerpoolV2) with single component samples were prepared.
[00380] DNA division [00381] Powerpool cfDNA was divided into multiple fractions. cfDNA (15 or 150 ng) was divided into hypermethylated, methylated intermediate and hypomethylated fractions using the MethylMiner ™ affinity enrichment protocol (Thermo Fisher Scientific, Cat # ME10025), except that reaction conditions were modified using 300 mM NaCI incubation and wash buffer, and protocol for a microgram of DNA entry was scaled linearly for submicrogram of DNA entries.
[00382] Sphere preparation [00383] Dynabeads® M-280 Streptavidin wash [00384] Dynabeads® M-280 Streptavidin were washed using IXBind / Wash Buffer (containing 160 mM NaCI) before coupling with MBD-Biotin Protein . Soon, the stock of Dynabeds® M-280 Streptavidin was resuspended to obtain a homogeneous suspension. For each microgram of incoming DNA, 10 μί of spheres were added to a 1.7 ml DNase-free micro centrifuge tube. The volume of the sphere was brought to 100 μΙ with IXBind / Wash Buffer. The tube was placed on a magnetic support for 1 minute to concentrate all of the spheres on the inner wall of the tube before the liquid was removed and discarded. The tube was removed from the magnetic support, and an equal volume (for example, about 100250 μΙ) of IXBind / Wash Buffer was added to resuspend the spheres. The resuspended spheres were concentrated and washed once more before proceeding with the coupling of MBD-Biotin ProPetição 870190078052, of 12/08/2019, p. 156/238
152/194 theine to the spheres.
[00385] Coupling Dynabeads® M-280 Streptavidin with MBD-Biotin Protein [00386] For each microgram of incoming DNA, 7 μ! (3.5 pg) of MBD-Biotin Protein were added to a 1.7 ml DNase-free micro centrifuge tube. The ball volume was brought to 100 pl with IXBind / Wash Buffer containing 300 mM NaCI. The MBD-Biotin Protein was diluted and transferred to the resuspended ball tube from the initial ball wash. The ball-protein mixture was mixed in a rotary mixer at room temperature for 1 hour, before washing the MBD-balls.
[00387] Washing of the MBD-beads [00388] The tube containing the MBD-beads was concentrated by placing the MBD-beads on a magnetic support for 1 minute. The liquid was removed and discarded. The spheres were resuspended with 100-250 µl IXBind / Wash Buffer containing 160 mM NaCI and mixed in a rotary mixer at room temperature for 5 minutes. The spheres were concentrated, washed, and resuspended as described above two more times. The tube was then placed in the magnetic support for 1 minute, and the liquid was carefully removed and discarded. The beads were resuspended with 10 µl of 1X DNA capture buffer (containing 300 mM NaCI) for each µ of streptavidin beads used.
[00389] Capture of fragmented methylated DNA in MBDespheres [00390] Incubation of MBD-spheres with fragmented DNA [00391] In general, the incoming DNA can vary from 5 ng-1 pg. The control reaction typically uses 1 pg of K-562 DNA. To a 1.7 ml clean DNase-free micro centrifuge tube or PCR tube, fragmented sample DNA, for example, 5 ng-1 pg, was added
Petition 870190078052, of 12/08/2019, p. 157/238
153/194 to the tube, with an equal volume of 2xDNA capture buffer (containing 300mM NaCI), and the final volume was brought to 100 or 200 μΙ with 1xDNA capture buffer. The DNA / Buffer mixture was transferred to the tube containing the MBD-spheres and mixed in a rotary mixer for 1 hour at room temperature. Alternatively, the mixture can be mixed overnight at 4 ° C.
[00392] Collection of uncaught DNA from the sphere solution [00393] Uncaught DNA / unmethylated DNA was collected from the mixture of DNA and MBD-beads. Briefly, the tube containing a mixture of DNA and MBD-spheres was placed on the magnetic support for 1 minute to concentrate all of the spheres, and the soapy liquid was removed and saved in a clean DNase-free micro centrifuge tube. This saved supernatant liquid is the un-captured DNA supernatant / fraction of unmethylated DNA, and can be stored on ice. The beads were washed with 200 μ! 1X DNA Capture Buffer containing 300 mM NaCI in a rotary mixer for 3 minutes. The spheres were concentrated as described above, and the supernatant liquid containing uncaught DNA / unmethylated DNA / hypomethylated DNA was removed, saved and stored on ice as described above. The spheres were washed, mixed, concentrated with the supernatant removed and saved one more time to collect two wash fractions. Each wash fraction was stored on ice. The washing fractions can be combined together and labeled accordingly.
[00394] Elution of captured DNA [00395] The captured DNA was eluted using an elution buffer containing 2000 mM NaCI. The spheres were resuspended in 200 μΙ of elution buffer (2000 mM NaCI). The spheres were incubated in a rotary mixer for 3 minutes, and placed in the holder
Petition 870190078052, of 12/08/2019, p. 158/238
154/194 magnetic for 1 minute to concentrate all of the spheres, and the liquid containing captured DNA / hypermethylated DNA was removed and saved in a clean DNase-free micro centrifuge tube. The first saved fraction was stored on ice. The spheres were resuspended and incubated one more time, and the liquid containing captured DNA / methylated DNA was removed and saved in a second clean tube. The first and second collection of captured DNA / hypermethylated DNA were collected and stored on ice. Alternatively, multiple elutions with increased NaCI concentration can be performed for further division of the DNA into fraction with increased DNA methylation.
[00396] Preparation of methylated fractionated DNA for analysis [00397] split cfDNA, methylated DNA, intermediate methylated DNA and non-methylated DNA was purified, for example, by SPRI sphere cleaning (Ampure XP, Beckman Coulter), subsequently prepared for connection (using NEBNext® Ultra ™ End Repair / dATailing Module), then connected with modified Y-shaped dsDNA adapters containing non-random molecular barcodes, as described in Lanman et al., 2015. The divisions of hypermethylated cfDNA, Intermediate methylated and hypomethylated were linked with 11, 12, and 12 distinct non-random molecular barcode adapters, respectively. Linked cfDNA molecules bound to each sample were again purified with SPRI beads (Ampure XP), then re-combined in a PCR reaction with universal oligos for all bound adapter molecules (NEBNext Ultra II ™ Q5 master mix), amplifying all the cfDNA molecules in a sample together. The amplified DNA libraries were again purified using SPRI beads (Ampure XP), in preparation for target enrichment by hybrid capture. 870190078052, of 12/08/2019, p. 159/238
155/194 brida (Agilent SureSelect 30kb panel; ‘panel’).
[00398] The preparation of undivided DNA for analysis [00399] cfDNA Powerpool (10 or 150 ng) was prepared for ligation (using NEBNext® Ultra ™ End Repair / dA-Tailing Module), then connected with dsDNA adapters in modified Y-shape containing non-random molecular bar codes as described in Lanman et al., 2015. The cfDNA was linked with 35 distinct non-random bar code adapters. Bound cfDNA molecules for each sample were again purified with SPRI beads (Ampure XP), then placed in a PCR reaction with universal oligos for all molecules bound by adapter (NEBNext Ultra II ™ Q5 master mix), amplifying all cfDNA molecules of a sample together. The amplified DNA libraries were again purified using SPRI beads (Ampure XP), in preparation for target enrichment by hybrid capture (Agilent SureSelect 30kb panel; ‘panei’).
[00400] The disclosure provides methods for processing the nucleic acid population containing different forms (for example, RNA and DNA, single-stranded or double-stranded), and / or extensions of modification (for example, cytosine methylation, association with proteins). These methods accommodate multiple forms and / or modifications of nucleic acid in a sample, such that sequence information can be obtained for multiple forms. The methods also preserve the identity of multiple forms or modified states through processing and analysis, such that sequence analysis can be combined with epigenetic analysis.
[00401] Data analysis [00402] DNA libraries from different samples were assembled and sequenced in an Illumina HiSeq2500, 2x150 paired terminal sequencing. Bioinformatics processing was performed
Petition 870190078052, of 12/08/2019, p. 160/238
156/194 as per the standard protocol of GUARDANT360 ™ as described in Lanman et al, 2015 and anywhere here. For MBD-divided samples, additionally, molecular bar codes were used to identify the MBD-division in which the DNA was fractionated (hypermethylated, intermediate methylated, and hypometllated). At each genomic site directed by the panel, the aligned molecules that were hypermethylated, intermediate methylated and hypomethylated were totaled. The% hypermethylated was defined at a given site as the fraction of total molecules that comprise the site are hypermethylated. For both samples of divided MBD and undivided DNA, in targeted regions, fraction of allele mutant (MAF) from the reference genome was named using proprietary variant Guardant Health called software.
[00403] Example 18: Comparison between coverage for MBD samples and non-MBD samples in the targeted sequencing assay [00404] In this example, the samples were processed as described in Example 17. Different clinical samples (PowerpoolVI and PowerpoolV2) from cfDNA were tested in the directed sequencing assay with and without the MBD-division, 'MBD' and 'non-MBD', in triplicates respectively. The unique molecules sequenced in each genomic position directed to the genes from the panel were compared in the MBD and Non-MBD for PowerpoolVI at 15 ng (Fig. 25A) and 150 ng (Fig. 25B) from assay entry. The panel is a custom gene panel that covers about 30 kb genomic region. The panel also has a higher sensitivity for detecting different cancers, such as lung cancer, colorectal cancer, etc. Fig. 25A and Fig. 25B show high efficiency recovery of molecules in directed sequencing assay was retained with application of MBD-division. Sequence assay molecule counts
Petition 870190078052, of 12/08/2019, p. 161/238
157/194 directed from powerpoolVI (a) 15ng and (b) 150ng input, or operate with (Y axis) or without MBD-division. A linear correlation is observed between the MBD for non-MBD molecule counts or coverage, indicating that the MBD-division does not provide assay recovery.
[00405] The molecule or cover counts for the genes from the panel were compared between the non-MBD and MBD samples. MBD and non-MBD samples were prepared using 15 ng of incoming cfDNA extracted from two clinical samples (Fig. 26APowerpoolVI and Fig. 26B - PowerpoolV2), or using 150 ng of incoming cfDNA extracted from two clinical samples (Fig. 27A - PowerpoolV1; Fig. 27B - PowerpoolV2). The X axis for the graph on the left represents molecule or cover counts, the X axis for the graph in the center represents confirmed mutant with both paired terminal readings (double-strand overlap; DSO) and the X axis for the graph on the left represents counts of molecule for which both strands of DNA are sequenced (double-stranded support; DS). A strong correlation between MBD and non-MBD samples for molecule counts, DSO and DS shows that MBD samples can capture many of the molecules (-94% as in Fig. 26A, -8085% as in Fig. 26B and Fig. 27A and -90% as in Fig. 27B) when compared to non-MBD. No positional inclination in molecular coverage, as well as another important variant called metrics (DSO, DS) across the panel.
[00406] Example 19: Sensitivity and specificity of variant detection in MBD and non-MBD samples [00407] In this example, the samples were processed as described in Example 17. To measure the impact on the detection of variant or mutation in sensitivity and specificity , the fraction of mutant allele (MAF) between the MBD (Y axis) and non-MBD (X axis) samples was
Petition 870190078052, of 12/08/2019, p. 162/238
158/194 were compared for the genes in the panel using 15 ng of input cfDNA. Different MAF ranges are plotted on the X axis, for example, 0-100% (Fig. 28A), 0-5% (Fig. 28B) and 0-0.5% (Fig. 28C). MAF values are from MBD and non-MBD triplicate samples. MAFs determined for MBD samples were in accordance with MAFs determined for Non-MBD samples. MAFs between MBD and nonMBMB show a linear correlation for PowerpoolVI with 15 ng input input (Fig. 28A; 0-100%) and a lower detection limit (Fig. 28B; 0-5%). MAFs between MBD and non-MBD do not correlate well below the detection limit (Fig. 28C; 0- 0.5% MAF). Similarly, samples of MBD and non-MBD show agreement in MAFs with 150 ng cfpool input (Fig. 29A and Fig. 29B) from PowerpoolVI, but there is no strong agreement in the range of 0-0.5% (Fig. 29C ).
[00408] Example 20: Methylation profile of promoter region using total genome sequencing [00409] Split molecular samples can enhance genome architecture analysis such as occupation and detection of cancer-free cell DNA. For example, relevant transcription hypermethylation events can be detected by taking the occupation of a free cell DNA fragment into account when analyzing the tumor suppressor gene promoting regions that are usually targeted by cancer via methylation-triggered gene sequencing. . One can examine the signal occupation of free cell DNA fragment and hypermethylated fraction in different MBD divisions to validate the viability of MBD-triggered discovery of relevant transcription hypermethylation events and gene silencing in cancer samples.
[00410] According to the illustrative example, publicly available gene code data (v26lift37) can be used to produce percentage of hypermethylated (number of fragments in hi division)
Petition 870190078052, of 12/08/2019, p. 163/238
159/194 permethylated / total number of fragments in all MBD divisions) in TSS regions of all gene code genes within the available cohort of healthy non-malignant adults. The free cell DNA fragment occupancy signal can be aggregated across a cohort of healthy non-malignant adults. All TSSs can be deposited based on the percentage of hypermethylated fraction observed in an MBD split assay. The fragment occupation in a non-MBD WSG cohort in each deposit can be examined. Fig. 23 shows correlation of gene expression and methylation status. Shown is the occupation of WGS in the promoter profile versus the percentage of methylation of MBD. As seen in Fig. 23, hypomethylated DNA (0-0.1% hyper) has low fragment occupation coverage in the vicinity of TSS, while hypermethylated DNA (10-50% hyper or> 50% hyper) has high coverage of fragment occupation and distinct NDR in the neighborhood of TSS. In some cases, hypomethylated DNA fragment occupation coverage is used to normalize sequence depth and / or sequence mapping. The percentage of hypermethylated or hypomethylated nucleic acid fragments can be determined by dividing the number of hypermethylated or hpomethylated free cell fragments by the total number of free cell DNA fragments observed across all divisions.
[00411] Example 21: Comparison between methylation levels in MBD samples and total genome bisulfite (WGBS) sequencing samples [00412] To assess the methylation levels of fragments in various divisions prepared using the MBD protocol , a well characterized sample, NA12878 (catalog.coriell.org/0/Sections/Search/Sample_Detail.aspx ReficandoGM12878), was used. The sample was divided into hyper-, hypo- and intermediate
Petition 870190078052, of 12/08/2019, p. 164/238
160/194 methylated ria, followed by recombination of the in silico divisions (MBD sample), as described in Example 1. The MBD sample was compared to a publicly available standard methylation data set (basespaceJllumina.com/data central (HiSeq 4000: TruSeq DNA Methylation (NA12878, 1x151), which uses total genome bisulfite sequencing (WGBS). WGBS interrogates the methylation status of individual cytosines. Fig. 31 shows the correlation of the average methylation level as measured by WGBS ( X-axis) and MBD (Y-axis) in windows of 160 bp The level of methylation of MDB was computed by dividing the number of readings in the hypermethylated division that falls in that window divided by the total number of readings in the hyper and hypo-methylated divisions. The methylation level of WGBS was computed by dividing the number of methylated bases by the number of methylated and non-methylated bases in the window.This experiment was carried out for several proportions different ball es that affect the division of methylated fragments. Few spheres restrict hypermethylated division to highly methylated fragments (that is, make the assay more specific for methylation), and more spheres decrease the amount of methylation needed to obtain a fragment in the hyper division (that is, make the assay more sensitive to methylation) ). Empirically, the ratio of input DNA: 1:50 spheres was found to correlate between the divided fragments and their methylation levels. These results indicate that the MBD division does not accurately reflect the underlying methylation status of the samples.
[00413] In this analysis, the effect of the number of CG sites on a fragment in that fragment division was determined. The fragments that are publicly available with a standard methylation data set (NA12878; same as in the previous analysis) that indicates highly hyper- or hypomethylated (total genome bisulfite sequencing methylation level> 90% or <10%, as calculated)
Petition 870190078052, of 12/08/2019, p. 165/238
161/194 of the previous analysis) were selected for analysis. These fragments were stratified by the number of CG sites that they contained. Highly methylated fragments with 3 or more GC sites terminate in the hypermethylated division, indicating that the assay is sensitive to small amounts of methylation (FIG. 31A). Conversely, fragments devoid of methylation were divided predominantly into the hypomethylated division regardless of the number of GC sites in the fragment, indicating that the assay has a high degree of specificity (FIG. 31B).
[00414] While preferred embodiments of the present disclosure have been shown and described here, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will take place for those technicians in the subject without escaping the revelation. It should be understood that several alternatives to the embodiments of the disclosure described herein can be employed in the practice of disclosure. The following claims are intended to define the scope of the disclosure, and that methods and structures within the scope of these claims and their equivalents are thereby covered.
[00415] SOME ACCOMPLISHMENTS OF THE INVENTION.
[00416] Provided below are some embodiments of the invention provided in the form of a patent claim.
1. A method of analyzing a nucleic acid population comprising at least two forms of nucleic acid selected from double-stranded DNA, single-stranded DNA, and single-stranded RNA, the method, in which each of the at least two forms comprises a plurality of molecules, comprising:
(a) linking at least one of the nucleic acid forms with at least one labeled nucleic acid to distinguish the forms from each other,
Petition 870190078052, of 12/08/2019, p. 166/238
162/194 (b) amplifying the nucleic acid forms at least one of which is linked to at least one nucleic acid tag, in which the nucleic acids and linked nucleic acid tag, are amplified, to produce amplified nucleic acids, of the which ones amplified from at least one form are labeled;
(c) assay amplified nucleic acid sequence data at least some of which are tagged; in which the assay obtains sufficient sequence information to decode the labeled nucleic acid molecules from the amplified nucleic acids to reveal the nucleic acid forms in the population that provides an original model for the amplified nucleic acids attached to the labeled nucleic acid molecules for which sequence data was tested.
1A. The method according to claim 1, further comprising the step of decoding the labeled nucleic acid molecules from the amplified nucleic acids to reveal the forms of nucleic acids in the population that provides an original model for the amplified nucleic acids attached to the molecules of tag nucleic acid for which sequence data was assayed.
The method according to claim 1, further comprising enriching at least one of the forms relating to one or more of the other forms.
The method according to claim 1, in which at least 70% of the molecules of each form of nucleic acid in the population are amplified in step (b).
4. The method according to claim 1, in which at least three forms of nucleic acid are present in the population, and at least two of the forms are linked to different forms of
Petition 870190078052, of 12/08/2019, p. 167/238
163/194 label nucleic acid that distinguish each of the three forms from each other.
The method according to claim 4, in which each of the at least three forms of nucleic acid in the population is linked to a different tag.
The method according to claim 1, in which each molecule is similarly linked to a tag comprising the same identification of tag information.
7. The method according to claim 1, in which molecules are similarly attached to different types of tags.
8. The method according to claim 1, in which step (a) comprising: subjecting the population to reverse transcription with a labeled primer, in which the labeled primer is incorporated into the generated RNA cDNA in the population.
The method according to claim 8, in which the reverse transcription is sequence specific.
10. The method according to claim 8, in which reverse transcription is random.
The method according to claim 8, further comprising degrading RNA duplexed to the cDNA.
12. The method of claim 4, further comprising separating single-stranded DNA from double-stranded DNA, and attaching nucleic acid tag to the double-stranded DNA.
The method according to claim 12, in which the single-stranded DNA is separated by hybridization to one or more capture probes.
The method according to claim 4, further comprising circularizing single-stranded DNA with a clclase, and attaching nucleic acid tag to double-stranded DNA.
Petition 870190078052, of 12/08/2019, p. 168/238
164/194
The method according to claim 1, comprising, prior to the assay, assembling labeled nude acids comprising different forms of nucleic acid.
16. The method according to any of the preceding claims, in which the population of nucleic acid is a sample of body fluid.
17. The method according to claim 16, in which the body fluid sample is blood, serum, or plasma.
18. The method according to claim 1, in which the nucleic acid population is a cell-free nucleic acid population.
19. The method according to claim 17, in which the sample of body fluid is from an individual suspected of having cancer.
20. The method according to claims 1-19, in which the sequence data indicates the presence of a somatic variant or germline variant.
21. The method according to claims 1-20, in which the sequence data indicates the presence of a copy number variation.
22. The method according to claims 1-21, in which the sequence data indicates the presence of a single nucleotide variation (SNV), indel, or gene fusion.
23. A method of analyzing a nucleic acid population comprising nucleic acids with different extensions of modification, comprising:
contacting the nucleic acid population with an agent that preferably binds to nucleic acids supporting the modification,
Petition 870190078052, of 12/08/2019, p. 169/238
165/194 separating an agent-linked first nucleic acid pool from a non-agent-linked second nucleic acid pool, in which the first nucleic acid pool is overrepresented for modification, and the nucleic acids in the second pool are overrepresented for the modification;
linking the nucleic acids at the first meeting and / or the second meeting to one or more nucleic acid tags that distinguish the nucleic acids at the first meeting and the second meeting to produce a population of labeled nucleic acids;
amplifying the labeled nucleic acids, in which the nucleic acids and the attached tags are amplified;
test amplified nucleic acid sequence data and linked tags; in which the assay obtains sequence data for decoding the tags to reveal whether the nucleic acids for which sequence data was assayed were amplified from models at the first or second meeting.
23A. The method according to claim 23, comprising the step of decoding the tags to reveal whether the nucleic acids for which sequence data was tested were amplified from models at the first or second meeting.
24. The method of claim 23, wherein the modification is binding of nucleic acids to a protein.
25. The method of claim 23, wherein the protein is a histone or transcription factor.
26. The method of claim 23, wherein the modification is a post-replication modification to a nucleotide.
27. The method of claim 26, wherein the post-replication modification is 5-methyl cytosine, and the extension of
Petition 870190078052, of 12/08/2019, p. 170/238
166/194 binding of the agent to nucleic acids increases with the extension of 5-methyl cytosines in the nucleic acid.
28. The method of claim 26, in which the post-replication modification is 5-hydroxymethyl-cytosine, and the extent of binding of the agent to the nucleic acid increases with the extension of 5-hydroxymethyl-cytosine in the nucleic acid.
29. The method of claim 26, wherein the post-replication modification is 5-formylcytosine, or 5-carboxylcytosine, and the extent of binding of the agent increases with the extension of 5-formylcytosine, or 5-carboxyl-cytosine in the nucleic acid.
30. The method of claim 23, further comprising washing the agent-bound nucleic acids, and collecting the wash as a third pool including post-replication nucleic acids to an intermediate extent relative to the first and second pools.
31. The method of claim 23, comprising, prior to the assay, pooling the labeled nucleic acids from the first and second pools.
32. The method of claim 23, wherein the agent is magnetic spheres of 5-methyl binding domain.
33. The method according to any of the preceding claims, in which the population of nucleic acid is a sample of body fluid.
34. The method according to claim 33, in which the body fluid sample is blood, serum, or plasma.
35. The method of claim 23, in which the nucleic acid population is a cell-free nucleic acid population.
Petition 870190078052, of 12/08/2019, p. 171/238
167/194
36. The method according to claim 33, in which the sample of body fluid is from an individual suspected of having cancer.
37. The method according to claims 23-36, in which the sequence data indicates the presence of a somatic variant, or germline line variant.
38. The method according to claims 23-37, in which the sequence data indicates the presence of a copy number variation.
39. The method of any 23-38, in which the sequence data indicates the presence of a single nucleotide (SNV) variation, indel, or gene fusion.
40. A method of analyzing a nucleic acid population in which at least some of the nucleic acids include one or more modified cytosine residues, comprising linking capture fractions to nucleic acids in the population, whose nucleic acids serve as models for amplification;
perform an amplification reaction to produce amplification products from the models;
separate connected models to capture amplification product tags;
test sequence data of linked models to capture tags by bisulfite sequencing; and test sequence data for the amplification products.
41. The method of claim 40, wherein the capture fractions comprise biotin.
42. The method according to claim 41, in which the separation is carried out by contacting the models with streptavidin beads.
Petition 870190078052, of 12/08/2019, p. 172/238
168/194
43. The method of claim 40, in which the modified cytosine residues are 5-methyl-cytosine, 5-hydroxymethyl cytosine, 5-formyl cytosine, or 5-carboxyl cytosine.
44. The method of claim 40, wherein the capture fractions comprise biotin bound to the nucleic acid tags including one or more modified residues.
45. The method according to claim 40, in which the capture fractions are linked to the nucleic acid in the population, via a cleavable link.
46. The method of claim 45, in which the cleavable link is a photocleavable link.
47. The method of claim 45, in which the cleavable link comprises a uracil nucleotide.
48. The method according to any of the preceding claims, in which the nucleic acid population is a sample of body fluid.
49. The method according to claim 48, in which the body fluid sample is blood, serum, or plasma.
50. The method of claim 40, wherein the nucleic acid population is a cell-free nucleic acid population.
51. The method according to claim 48, in which the body fluid sample is from an individual suspected of having cancer.
52. The method according to any of the preceding claims, in which the sequence data indicates the presence of a somatic variant, or germline variant.
53. The method according to any of the preceding claims, in which the sequence data indicates the presence of a variation in the number of copies.
Petition 870190078052, of 12/08/2019, p. 173/238
169/194
54. The method according to any of the preceding claims, in which the sequence data indicates the presence of a single nucleotide variation (SNV), indel, or gene fusion.
55. A method of analyzing a nucleic acid population comprising nucleic acids with extensions other than 5-methylation, comprising:
(a) contacting the nucleic acid population with an agent that preferably binds to methylated 5-nucleic acids;
(b) separating a first nucleic acid pool linked to the agent from a second nucleic acid pool not linked to the agent, in which the first nucleic acid pool is overrepresented for 5-methylation, and the nucleic acids in the second meeting are overrepresented for 5 -methylation;
(c) attaching the nucleic acids at the first meeting and / or the second meeting to one or more nucleic acid tags that distinguish the nucleic acids at the first meeting and at the second meeting, in which the nucleic acid tag linked to the nucleic acids at the first meeting comprises a capture fraction (for example, biotin);
(d) amplifying the labeled nucleic acids, in which the nucleic acids and the attached tags are amplified;
(e) separating amplified nucleic acids that support the capture fraction from amplified nucleic acids that do not support the capture fraction; and (f) testing separate amplified nucleic acid sequence data.
Petition 870190078052, of 12/08/2019, p. 174/238
170/194
56. A method of analyzing a nucleic acid population comprising nucleic acids with different extensions of modification, comprising:
contacting nucleic acids in the population with adapters to produce a population of nucleic acids flanked by the adapters comprising primer binding sites;
amplifying nucleic acids flanked by adapters initiated from the primer binding sites;
contacting the amplified nucleic acids with an agent that preferably binds to the nucleic acids that support the modification, separating a first assembly of nucleic acids linked to the agent from a second assembly of nucleic acids not linked to the agent, in which the first assembly of acids nucleic acids are overrepresented for modification, and nucleic acids in the second meeting are overrepresented for modification;
perform parallel amplifications of labeled nucleic acids in the first and second meetings;
test amplified nucleic acid sequence data in the first and second meetings.
57. A method of analyzing a nucleic acid population in which at least some of the nucleic acids include one or more modified cytosine residues, comprising contacting the nucleic acid population with adapters comprising a primer binding site comprising a modified cytosine for forming nucleic acids flanked by adapters;
Petition 870190078052, of 12/08/2019, p. 175/238
171/194 amplify nucleic acids flanked by adapters initiated from the primer binding sites on adapters flanking a nucleic acid:
dividing the amplified nucleic acids into first and second aliquots;
test sequence data on the nucleic acids of the first aliquot;
contacting the nucleic acids of the second aliquot with bisulfite, which converts unmodified C's to U;
amplify the nucleic acids resulting from bisulfite treatment initiated from the primer binding sites that flank the nucleic acids, in which U's introduced by bisulfite treatment are converted to Ts, test sequence data on the amplified nucleic acids from the second aliquot ;
compare the nucleic acid sequence data in the first and second aliquots to identify which nucleotides in the nucleic acid population have been modified cytosines.
58. The method according to claim 56 or 57, in which the adapters are hair clip adapters.
59. A method, comprising:
(a) physically fractioning DNA molecules from a human sample to generate two or more divisions;
(b) apply differential molecular tags and NSG capability adapters to each of the two or more divisions to generate molecular labeled divisions;
Petition 870190078052, of 12/08/2019, p. 176/238
172/194 (c) test the labeled molecular divisions on an NGS instrument to generate sequence data for sample deconvolution into molecules that have been differentially divided.
60. The method according to claim 59, further comprising analyzing the sequence data by deconvolution of the sample into molecules that have been differentially divided.
61. The method according to claim 59, in which the DNA molecules are from extracted blood plasma.
62. The method of claim 59, in which physical fractionation comprises fractionation of molecules based on varying degrees of methylation.
63. The method of claim 61, in which varying degrees of methylation comprise hypermethylation and hypomethylation.
64. The method of claim 59, in which physical fractionation comprises fractionation with methyl binding domain protein ("MBD") ~ spheres to stratify at various degrees of methylation.
65. The method of claim 59, wherein the differential molecular tags are different sets of molecular tags corresponding to a division of MBD.
66. The method of claim 59, in which physical fractionation comprises separating DNA molecules using immunoprecipitation.
67. The method of claim 59, further comprising re-combining two or more molecular labeled fractions of the generated molecular labeled fractions.
68. The method of claim 66, further comprising enriching recombinant molecular tagged fractions or groups.
Petition 870190078052, of 12/08/2019, p. 177/238
173/194
69. A method for identifying the molecular tag of MBD-fractionated sphere libraries through NGS, comprising:
(a) physical fractionation of a DNA sample extracted using a methyl sphere binding domain protein purification kit, saving all elutions for downstream processing;
(b) parallel application of differential molecular tags and NSG enabling adapter sequences for each fraction or group;
(c) re-combining all labeled molecular fractions or groups, and subsequent amplification using adapter-specific DNA primer sequences;
(d) enrichment / hybridization of recombinant and amplified total libraries, tagging genomic regions of interest;
(e) re-amplification of the enriched total DNA library, attaching a sample tag;
(f) gathering different samples, and rehearsing them in multiplex on an NGS instrument; in which NGS sequence data produced by the instrument provides sequence of the molecular tags being used to identify unique molecules, and sequence data for sample devolution in molecules that have been differentially divided MBD.
69A. The method according to claim 69, comprising performing analysis of NGS data, with the molecular tags being used to identify unique molecules, as well as des
Petition 870190078052, of 12/08/2019, p. 178/238
174/194 sample convolution into molecules that were differentially divided MBD.
70. A method, comprising:
(a) providing a population of nucleic acid molecules obtained from a body sample from an individual;
(b) fractioning the population of nucleic acid molecules based on one or more characteristics to generate a plurality of groups of nucleic acid molecules, (c) differentially labeling nucleic acid molecules in the plurality of groups to distinguish the nucleic acid molecules in each of the plurality of groups among themselves based on one or more characteristics;
(d) sequencing the plurality of groups of nucleic acid molecules to generate sequence readings; containing sufficient data to generate relative information about nucleosome positioning, nucleosome modification, or DNA-protein interaction binding for each of the plurality of groups of nucleic acid molecules.
70A The method of claim 70, further comprising analyzing the sequence readings to generate relative information on nucleosome positioning, nucleosome modification, or DNA-protein interaction linkage for each of the plurality of groups of nucleic acid molecules .
71. A method, comprising:
(a) providing a population of nucleic acid molecules obtained from a body sample from an individual;
(b) fractionating the population of nucleic acid molecules based on the methylation state to generate a plurality of groups of nucleic acid molecules;
Petition 870190078052, of 12/08/2019, p. 179/238
175/194 (c) differentially labeling nucleic acid molecules in the plurality of groups to distinguish the nucleic acid molecules in each of the plurality of groups among themselves based on one or more characteristics;
(d) sequencing the plurality of groups of nucleic acid molecules to generate sequence readings; in which the sequencing readings are sufficient to detect one or more characteristics in one of the plurality of groups of nucleic acid molecules, in which the one or more characteristics is indicative of nucleosome positioning, nucleosome modification, or a protein interaction of DNA.
A. The method according to claim 71, comprising analyzing the sequence readings to detect one or more characteristics in one of the plurality of groups of nucleic acid molecules, in which the one or more characteristics is indicative of nucleosome positioning, nucleosome modification, or a DNA protein interaction.
72. A method, comprising:
providing a population of nucleic acid molecules obtained from a body sample from an individual;
(a) fractioning the population of nucleic acid molecules to generate the plurality of groups of nucleic acid molecules comprising free cell nucleic acids bound to the protein;
(b) differentially labeling nucleic acid molecules in the plurality of groups to distinguish the nucleic acid molecules in each of the plurality of groups among themselves based on one or more characteristics;
(c) sequencing the plurality of groups of nucleic acid molecules to generate sequence readings; in which the sequence information obtained is sufficient to map the sequence readings
Petition 870190078052, of 12/08/2019, p. 180/238
176/194 at one or more locations in a reference sequence; and to analyze sequence readings to detect one or more characteristics in one of the plurality of groups of nucleic acid molecules, in which the one or more characteristics is indicative of nucleosome positioning, nucleosome modification, or a DNA protein interaction .
72A. The method according to claim 72, further comprising mapping the sequence readings to one or more locations in a reference sequence; and analyzing sequence readings to detect one or more characteristics in one of the plurality of groups of nucleic acid molecules, in which the one or more characteristics is indicative of nucleosome positioning, nucleosome modification, or a DNA protein interaction.
73. One method, comprising:
providing a population of nucleic acid molecules obtained from a body sample from an individual;
(a) fractioning the population of nucleic acid molecules based on one or more characteristics to generate the plurality of groups of nucleic acid molecules;
(b) differentially labeling nucleic acid molecules in the plurality of groups to distinguish the nucleic acid molecules in each of the plurality of groups among themselves based on one or more characteristics;
(c) sequencing the plurality of groups of nucleic acid molecules to generate sequence readings; in which the sequence information obtained is sufficient to map the sequence readings in one or more locations in a reference sequence; and analyzing sequence readings to detect one or more characteristics in one of the plurality of groups of nucleic acid molecules, in which one or more characteristics are not capable
Petition 870190078052, of 12/08/2019, p. 181/238
177/194 of detection in a meeting of sequence readings from the plurality of groups.
73A. The method according to claims 73, further comprising mapping the sequence readings to one or more locations in a reference sequence; and analyzing the sequence readings to detect one or more characteristics in one of the plurality of groups of nucleic acid molecules, in which one or more characteristics are not capable of detection in a pool of sequence readings from the plurality of groups.
74. The method according to any of claims 70-72, in which the one or more features comprises a quantitative feature of the mapped readings.
75. The method according to any of claims 69-73, in which the fractionation comprises physical fractionation.
76. The method according to claim 69 or 72, in which the population of nucleic acid molecules is divided based on one or more characteristics selected from the group consisting of: methylation state, glycosylation state, histone modification , length and start / stop position.
77. The method according to any of claims 69-72, further comprising bringing together the nucleic acid molecules of (b).
78. The method of claim 69 or 72, wherein one or more characteristics is methylation.
79. The method of claim 77, wherein fractionation comprises separating methylated nucleic acids from non-methylated nucleic acids using proteins comprising a methyl binding domain to generate groups of nucleic acid molecules comprising varying degrees of methylation.
Petition 870190078052, of 12/08/2019, p. 182/238
178/194
80. The method of claim 78, in which one of the groups comprises hypermethylated DNA.
81. The method of claim 78, in which at least one group is characterized by a degree of methylation.
82. The method of claim 72, wherein fractionation comprises separating single-stranded DNA molecules and / or double-stranded DNA molecules.
83. The method of claim 81, wherein the double-stranded DNA molecules are separated using hairpin adapters.
84. The method of claim 69 or 72, in which fractionation comprises isolating protein-bound nude acids.
85. The method according to any of claims 69-72, in which fractionation comprises fractionation based on a difference in a mono-nudeosomal profile.
86. The method according to any of claims 69-72, in which fractionation is capable of generating different mononucleosomal profiles for at least one group of nucleic acid molecules when compared to a normal one.
87. The method of claim 85, wherein the isolation comprises immunoprecipitation.
88. The method according to any of claims 69-72, further comprising fractionating at least one group of nucleic acid molecules based on a different characteristic.
89. The method according to any of claims 69-72, in which the analysis comprises, in one or more locations, comparing a first characteristic corresponding to a first
Petition 870190078052, of 12/08/2019, p. 183/238
179/194 group of nucleic acid molecules with a second characteristic corresponding to a second group of nucleic acid molecules.
90. The method according to any of claims 70-72, in which the analysis comprises analyzing a characteristic of one or more characteristics in a group relative to a normal sample in one or more locations.
91. The method according to any of claims 70-72, in which the one or more characteristics are selected from the group consisting of: a frequency called the base in a base portion in the reference sequence, a number of molecules that map to a base or sequence in the reference sequence, a number of molecules having a starting location that maps to a base portion in the reference sequence, and a number of molecules having a stop location that maps to a portion of based on the reference sequence, and a length of a molecule that maps to a location in the reference sequence.
92. The method according to any of claims 70-72, further comprising (f) using a trained classifier to classify the Individual based on one or more characteristics.
93. The method of claim 91, in which the trained classifier classifies one or more characteristics as associated with a tissue in the individual.
94. The method of claim 91, in which the trained classifier classifies one or more characteristics as associated with a type of cancer in the individual.
95. The method according to claims 70-72, in which one or more characteristics are indicative of gene expression or state of a disease.
Petition 870190078052, of 12/08/2019, p. 184/238
180/194
96. The method according to any of claims 69-72, in which the nucleic acid molecules are circulating the tumor DNA.
97. The method according to any of claims 69-72, in which the nucleic acid molecules are free cell DNA ("cfDNA").
98. The method according to any of claims 69-71, in which the one or more features is a cancer marker.
99. The method according to any of claims 69-72, in which the tags are used to distinguish different molecules in the same sample.
100. A method, comprising:
(a) providing a population of nucleic acid molecules obtained from a body sample from an individual;
(b) fractioning the population of nucleic acid molecules based on one or more characteristics to generate plurality of groups of nucleic acid molecules, in which the nucleic acid molecules of each of the plurality of groups comprise distinct identifiers;
(c) bringing together the plurality of groups of nucleic acid molecules;
(d) sequencing the plurality of assembled groups of nucleic acid molecules to generate plurality of sets of sequence readings; and (e) fractionate the sequence readings based on the identifiers.
101. A composition, comprising a pool of nucleic acid molecules comprising differently labeled nucleic acid molecules, in which the pool comprises a
Petition 870190078052, of 12/08/2019, p. 185/238
181/194 plurality of sets of nucleic acid molecules that are differently labeled based on one or more characteristics selected from the group consisting of: methylation status, glycosylation status, histone modification, length and start / stop position, in the which the meeting is derived from a biological sample.
102. The composition of claim 101, wherein the plurality of sets is any of 2, 3, 4, 5 or more than
5.
103. One method, comprising:
(a) splitting a population of nucleic acid molecules into a plurality of groups, the plurality of groups comprising nucleic acids that differ by one characteristic;
(b) labeling the nucleic acids in each of the plurality of groups with a set of labels that distinguish the nucleic acids in each of the plurality of groups to produce a population of labeled nucleic acids, in which each of the labeled nucleic acids comprises one or more labels ;
(c) sequencing the labeled nucleic acid population to generate sequence readings, in which the sequence readings allow the use of one or more tags to group each group of sequence readings; and analyzing the sequence readings to detect a signal in at least one of the groups relative to a normal sample or a classifier.
103A. The method according to claim 103, further comprising using one or more tags to group each group of sequence readings; and analyzing the sequence readings to detect a signal in at least one of the groups relative to a normal sample or a classifier.
Petition 870190078052, of 12/08/2019, p. 186/238
182/194
104. The method of claim 102, further comprising normalizing the signal in at least one of the groups against another group, or a total genome sequence.
105. A method comprising:
i. provide a population of free cell DNA from a biological sample:
ii. fractionating the free cell DNA population based on a characteristic that is present at different levels in free cell DNA derived from cancer cells compared to non-cancer cells, thereby generating subpopulations of free cell DNA;
iii. amplify at least one of the subpopulations of free cell DNA; and iv. sequence at least one of the amplified subpopulations of free cell DNA.
106. The method according to claim 104, in which
the feature is: i.il.iii. the methylation level of free cell DNA;the level of glycosylation of free cell DNA;the length of the free cell DNA fragments; oriv. the presence of single chain breaks in the DNA of cells free squid.107. One method, comprising:
I. providing a population of free cell DNA from a biological sample;
ii. fractionating the free cell DNA population based on the methylation level of the free cell DNA, thereby generating subpopulations of free cell DNA;
Petition 870190078052, of 12/08/2019, p. 187/238
183/194. amplify at least one of the subpopulations of free cell DNA; and iv. sequence at least one of the amplified subpopulations of free cell DNA.
108. A method for determining the methylation status of free cell DNA comprising:
i. providing a population of free cell DNA from a biological sample;
ii. fractionating the free cell DNA population based on the level of free cell DNA methylation, thereby generating subpopulations of free cell DNA;
m. sequencing at least one subpopulation of free cell DNA, thereby generating sequence readings:
iv. assign a methylation state to each free cell DNA depending on the subpopulation of the corresponding sequence readings that occur.
109. A method of classifying an individual in which the method comprises:
i. providing a population of free cell DNA from a biological sample from the individual;
ii. fractionating the free cell DNA population based on the methylation level of the free cell DNA, thereby generating subpopulations of free cell DNA;
iii. sequencing the subpopulations of free cell DNA, thereby generating sequence readings; and iv. use a trained classifier to classify the individual, depending on which sequence readings occur in the subpopulation.
Petition 870190078052, of 12/08/2019, p. 188/238
184/194
110. A method for analyzing the fragmentation pattern of free cell DNA comprising:
i. providing a population of free cell DNA from a biological sample;
ii. fractionate the free cell DNA population, thereby generating subpopulations of free cell DNA;
iii. sequencing at least one subpopulation of free cell DNA, thereby generating sequence readings;
iv. align sequence readings to a reference genome; and
v. determine the fragmentation pattern of free cell DNA in each subpopulation by analyzing any number of:
The. length of each sequence reading that maps to each base portion in the reference genome;
B. number of sequence readings that map to the base portion of the reference genome as a function of length of the sequence readings;
ç. number of sequence readings starting at each base portion in the reference genome; or
d. number of sequence readings ending at each base portion in the reference genome.
111.0 method according to claim 109, in which the population of free cell DNA is fractionated by one or more characteristics that provides a difference in signal between healthy and diseased states.
112. The method according to claim 110, in which the one or more characteristics comprise a chemical modification selected from the group consisting of: methylation, hydroxymethylation, formylation, acetylation, and glycosylation.
Petition 870190078052, of 12/08/2019, p. 189/238
185/194
113. The method according to any of the preceding claims, in which a ratio of DNA: sphere is 1: 100.
114. The method according to any of the preceding claims, in which the ratio of DNA: sphere is 1:50
115. The method according to any of the preceding claims, in which the ratio of DNA: sphere is 1:20
116. The method according to claim 109, in which the population of free cell DNA is fractionated based on the methylation level of the free cell DNA.
117. The method of claim 109, in which determining the fragmentation pattern of free cell DNA further comprises analyzing the number of sequence readings that map to each base portion in the reference genome.
118. The method according to claim 109, further comprising determining the fragmentation pattern of free cell DNA in each subpopulation by analyzing the number of sequence readings that map to each base portion in the reference genome.
119. The use of physical fractionation based on the degree of DNA methylation during analysis of circulating tumor DNA (ctDNA) to determine gene expression or disease status.
120. The use of a characteristic that provides a difference in signal between a normal state and a sick state to physically divide ctDNA during analysis of ctDNA.
121. The use of a characteristic that provides a difference in signal between a normal state and a sick state to physically divide ctDNA.
122. The use of a characteristic that provides a difference in signal between a normal state and a sick state for
Petition 870190078052, of 12/08/2019, p. 190/238
186/194 physically split ctDNA prior to sequencing and optional downstream analysis.
123. The use of a feature that provides a difference in signal between a normal state and a sick state to physically divide ctDNA for differential labeling / labeling.
124. The use of fractionation based on a differential fragmentation pattern during ctDNA analysis.
125. The use of a differential fragmentation pattern for dividing ctDNA.
126. The use of a differential fragmentation pattern for dividing ctDNA prior to sequencing and optional downstream analysis.
127. The use of a differential fragmentation pattern for dividing ctDNA for differential labeling / labeling.
128. The use according to claims 123-126, in which the pattern of differential fragmentation is indicative of gene expression or disease state.
129. The use according to claims 123-126, in which the pattern of differential fragmentation is characterized by one or more differences relative to a normal selected from the group consisting of:
(a) length of each sequence reading that maps to each base portion in the reference genome;
(b) number of sequence readings that map to the base portion of the reference genome as a function of length of the sequence readings;
(c) number of sequence readings that begin at each base portion in the reference genome; and
Petition 870190078052, of 12/08/2019, p. 191/238
187/194 (d) number of sequence readings ending at each base portion in the reference genome.
130. Use of differential molecular labeling of DNA molecules divided by molecular binding domain (MBD) spheres to stratify various degrees of DNA methylation, which are then quantified by next generation sequencing (NGS).
131. A method of analyzing a nucleic acid population comprising at least two forms of nucleic acid selected from double-stranded DNA, single-stranded DNA, and single-stranded RNA, the method, in which each of the at least two forms comprises a plurality of molecules, comprising:
(a) linking at least one of the nucleic acid forms with at least one labeled nucleic acid to distinguish the forms from each other, (b) amplifying the nucleic acid forms, at least one of which is linked to at least one label nucleic acid nucleic acid, in which the nucleic acids and linked nucleic acid tag, are amplified, to produce amplified nucleic acids, of which those amplified from at least one form are labeled;
(c) sequencing a plurality of the amplified nucleic acid that has been attached to the tags, in which the sequence data is sufficient to be encoded to actually form the nucleic acids in the population prior to binding to at least one tag.
132. A pool of labeled nucleic acid molecules, each nucleic acid molecule in the pool comprising a molecular tag selected from one of a plurality of tag sets, each tag set comprising a plurality of different tags, in which tags on any one
Petition 870190078052, of 12/08/2019, p. 192/238
188/194 sets are distinct from labels in any other set, and in which each set of labels contains information (I) indicating a characteristic of the molecule to which it is attached, or of the origin molecule from which the molecule is derived and (ii ) which, alone or in combination with information on the molecule to which it is attached, only distinguishes the molecule to which it is attached from other molecules labeled with tags of the same set of tags.
133. The assembly of labeled nucleic acid molecules according to claim 132, wherein the molecular tag comprises one or a plurality of nucleic acid bar codes.
134. The assembly of labeled nucleic acid molecules according to claim 133, wherein the molecular tag comprises two nucleic acid barcodes, fixed at opposite ends of the molecule.
135. The assembly of labeled nucleic acid molecules according to claim 134, in which a combination of any two bar codes in a set has different combined sequences than a combination of any two bar codes in any other set.
136. The assembly of labeled nucleic acid molecules according to claim 133, in which the bar codes are between 10 and 30 nucleotides in length.
137. The assembly of labeled nucleic acid molecules according to claim 132, wherein each label set comprises a plurality of different labels sufficient for only target molecules labeled by the label set, and having the same Start-stop coordinates , or having the same nucleotide sequence, or mapping to the same genomic coordinate.
Petition 870190078052, of 12/08/2019, p. 193/238
189/194
138. The pool of labeled nucleic acid molecules according to claim 132, wherein the plurality of label sets is 2, 3, 4, 5, 6 or more than 6.
139. The pool of labeled nucleic acid molecules according to claim 132, wherein the pool comprises molecules having tagged DNA sequences with tags from one set of tags, and molecules having tagged sequences from cDNA with tags from another set of tags. tag.
140. The assembly of labeled nucleic acid molecules according to claim 132, in which the characteristics of the molecules indicated by the label set include one or more of: DNA, RNA, single strand, double strand, methylated, non-methylated , methylation extension, or combinations of those mentioned above.
141. A system comprising:
a nucleic acid sequencer;
a digital processing device comprising at least one processor, an operating system configured to carry out executable instructions, and a memory; and a data link communicatively connecting the nucleic acid sequencer and the digital processing device;
in which the digital processing device further comprises executable instructions for creating an application for analyzing a nucleic acid population comprising at least two forms of nucleic acid selected from: double-stranded DNA, single-stranded DNA, and single-stranded RNA, each of at least two forms comprising a plurality of molecules, the application comprising:
Petition 870190078052, of 12/08/2019, p. 194/238
190/194 a software module receiving sequence data from the nucleic acid sequencer, via the data link, the amplified nucleic acid sequence data at least some of which are tagged, the sequence data generated by at least at least one of the forms of nucleic acid with at least one nucleic acid labeled to distinguish the forms from each other, amplifying the forms of nucleic acid at least one of which is linked to at least one nucleic acid tag, in which the nucleic acids and tags bound nucleic acid are amplified to produce amplified nucleic acids from which those amplified in at least one form are labeled; and a software module that tests the amplified nucleic acid sequence data by obtaining enough sequence information to decode the labeled nucleic acid molecules from the amplified nucleic acids to reveal the nucleic acid forms in the population that provides an original model for the amplified nucleic acids attached to the label nucleic acid molecules for which sequence data was tested.
142. The system of claim 141, in which the application additionally comprises a software module that decodes the labeled nucleic acid molecules from the amplified nucleic acids to reveal the nucleic acid forms in the population providing an original model for the acids amplified nucleic acids attached to the label nucleic acid molecules for which sequence data was assayed.
143. The system according to claim 141, in which the application additionally comprises a software module that transmits a test result, via a communications network.
144. A system comprising:
Petition 870190078052, of 12/08/2019, p. 195/238
191/194 a next generation sequencing instrument (NGS);
a digital processing device comprising at least one processor, an operating system configured to carry out executable instructions, and a memory; and a data link communicatively connecting the NGS instrument and the digital processing device:
in which the digital processing device additionally comprises executable instructions for creating an application comprising:
a software module to receive sequence data from the NGS instrument, via data link, the sequence data generated by physically fractioning DNA molecules from a human sample to generate two or more divisions, applying differential molecular tags and NSG training adapters to each of the two or more divisions to generate molecular labeled divisions, and test the molecular labeled divisions with the NGS instrument;
a software module for generating sequence data for deconvolution of the sample into molecules that have been differentially divided; and a software module for analyzing the sequence data by deconvolution of the sample into molecules that were differentially divided.
145. The system of claim 144, in which the application additionally comprises a software module that transmits a test result via a communications network.
146. A system comprising:
Petition 870190078052, of 12/08/2019, p. 196/238
192/194 a next generation sequencing instrument (NGS);
a digital processing device comprising at least one processor, an operating system configured to carry out executable instructions, and a memory; and a data link communicatively connecting the NGS instrument and the digital processing device;
in which the digital processing device additionally comprises instructions executable by at least one processor to create an application for molecular tag identification of MBD-fractional sphere libraries comprising:
a software module configured to receive sequence data from the NGS instrument, via data binding, the sequence data generated by physically fractionating a DNA sample extracted using a methyl-purification binding domain protein kit ball, saving all elutions for downstream processing; conducting parallel application of differential molecular tags and NSG-enabling adapter sequences for each fraction or group; re-combining all labeled molecular fractions or groups, and subsequent amplification using adapter-specific DNA primer sequences; conducting enrichment / hybridization of recombinant and amplified total libraries, labeling of genomic regions of interest; re-amplification of the enriched total DNA library, attaching a sample tag; gathering different samples; and testing them in multiplex on the NGS instrument; in which NGS sequence data produced by the Instrument provides sequence of the molecular tags being used to identify mo
Petition 870190078052, of 12/08/2019, p. 197/238
193/194 single molecules, and sequence data for sample devolution in the molecules that were differentially divided MBD; and a software module configured to perform sequence data analysis by using molecular tags to identify unique molecules, and sample deconvolution into molecules that were differentially divided into MBD.
147. The system according to claim 146, in which the application additionally comprises a software module configured to transmit an analysis result, via a communications network.
148. A system comprising:
a) a next generation sequencing instrument (NGS)
b) a digital processing device comprising at least one processor, an operating system configured to carry out executable instructions, and a memory; and
c) a data link communicatively connecting the NGS instrument and the digital processing device;
in which the digital processing device additionally comprises executable instructions for creating an application comprising:
i) a software module for receiving sequence data from the NGS instrument, via data link, the generated sequence data loaded with labeled nucleic acids prepared by contact of the nucleic acid population with an agent that preferably binds to the nucleic acids supporting the modification, separation of a first nucleic acid pool linked to the agent from a second nucleic acid pool not linked to the agent, in which the first nucleic acid pool is overrepresented for the modification, and the nucleic acids in the second
Petition 870190078052, of 12/08/2019, p. 198/238
194/194 of the meeting are underrepresented for modification; linking the nucleic acids at the first meeting and / or the second meeting to one or more nucleic acid tags that distinguish the nucleic acids at the first meeting and the second meeting to produce a population of labeled nucleic acids; amplification of labeled nucleic acids, in which nucleic acids and ligated tags are amplified; and testing of molecular labeled divisions with the NGS instrument;
ii) a software module for generating sequence data for decoding the tag; and iii) a software module for analyzing the sequence data to decode the tags to reveal whether the nucleic acids for which sequence data was tested were amplified from models at the first or second meeting.
149. The system of claim 148, further comprising a software module that transmits a test result, via a communications network.

权利要求:
Claims (41)
[1]
1. A method of analyzing a nucleic acid population comprising at least two forms of nucleic acid selected from double-stranded DNA, single-stranded DNA, and single-stranded RNA, the method, in which each of the at least two forms comprises a plurality of molecules, characterized by the fact of understanding:
(a) linking at least one of the nucleic acid forms with at least one label nucleic acid to distinguish the forms from each other, (b) amplifying the nucleic acid forms, at least one of which is attached to at least one tag nucleic acid, in which the nude acids and linked nucleic acid tag, are amplified, to produce amplified nude acids, of which those amplified from at least one form are tagged;
(c) test sequence data for amplified nude acids, at least some of which are labeled; where the assay obtains sufficient sequence information to decode the labeled nucleic acid molecules of the amplified nude acids to reveal the forms of nude acids in the population, providing an original model for the amplified nude acids attached to the labeled nucleic acid molecules for which sequence data were tested.
[2]
2. Method according to claim 1, characterized in that it additionally comprises the step of decoding the nucleic acid label molecules of the amplified nude acids to reveal the forms of nude acids in the population that provides an original model for the nude acids amplified
Petition 870190057556, of 06/21/2019, p. 12/49
2/7 linked to the label nucleic acid molecules for which sequence data were tested.
[3]
3. Method according to claim 1 or 2, characterized in that it additionally comprises enriching at least one of the forms relating to one or more of the other forms.
[4]
4. Method according to claim 1 or 2, characterized by the fact that at least 70% of the molecules of each form of nucleic acid in the population are amplified in step (b).
[5]
5. Method according to claim 1 or 2, characterized by the fact that at least three forms of nucleic acid are present in the population, and at least two of the forms are linked to different forms of labeled nucleic acid that distinguish each from three ways among themselves.
[6]
6. Method according to claim 5, characterized by the fact that each of the at least three forms of nucleic acid in the population is linked to a different label.
[7]
7. Method according to claim 1 or 2, characterized by the fact that each molecule is similarly attached to a tag comprising the same identification tag.
[8]
8. Method according to claim 1 or 2, characterized by the fact that molecules are similarly attached to different types of labels.
[9]
9. Method according to claim 1 or 2, characterized by the fact that step (a) comprises: subjecting the population to reverse transcription with a labeled primer, in which the labeled primer is incorporated into the generated RNA cDNA in the population .
[10]
10. Method according to claim 9, characterized by the fact that reverse transcription is sequence specific.
[11]
11. Method, according to claim 9, characterized by the fact that reverse transcription is random.
Petition 870190057556, of 06/21/2019, p. 13/49
3/7
[12]
12. Method according to claim 9, characterized in that it further comprises degrading duplexed RNA to the cDNA.
[13]
13. Method according to claim 5, characterized in that it further comprises separating single-stranded DNA from double-stranded DNA, and attaching the nucleic acid tag to double-stranded DNA.
[14]
14. Method according to claim 13, characterized in that the single-stranded DNA is separated by hybridization to one or more capture probes.
[15]
15. Method according to claim 5, characterized in that it further comprises circularizing the single-stranded DNA with a circligase, and attaching nucleic acid tags to the double-stranded DNA.
[16]
16. Method according to claim 1, characterized in that it comprises, prior to the assay, assembling labeled nucleic acids comprising different forms of nucleic acid.
[17]
17. Method according to claims 1-16, characterized by the fact that the nucleic acid population is from a sample of body fluid.
[18]
18. Method according to claim 17, characterized by the fact that the sample of body fluid is blood, serum, or plasma.
[19]
19. Method according to claim 1 or 2, characterized in that the nucleic acid population is a cell-free nucleic acid population.
[20]
20. Method, according to claim 18, characterized by the fact that the sample of body fluid is from an individual suspected of having cancer.
Petition 870190057556, of 06/21/2019, p. 14/49
4/7
[21]
21. Method, according to claims 1-20, characterized by the fact that the sequence data indicates the presence of a somatic variant or germline variant.
[22]
22. Method according to claims 1-21, characterized by the fact that the sequence data indicates the presence of a variation in the number of copies.
[23]
23. Method according to claims 1-22, characterized by the fact that the sequence data indicates the presence of a single nucleotide variation (SNV), indel, or gene fusion.
[24]
24. Method of analysis of a nucleic acid population comprising nucleic acids with different extensions of modification, characterized by the fact that it comprises:
contacting the nucleic acid population with an agent that preferably binds to the nucleic acids that support modification, separating a first pool of nucleic acids linked to the agent from a second pool of nucleic acids not bound to the agent, in which the first pool of acids nucleic acids are overrepresented for modification, and nucleic acids in the second meeting are overrepresented for modification;
linking the nucleic acids at the first meeting and / or the second meeting to one or more nucleic acid tags that distinguish the nucleic acids at the first meeting and the second meeting to produce a population of labeled nucleic acids;
amplifying the labeled nucleic acids, in which the nucleic acids and the attached tags are amplified;
test amplified nucleic acid sequence data and linked tags; where the assay obtains sequence data to decode the tags to reveal whether the nucleic acids for
Petition 870190057556, of 06/21/2019, p. 15/49
5/7 which sequence data were tested were amplified from models at the first or second meeting.
[25]
25. Method according to claim 24, characterized in that it comprises the step of decoding the tags to reveal whether the nucleic acids for which the sequence data was tested were amplified from models at the first or the second meeting.
[26]
26. Method according to claim 25 or 26, characterized in that the modification is binding of nucleic acids to a protein.
[27]
27. Method according to claim 25 or 26, characterized by the fact that the protein is a histone or transcription factor.
[28]
28. Method according to claim 25 or 26, characterized in that the modification is a post-replication modification to a nucleotide.
[29]
29. Method according to claim 27, characterized in that the post-replication modification is 5-methylcytosine, and the extent of binding of the agent to nucleic acids increases with the extent of 5-methylcytosines in the nucleic acid .
[30]
30. Method according to claim 27, characterized in that the post-replication modification is 5hydroxymethyl-cytosine, and the extent of binding of the agent to nucleic acid increases with the extension of 5-hydroxymethyl-cytosine in the nucleic acid .
[31]
31. Method according to claim 27, characterized in that the post-replication modification is 5 ~ formyl ~ cytosine or 5-carboxyl-cytosine, and the extent of binding of the agent increases with the extent of 5-formyl -cltosine or 5-carboxyl-cytosine in the nucleic acid.
Petition 870190057556, of 06/21/2019, p. 16/49
6/7
[32]
32. Method according to claim 25 or 26, characterized in that it additionally comprises washing nucleic acids bound to the agent, and collecting the wash as the third assembly including nucleic acids with the post-replication modification to an intermediate extent on the first and second meetings.
[33]
33. Method according to claim 25 or 26, characterized in that it comprises, prior to the assay, collecting labeled nucleic acids from the first and second meetings.
[34]
34. The method of claim 25 or 26, characterized by the fact that the agent is magnetic 5-domain binding spheres.
[35]
35. Method according to claims 24-34, characterized by the fact that the nucleic acid population is a sample of body fluid.
[36]
36. Method according to claim 35, characterized by the fact that the sample of body fluid is blood, serum, or plasma.
[37]
37. The method of claim 25 or 26, characterized in that the nucleic acid population is a cell-free nucleic acid population.
[38]
38. Method according to claim 35, characterized by the fact that the sample of body fluid is from an individual suspected of having cancer.
[39]
39. Method according to claims 25-38, characterized by the fact that the sequence data indicates the presence of a somatic variant or germline variant.
[40]
40. Method according to claims 25-39, characterized by the fact that the sequence data indicates the presence of a variation in the number of copies.
Petition 870190057556, of 06/21/2019, p. 17/49
ΊΠ
[41]
41. Method according to any one of claims 25-39, characterized in that the sequence data indicates the presence of a single nucleotide (SNV) variation, indel, or gene fusion, iv) nucleic acids, in which nucleic acids and linked tags are amplified; and testing of molecular labeled partitions with the NGS instrument;
v) a software module for generating sequence data to decode the tag; and vi) a software module for analyzing the sequence data to decode the tags to reveal whether the nucleic acids for which sequence data were tested were amplified from models at the first or second meetings.

类似技术:

---

公开号 | 公开日 | 专利标题

---

US20190390253A1|2019-12-26|Methods and systems for analyzing nucleic acid molecules

---

Salk et al.2018|Enhancing the accuracy of next-generation sequencing for detecting rare and subclonal mutations

---

RU2760913C2|2021-12-01|Methods for identifying lung cancer

---

JP6743268B2|2020-08-19|Synthetic nucleic acid spike-in

---

US11078475B2|2021-08-03|Methods of capturing cell-free methylated DNA and uses of same

---

JP2020527340A|2020-09-10|Methods and systems for assessing DNA methylation in cell-free DNA

---

KR20200032127A|2020-03-25|Cancer detection and classification using methylrom analysis

---

JP2019522487A|2019-08-15|Recovery of long-range linkage information from stored samples

---

US20200248272A1|2020-08-06|Compositions and methods for isolating cell-free dna

---

US20150126379A1|2015-05-07|Long insert-based whole genome sequencing

---

CN110622250A|2019-12-27|Method and system for detecting insertions and deletions

---

WO2017075784A1|2017-05-11|Biomarker for detection of lung adenocarcinoma and use thereof

---

CN111032868A|2020-04-17|Methods and systems for assessing DNA methylation in cell-free DNA

---

WO2020243722A1|2020-12-03|Methods and systems for improving patient monitoring after surgery

---

CN113227393A|2021-08-06|Methods, compositions, and systems for calibrating epigenetic zoning assays

---

JP2022519045A|2022-03-18|Compositions and Methods for Isolating Cell-Free DNA

---

TW202102687A|2021-01-16|Determining linear and circular forms of circulating nucleic acids

---

US11008616B2|2021-05-18|Correcting for deamination-induced sequence errors

---

ES2868074T3|2021-10-21|Methods for binding adapters to sample nucleic acids

---

US20200273538A1|2020-08-27|Computational modeling of loss of function based on allelic frequency

---

US20210115502A1|2021-04-22|Compositions and methods for analyzing cell-free dna in methylation partitioning assays

---

WO2021072275A1|2021-04-15|Use of cell free bacterial nucleic acids for detection of cancer

---

WO2021222828A1|2021-11-04|Methods for sequence determination using partitioned nucleic acids

---

Neiman2013|Methods for deep examination of DNA

---

Piro2020|Sequencing technologies for epigenetics: From basics to applications

同族专利:

---

公开号 | 公开日

---

AU2017382439A1|2019-06-20|

---

CA3046007A1|2018-06-28|

---

KR20190095410A|2019-08-14|

---

WO2018119452A3|2018-08-09|

---

US20190390253A1|2019-12-26|

---

JP2020504606A|2020-02-13|

---

EP3559270A2|2019-10-30|

---

IL267424D0|2019-08-29|

---

MX2019007444A|2019-08-16|

---

WO2018119452A2|2018-06-28|

---

CN110325650A|2019-10-11|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

US6582908B2|1990-12-06|2003-06-24|Affymetrix, Inc.|Oligonucleotides|

---

US20030017081A1|1994-02-10|2003-01-23|Affymetrix, Inc.|Method and apparatus for imaging a sample on a device|

---

US7208271B2|2001-11-28|2007-04-24|Applera Corporation|Compositions and methods of selective nucleic acid isolation|

---

US8835358B2|2009-12-15|2014-09-16|Cellular Research, Inc.|Digital counting of individual molecules by stochastic attachment of diverse labels|

---

PT2893040T|2012-09-04|2019-04-01|Guardant Health Inc|Systems and methods to detect rare mutations and copy number variation|

---

EP2805769A1|2013-05-24|2014-11-26|European Molecular Biology Laboratory|Methods for nano-scale single cell analysis|

---

WO2015159293A2|2014-04-14|2015-10-22|Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd.|A method and kit for determining the tissue or cell origin of dna|

---

JP2017522908A|2014-07-25|2017-08-17|ユニヴァーシティ オブ ワシントン|Method for determining tissue and / or cell type producing cell-free DNA, and method for identifying disease or abnormality using the same|

---

US10364467B2|2015-01-13|2019-07-30|The Chinese University Of Hong Kong|Using size and number aberrations in plasma DNA for detecting cancer|

---

US9984201B2|2015-01-18|2018-05-29|Youhealth Biotech, Limited|Method and system for determining cancer status|

---

US20190085406A1|2016-04-14|2019-03-21|Guardant Health, Inc.|Methods for early detection of cancer|

---

WO2017181161A1|2016-04-15|2017-10-19|Predicine, Inc.|Systems and methods for detecting genetic alterations|

---

WO2017184707A1|2016-04-19|2017-10-26|President And Fellows Of Harvard College|Immobilization-based systems and methods for genetic analysis and other applications|

---

EP3831958A1|2016-06-30|2021-06-09|Grail, Inc.|Differential tagging of rna for preparation of a cell-free dna/rna sequencing library|

---

US9850523B1|2016-09-30|2017-12-26|Guardant Health, Inc.|Methods for multi-resolution analysis of cell-free nucleic acids|PL2697397T3|2011-04-15|2017-08-31|The Johns Hopkins University|Safe sequencing system|

---

EP3610034A4|2017-04-12|2020-12-16|Karius, Inc.|Sample preparation methods, systems and compositions|

---

WO2019067092A1|2017-08-07|2019-04-04|The Johns Hopkins University|Methods and materials for assessing and treating cancer|

---

CN112752854A|2018-07-23|2021-05-04|夸登特健康公司|Methods and systems for modulating tumor mutational burden by tumor score and coverage|

---

EP3914736A2|2019-01-25|2021-12-01|Grail, Inc.|Detecting cancer, cancer tissue of origin, and/or a cancer cell type|

---

EP3918089A1|2019-01-31|2021-12-08|Guardant Health, Inc.|Compositions and methods for isolating cell-free dna|

---

WO2020176659A1|2019-02-27|2020-09-03|Guardant Health, Inc.|Methods and systems for determining the cellular origin of cell-free dna|

---

US20210017605A1|2019-05-31|2021-01-21|Guardant Health, Inc.|Methods and systems for improving patient monitoring after surgery|

---

WO2021032660A1|2019-08-19|2021-02-25|F. Hoffmann-La Roche Ag|Single tube preparation of dna and rna for sequencing|

---

US20210115502A1|2019-09-30|2021-04-22|Guardant Health, Inc.|Compositions and methods for analyzing cell-free dna in methylation partitioning assays|

---

WO2021127208A1|2019-12-20|2021-06-24|Accuragen Holdings Limited|Methods and systems for disease detection|

---

GB202000747D0|2020-01-17|2020-03-04|Institute Of Cancer Res|Monitoring tumour evolution|

---

WO2021202752A1|2020-03-31|2021-10-07|Guardant Health, Inc.|Determining tumor fraction for a sample based on methyl binding domain calibration data|

---

WO2021222828A1|2020-04-30|2021-11-04|Guardant Health, Inc.|Methods for sequence determination using partitioned nucleic acids|

---

WO2021231614A1|2020-05-12|2021-11-18|The Board Of Trustees Of The Leland Stanford Junior University|System and method for gene expression and tissue of origin inference from cell-free dna|

---

US20220025468A1|2020-05-14|2022-01-27|Guardant Health, Inc.|Homologous recombination repair deficiency detection|

---

WO2021236993A1|2020-05-22|2021-11-25|Bloodq, Inc.|Methods for characterizing cell-free nucleic acid fragments|

---

WO2022026761A1|2020-07-30|2022-02-03|Guardant Health, Inc.|Methods for isolating cell-free dna|

---

WO2022046947A1|2020-08-25|2022-03-03|Guardant Health, Inc.|Methods and systems for predicting an origin of a variant|

法律状态:
2021-10-13| B350| Update of information on the portal [chapter 15.35 patent gazette]|

优先权:

---

申请号 | 申请日 | 专利标题

---

US201662438240P| true| 2016-12-22|2016-12-22|

---

US201762512936P| true| 2017-05-31|2017-05-31|

---

US201762550540P| true| 2017-08-25|2017-08-25|

---

PCT/US2017/068329|WO2018119452A2|2016-12-22|2017-12-22|Methods and systems for analyzing nucleic acid molecules|

---